DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of group II (claims 7, 8, 10, 12, 24, 27-33, 80-83 and species (aptamer comprises a sequence configured to bind a nucleoporin protein (claims 29-33) in the reply filed on 7/21/26 is acknowledged. NOTE: claim 4 is a linking claim between groups I and II.
The claims directed to a non-elected invention were cancelled in the amendment filed on 7/21/26.
Claims 24 and 27-28 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 7/21/26.
Drawings
The drawings are objected to because Figure 11 is a color drawing. Applicant needs file an updated version of their drawings that do not contain color, since
the specification does not indicate drawings were submitted and
there is no Petition for entry of color drawings.
NOTE: the most recent drawings of record control. The most recent set do contain at least one color drawing.
If applicant intended to file color drawings:
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2).
Specification
The amendment to the specification filed on 7/21/26 has been entered.
The disclosure is objected to because of the following informalities: is a space missing in this limitation “a closed ended linear DNAclosed linear DNA” in paragraphs 166 and 183?
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 4, 7, 8, 10, 12, 80-83 and 298-299 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claimed invention embraces a nucleic acid comprising a cargo polynucleotide and a nuclear localization element (NLS), that is used in a method of expressing the nucleic acid in a target cell of the subject, wherein the NLS increases expression of the cargo polynucleotide in a target cell by at least 1.25 fold as compared to a nucleic acid lacking the NLS.
The specification provides examples of the term “a nuclear localization element’ (paragraph 27) and does not appear to provide a definition for the term “a nuclear localization element”. The broadest reasonable interpretation of the term embraces a an agent, including nucleic acid (aptamer), peptides, antibodies, small molecules (polyethylene glycol (PEG) liposomes) or nucleic acid encoding a peptide that deliver the cargo polynucleotide to the nucleus of a cell.
The specification contemplates NLS comprising a nucleic acid (aptamers). Paragraphs 131-133 discloses several elements (nucleolin, importin and nucleoporin aptamers) and their sequences (SEQ ID NOs: 3-47; 48; 49-50, respectively). The working examples described on pages 63-73 disclose that some of the aptamers (e.g., NUP 358 aptamer (SEQ ID NOs: 49-50), a nucleoporin aptamer) or comprising a sequence from the list in paragraphs 131-133 showed substantially higher signal, displayed a 2(3)-fold increase over the control.
The specification provides written description for importin aptamers, nucleolin aptamers, and nucleoporin aptamers that have the desired biological activity, wherein the NLS increases expression of the cargo polynucleotide in a target cell by at least 1.25 fold as compared to a nucleic acid lacking the NLS.
The prior art teaches the NLS are known in the prior art, including snRNA U6 hairpins (Berzal Herranz, US 20160017332 and Shrivastava et al. Nucleic Acid Therapeutics 26, 288-298, 2016, cited on an IDS). NLS could be a natural ligand and these ligands have been used for drug delivery. Jiang et al. (Molecular Therapy 24, 1581-1591, 2016) teach dumbbell-shaped DNA minimal vectors (db vectors) comprises a nucleic which is a closed linear DNA construct comprising a stem region comprising a double stranded DNA sequence covalently closed at both ends. Dumbbell-driven gene expression was enhanced to 56- to 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbell or plasmids (abstract). Figure 2b on page 1584 displayed results for studying nuclear dumbbell delivery.
In view of the prior art and description in the specification, the genus of NLS embraces a very large number of sequences and there is a substantial variation amongst species in the genus. The written description requirement for the claimed genus is not satisfied through sufficient description of a representative number of species. The contemplation of the genus of NLS and description of three sub-species of NLS aptamers does not adequately described and represent the entire genus. The specification does not teach an essential structure for the genus of NLS that would have the desired biological activity. While one of skill in the art can make or use an NLS embraced by the claimed method, the skilled artisan would further have to experiment with each NLS to determine if it had the desired biological activity.
In view of the foregoing, it is clear that the specification of the instant disclosure fails to convey to the skilled artisan that the applicant had possession of the claimed genus of NLS which increase expression of the cargo polynucleotide in the target cell by at least 1.25 fold in claims as of the effective filing date.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 30 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 30 recites the limitation "the nuclear pore complex" in line 2. There is insufficient antecedent basis for this limitation in the claim.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 4 and 10 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wittig et al. (US 20060194753). Wittig et al. teach introducing into a subject a DNA expression construct comprising one or more coding nucleic acid sequences, the DNA expression construct is covalently linked to one or more oligopeptides to increase transfection efficiency; and wherein the coding sequences are expression constructs consisting of covalently closed linear deoxyribonucleic acid molecules, having a linear double stranded region, wherein the double stranded forming single strands are linked by short single stranded loops of deoxyribonucleic acid nucleotides, wherein the double strand forming single strands consist only of a coding sequence under control of a promoter sequence operable in the subject and a terminator sequence; or the coding polynucleotide sequences are present as circular double stranded expression vectors; wherein each DNA expression construct is linked to an oligopeptide of 3 to 30 amino acids, where the oligopeptide consists half of basic amino acids selected from the groups arginine and lysine; the linked oligopeptides have the amino acid sequence YGRKKRRQRRR; and the linear covalently closed DNA expression constructs are modified with a peptide containing the nuclear localization sequence (NLS) of large T-antigen from SV40 PKKKRKV. See pages 22-23.
Although Wittig et al. is silent with respect to the limitation (wherein the nuclear localization element increases expression of the cargo polynucleotide in the target cell by at least 1.25(1.35) fold as compared to a nucleic acid lacking the nuclear localization signal) recite in the instant claim, Wittig et al. anticipates all of the claimed structural limitations, so the functional effects of the claimed product are considered to be inherent in the product taught by Wittig et al.
Where, as here, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his claimed product. See In re Ludtke 441 F.2d 660, 169 USPQ 563 (CCPA 1971). Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972).
Claims 4 and 10 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Szoka et al. WO 93/19768. Szoka teach a method of introducing a polynucleotide into a mammal comprising administering a composition comprising a) a polynucleotide, b) a cell recognition component capable of recognizing eukaryotic cell; c) a membrane-permeabilizing component; and d) a nuclear-localization component. See pages 5-7, 42 and 53-57.
Although Szoka et al. is silent with respect to the limitation (wherein the nuclear localization element increases expression of the cargo polynucleotide in the target cell by at least 1.25(1.35) fold as compared to a nucleic acid lacking the nuclear localization signal) recite in the instant claim, Szoka et al. anticipates all of the claimed structural limitations, so the functional effects of the claimed product are considered to be inherent in the product taught by Szoka et al. See In re Ludtke 441 F.2d 660, 169 USPQ 563 (CCPA 1971). Also see In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972).
Claims 4 and 10 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Berzal Herranz (US 20160017332). ‘332 disclose an aptamer flanked by two snRNA U6 hairpins to assist in nuclear localization of the aptamer and increase resistance to degradation by exonuclease. See paragraph 47.
Although ‘332 is silent with respect to the limitation (wherein the nuclear localization element increases expression of the cargo polynucleotide in the target cell by at least 1.25(1.35) fold as compared to a nucleic acid lacking the nuclear localization signal) recite in the instant claim, ‘332 anticipates all of the claimed structural limitations, so the functional effects of the claimed product are considered to be inherent in the product taught by ‘332. See In re Ludtke 441 F.2d 660, 169 USPQ 563 (CCPA 1971). Also see In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 4, 10, 12, 29-33, 80-83 and 298-299 are rejected under 35 U.S.C. 103 as being unpatentable over Jiang et al. (Molecular Therapy 24, 1581-1591, 2016) taken with Shrivastava et al. (Nucleic Acid Therapeutics 26, 288-298, 2016, cited on an IDS).
Jiang teaches dumbbell-shaped DNA minimal vectors (db vectors) improve non-coding and coding RNA expression. The db vector comprises a nucleic which is a closed linear DNA construct comprising a stem region comprising a double stranded DNA sequence covalently closed at both ends. Dumbbell-driven gene expression was enhanced to 56- to 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbell or plasmids (abstract). Figure 2b on page 1584 displayed results for studying nuclear dumbbell delivery. Nuclear delivery was enhanced up to 74- or 25-fold 10 minutes or 24 hours post-transfection compared with the plasmid pointing toward an accelerated rate of dumbbell diffusion from the cytoplasm to the nucleus (page 1583-1584. “Our study revealed significant advantage of dumbbell vectors over plasmids which were found to depend on the mode of delivery and the type of target cells (page 1587).”
The specification provides examples of the term “a nuclear localization element’ (paragraph 27) and does not appear to provide a definition for the term “a nuclear localization element”. The broadest reasonable interpretation of the term embraces a nucleic acid, small molecule, peptide that deliver the cargo polynucleotide to the nucleus of a cell. The db vector taught by Jiang would be embraced by the term.
However, Jiang does not specifically teach delivering to a subject a nucleic acid comprises a cargo polynucleotide and a nuclear localization element.
Shrivastava teaches aptamers targeting NUP358 protein (abstract). Intracellular targeted drug delivery to overcome toxicity and increase therapeutic effect has gained major attention (page 288). Targeting the nucleus would be expected to provide site-specific drug delivery and gene therapy. RNA aptamers that bind to the nucleus could act as a ligand for artificial ligand-mediated drug targeting. Shrivastava further teaches:
The nuclear envelope contains perforations, which are referred to as nuclear pores that participate in the import and export of macromolecules between the nucleus and cytoplasm. Each nuclear pore complex (NPC) contains eight filamentous nucleoporins called Nucleoporin358 or Nup358. NPC is a large complex of 125 MDa, acts as a barrier to macromolecules such as nucleic acids and various proteins, thus restricting their bidirectional traffic. See page 288.
Table 2 on page 6 discloses several sequences for NUPT aptamers. A DNA aptamer for the RNA labelled NupApt02 appears to be 100% identical to instant SEQ ID NO: 50.
Qy 1 CCACGCAGATAGACGCTACTCTACTACATCGCAGCCAAC 39
Db 1 CCACGCAGAUAGACGCUACUCUACUACAUCGCAGCCAAC 39
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Jiang taken with Shrivastava as a simple substitution to replace one end of the db vector or covalently linked the RNA aptamer targeting NUP358 to provide an additive effect for intracellularly delivery of the db vector to cells of the subject with a reasonable expectation of success. See MPEP 2143(I)A, F and G. It would have been obvious to try a DNA version of the NupApt02 (instant SEQ ID NO: 50) at one end of the db vector or attached to the db vector to study gene expression and whether this aptamer would be the optimal aptamer for nucleus delivery. See MPEP 2143(I)E. The db vector taught by Jiang would read on the structural limitations recited in instant claims 80-83 and 298.
With respect to the limitation (wherein the nuclear localization element increases expression of the cargo polynucleotide in the target cell by at least 1.25(1.35, 2.0) fold as compared to a nucleic acid lacking the nuclear localization signal) recite in the instant claims 1, 10 and 299, Jiang also teaches at least 2.0 fold increase in gene expression using db vectors. Furthermore, Jiang and Shrivastava makes obvious all of the claimed structural limitations, so the functional effects of the claimed product are considered to be inherent in the product made obvious by Jiang taken with Shrivastava. See also In re Ludtke 441 F.2d 660, 169 USPQ 563 (CCPA 1971) and In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972).
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 7 and 8 are rejected under 35 U.S.C. 103 as being unpatentable over Szoke (‘768) as applied to claims 4 and 10 above, and further in view of Fisher (US 2016010429).
Szoka does not specifically teach administering an ultrasonic acoustic energy and a sonoactive agent to the target cell of the subject.
However, Fisher teach a method for delivering composition comprising a biological agent to cancer cells (abstract). The agent can be confined to a specific cell compartment by targeting the agent to a specific subcellular compartment using a nuclear localization signal (paragraphs 120). The agent can be delivered to cancer cells using sonoporation, which used local application of ultrasound waves and administration of gas microbubbles to transiently increase the permeability of vessels and tissues (paragraph 155).
Fisher further teaches: A method for delivering a nucleic acid construct to cancerous cells in a subject, comprising the steps of: a. providing an ultrasound targeted microbubble population stably binding the nucleic acid construct; b. providing an ultrasound device capable of directing the microbubble population to the cancer cells; c. directing the microbubble population to the cancer cells with the ultrasound device; and d. bursting the microbubble population under conditions such that the nucleic acid construct is delivered to the cancer cells; wherein the nucleic acid construct comprises a first promoter operably linked to a gene encoding avidin or streptavidin, and a second promoter operably linked to a gene encoding a therapeutic agent, wherein the first promoter is cancer-selective. See claim 45 on pages 26-27.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Szoka taken with Fisher to use ultrasound targeted microbubbles to successfully deliver a composition polynucleotide and nuclear localization element to cancer cells of a subject. See MPEP 2143(I)A: Combining Prior Art Elements According to Known Methods To Yield Predictable Results.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Double Patenting
Claim 4 of this application is patentably indistinct from claim 4 of Application No. 19669889. Pursuant to 37 CFR 1.78(f), when two or more applications filed by the same applicant or assignee contain patentably indistinct claims, elimination of such claims from all but one application may be required in the absence of good and sufficient reason for their retention during pendency in more than one application. Applicant is required to either cancel the patentably indistinct claims from all but one application or maintain a clear line of demarcation between the applications. See MPEP § 822.
A rejection based on double patenting of the “same invention” type finds its support in the language of 35 U.S.C. 101 which states that “whoever invents or discovers any new and useful process... may obtain a patent therefor...” (Emphasis added). Thus, the term “same invention,” in this context, means an invention drawn to identical subject matter. See Miller v. Eagle Mfg. Co., 151 U.S. 186 (1894); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Ockert, 245 F.2d 467, 114 USPQ 330 (CCPA 1957).
A statutory type (35 U.S.C. 101) double patenting rejection can be overcome by canceling or amending the claims that are directed to the same invention so they are no longer coextensive in scope. The filing of a terminal disclaimer cannot overcome a double patenting rejection based upon 35 U.S.C. 101.
Claim 4 is provisionally rejected under 35 U.S.C. 101 as claiming the same invention as that of claim 4 of copending Application No. 19669889 (reference application). This is a provisional statutory double patenting rejection since the claims directed to the same invention have not in fact been patented.
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 7-8, 10, 12, 29-33, 80-83, and 298-299 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-298 of copending Application No. 19669889 (reference application). NOTE: the claims from ‘889 appear to be identical to the instant claims, but the dependency for the ‘899 claims are not disclosed. Although the claims at issue are not identical, they are not patentably distinct from each other because both set of claims embrace a method of delivering a nucleic acid to a target cell of a subject, the method comprising administering to the subject a nucleic acid comprising a cargo polynucleotide and a nuclear localization element, wherein the element comprises an aptamer configured to bind to a nucleoporin protein (NUP214, NUP88, NUP 358) or the nucleoporin protein comprises SEQ ID NO: 49 or 50, wherein the element increases expression of the cargo polynucleotide by at least 1.25 fold as compared to a nucleic acid lacking the element. Claims 7-8, 10, 12, 29-33, 80-83 of ‘889 recite the same structural limitations as the limitations in dependent claims 7-8, 10, 12, 29-33, and 80-83. Claims 198-199, 240-241, and 249-251 of ‘889 are obvious variants of new claims 298-299.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Allowable Subject Matter
Other than the provisional NSDP over co-pending application 19669889, SEQ ID NO: 49 in claim 33 is free of the prior art of record. A search of publicly available databases indicates that is no known sequence which is 100% identical to the sequence. NupApt01 (Db) taught in the prior art (Shrivastava, supra) is the closest prior art to instant SEQ ID NO: 49, but it is only 96% identical and there is no teaching or suggestion in the prior art to substitute any nucleotide in NupApt01 to arrive at instant SEQ ID NO: 49.
Qy 1 TGACAGTGGCGGCAGTCACTGAGAAAAACGAAACCGGAGC 40
Db 1 UGACAGUGGCGGCAGCCACUGAGAAAAACGAAACCGGAGC 40
Conclusion
See attached PTO-326 for disposition of claims.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
US20230075380 (cited on an IDS and WO2021152146, a publication for the international application for ‘380), teaches the closed linear DNA construct used in the working examples of the specification of the instant application. US20060105975 teaches aptamer-mediated intracellular delivery of therapeutic oligonucleotides.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636