Prosecution Insights
Last updated: October 04, 2026
Application No. 18/940,054

GENERATION OF SITE SPECIFIC INTEGRATION SITES FOR COMPLEX TRAIT LOCI IN CORN AND SOYBEAN, AND METHODS OF USE

Final Rejection §103§112
Filed
Nov 07, 2024
Priority
Sep 12, 2014 — provisional 62/049,465 +3 more
Examiner
ZHONG, WAYNESHAOBIN
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Corteva Agriscience LLC
OA Round
2 (Final)
72%
Grant Probability
Favorable
3-4
OA Rounds
12m
Est. Remaining
94%
With Interview

Examiner Intelligence

Grants 72% — above average
72%
Career Allowance Rate
393 granted / 544 resolved
+12.2% vs TC avg
Strong +22% interview lift
Without
With
+21.5%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
27 currently pending
Career history
566
Total Applications
across all art units

Statute-Specific Performance

§101
8.9%
-31.1% vs TC avg
§103
31.7%
-8.3% vs TC avg
§102
10.4%
-29.6% vs TC avg
§112
36.1%
-3.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 544 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of claims Claims 1-32 had/have been canceled. Independent claims 33 and 42 have been amended. In summary, claims 33-48 are pending and examined in this office action. All previous objections and rejections not set forth below have been withdrawn in view of Applicant’s amendment and/or upon further consideration. See “Response to Arguments” at the end of office action. The following rejections are repeated, modified and/or added for the reasons of record as set forth in the last Office action of 6/5/2026, and/or necessitated by the applicant’s amendments. Applicant’s arguments filed 7/23/2026 have been thoroughly considered but are not deemed fully persuasive. Claim Objections Claims 38 and 40 are objected to because of the following informalities: In claim 38, line 1, there should be a ---,--- between “36” and “wherein”. In claim 40, line 1, there should be a ---,--- between “33” and “wherein”. See the requirement of 37 CFR 1.71(a) for “full, clear, and exact terms”. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claims 33, 42 and dependent claims 34-41, 43-48 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. Amended independent claims 33 and 42 recite “wherein the Cas endonuclease target site is selected from the group consisting of SEQ ID NOs: 13-19, and 21-23, wherein the Cas endonuclease target site is located within said genomic window, wherein said genomic window is flanked by two sequences, wherein the two sequences correspond to SEQ ID NO: 42 and SEQ ID NO: 48 as provided in a B73 maize plant”. However, according to specification (Table 1 in pages 133-134; Table 2 in page 135), SEQ ID NOs: 13-19, 21-23 are not located within the genomic window flanked by SEQ ID NO: 42 and SEQ ID NO: 48. Instead, SEQ ID NOs: 13-19, 21-23 are located within said genomic window is flanked by two sequences, wherein the two sequences correspond to SEQ ID NO: 12 and SEQ ID NO:24 as provided in a B73 maize plant, which is outside of the genomic window flanked by SEQ ID NO: 42 and SEQ ID NO: 48. Thus, the claims are contradicting to themselves and also contradicting to the disclosure of the specification. Thus, the claims are indefinite. Dependent claims do not cure the deficiency, thus, are included in the rejection. Appropriate corrections are required. Please note that the “genomic window is flanked by two sequences, wherein the two sequences correspond to SEQ ID NO: 42 and SEQ ID NO: 48 as provided in a B73 maize plant” was the subject matter of the original filed claims. Therefore, for compact prosecution and definiteness, sequences located within the genomic window flanked by SEQ ID NO: 42 and SEQ ID NO: 48, SEQ ID NOs: 42-48, are examined in this office action. Sequences outside of the genomic window, SEQ ID NOs: 13-19, 21-23 are not located within the genomic window, and are not examined for merit in this office action. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not b negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or non-obviousness. Claims 33-38, 41-46 are rejected under 35 U.S.C. 103 as being unpatentable over Nelson et al (Methylation-sensitive linking libraries enhance gene-enriched sequencing of complex genomes and map DNA methylation domains. BMC Genomics 9, 621, 2008), in view of Whitelaw et al (CG448323 and BZ798211, published 2003), Liang et al (Targeted Mutagenesis in Zea mays Using TALENs and the CRISPR/Cas System. Journal of Genetics and Genomics 41, 63-68, 2013), and Lassner et al (US 20130263324, published 10/3/2013, filed 3/22/2012). Regarding claims 33-34, 42 and 46 Claim 33 is drawn to a maize plant, maize plant part or maize seed having in its genome a genomic window comprising at least one heterologous sequence integrated into at least one Cas endonuclease target site, wherein said genomic window is flanked by two sequences, wherein the two sequences correspond to SEQ ID NO: 42 and SEQ ID NO: 48 as provided in a B73 maize plant, wherein said genomic window comprises a first recombination site and a second recombination site, wherein said first and said second recombination sites are dissimilar with respect to one another. Claim 34: said genomic window further comprises a transgene. Claim 42 is drawn to a maize plant, maize plant part or maize seed having in its genome a genomic window comprising at least one Cas endonuclease target site, wherein said genomic window is flanked by two sequences, wherein the two sequences correspond SEQ ID NO: 42 and SEQ ID NO: 48 as provided in a B73 maize plant; wherein said genomic window comprises a transgene. Claim 46 limits claim 42, wherein said genomic window further comprises at least one transgenic target site for site-specific integration, wherein said transgenic target site comprises a first recombination site and a second recombination site, wherein said first and said second recombination site are dissimilar with respect to one another. Note: claims 42 and 46 are drawn to essentially the same subject matter as claims 33-34. According to specification (table 2 in page 135), the genomic window flanked by SEQ ID NO: 42 and SEQ ID NO: 48 comprises sequences of SEQ ID NOs: 43-47. The window spans from 230.5 PHI to 231.06 PHI, which is a very big region (Table 2, far right col). Any insertion and integration into any position within the region in prior art is considered teaching. Nelson et al teach a natural sequence from maize (Zea mays) B73 genome that is 100% identical to instant SEQ ID NO: 45, which is within the claimed genomic window flanked by SEQ ID NOs: 42 and 48. See “Sequence Matches” at the end of office action. Nelson et al teach and demonstrated that heterologous DNAs are inserted into the genome, and that heterologous DNAs are integrated into the genome (p7, left col, 1st para; p11, left col, 1st para). Please note that the insertion and integration are not required to be in SEQ ID NO: 45, they are only required to be within the claimed genomic window comprising SEQ ID NO: 45. Accordingly, Nelson et al teach integrating heterologous DNA into the claimed genomic window. Nelson et al further teach that the genome of B73 maize cultivar has been fully sequenced and analyzed (p12, right col, last para; p13, left col, 1st para). In addition, Whitelaw et al teach sequences from maize B73 genome that are 100% identical to instant SEQ ID NO: 42 and instant SEQ ID NO: 48. See “Sequence Matches” at the end of office action. Hence, one ordinary skill in the art would have been able to identify the whole region of the claimed genomic window from the fully sequenced B73 genome from the teaching of Nelson et al and Whitelaw et al. The “wherein said genomic window comprises a first recombination site and a second recombination site” and “wherein said first and said second recombination sites are dissimilar with respect to one another”, are inherent within the genomic window. Nelson et al and Whitelaw et al do not teach that the heterologous DNAs are integrated into at least one Cas endonuclease target site. Liang et al teach that either TALEN or CRISPR endonuclease can perform such site-specific targeting in maize plants (p6, whole page). Liang et al teach using CRISPR-Cas (page 67, left col, 3rd para) based homologous recombination to successfully make site specific targeted transformation and mutagenesis in maize seed and cell (page 67, left col, 4th para; right col, 1st to 3rd para). Liang et al teach that CRISPR-Cas generates double-strand breaks (page 63, right col, 1st para). Liang et al particularly teach making insertions to the target sites (p66, figure 3). In fig 3 (p66), Liang et al clearly show the targeting is using two recombination sites at each end. The transformation of 30-50 lines was stable (page 67, right col, 3rd para), meaning the transgene was integrated into the specific site. Liang further teach that CRISPR/Cas system has great advantages in terms of easy cloning and multiplex genome editing (page 67, left col, 1st para). Regarding the “transgene” limitation (independent claim 42 and dependent claim 34), Lassner et al teach a method for producing in a plant and plant part a complex transgenic trait locus comprising at least two altered target sequences in a genomic region of interest in a site-specific manner including in maize (target sites, abstract, [0004], [0316]). Lassner et al teach that the target sites are site-specific recombination sites ([0004]). Lassner et al teach and demonstrate producing plants comprising heterologous transgenes integrated into the target sites by using various endonucleases (Examples 1-5, [0320]-[0444]). Lassner et al teach targeting more than 2 different/dissimilar recombination target sites ([0108]-[0116], [[0123]-[0142]). Accordingly, not only the two dissimilar recombination sites are not only inherent, but also would have been readily identified and characterized, and the integration of heterologous DNAs including transgenes would have been readily produced within the claimed genomic window, as taught by Liang et al, and Lassner et al. Regarding dependent claims Lassner et al teach that the transgene confers herbicide resistance and insect resistance ([0286]), the limitation of claims 35 and 43. Lassner et al teach multiple recombination target sites (as analyzed above, [0108]-[0116], [[0123]-[0142]), and successfully targeted and inserted multiple and different trait genes in different regions, thus different sites comprise different trait genes (Example 4, [0419]), the limitation of claims 36-38, 44-45. Liang further teach that CRISPR/Cas system has great advantages in terms of easy cloning and multiplex genome editing in site specific manner (page 67, left col, 1st para), providing the motivation to use Cas endonuclease to target multiple and different trait genes in different regions. Liang et al also teach additionally using TALEN (page 67, left col, 2nd para) based homologous recombination to successfully make site specific targeted transformation in maize seed and cell (page 67, left col, 4th para; right col, 1st to 3rd para). TALEN targeting site is outside of CRISPR-Cas target site, the limitation of claim 41. An invention would have been obvious to one ordinary skill in the art if any teaching, suggestion or motivation in prior art leading the one to combine the teaching(s) or suggestion(s) of the cited references to arrive the claimed invention. In this case, it would have been obvious for one ordinary skill in the art to modify the invention of Nelson et al, such that the heterologous DNAs are inserted and integrated into a Cas endogenous target site as taught by Liang et al. One ordinary skill in the art would have been motivated to do so because Liang et al had demonstrated the Cas sites and had integrated heterologous DNAs into the sites in maize, and had taught that CRISPR/Cas system has great advantages in terms of easy cloning and multiplex genome editing. The expectation of success would have been high, because maize B73 genome had been fully sequenced, SEQ ID NOs: 45 (within the genomic window), 42 and 48 (flanking regions of the window) had been taught. Hence, one ordinary skill in the art would have been able to identify the whole region of the claimed genomic window from the fully sequenced B73 genome from the teaching of Nelson et al and Whitelaw et al. The “wherein said genomic window comprises a first recombination site and a second recombination site” and “wherein said first and said second recombination sites are dissimilar with respect to one another”, are not only inherent but would have been readily identified and characterized by Liang et al. Making site specific genetic modifications/insertions in multiple target sites by Cas endonuclease had been demonstrated by Liang et al in maize. Making transgenic integrations in maize had also been demonstrated by Lassner et al. Therefore, the invention would have been obvious to one ordinary skill in the art. Claims 39-40, 47-48 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Nelson et al in view of Whitelaw et al, Liang et al and Lassner et al, as applied to claims 33, 42 and 46 above, and further in view of Bottcher et al (Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination donors in cultured Drosophila cells. Nucleic Acids Research, 42: 1-16, 4/2014), and Tao et al (US20080047031, published 2/21/2008, filed 7/18/2005). Claims 33, 42 and 46 have been analyzed above. Claims 39 and 47 set a limitation--wherein the transgenic target site comprises an FRT (flippase (Flp) recognition target) site or a mutant FRT site. Claims 40 and 48 limit the first recombination site and second recombination site to SEQ ID NOs: 576-579 or 580. According to specification (p43, 1st para), FRT sites encompasses wild-type and mutant/artificial sites. Nelson et al in view of Whitelaw et al, Liang et al and Lassner et al do not teach the Cas target site comprising an FRT site or a mutant FRT site, and do not teach SEQ ID NOs: 576-580. Bottcher et al teach successfully applying CRISPR-Cas9 based homologous recombination to locations flanked by FRT sites in Drosophila (page 5, left col, 2nd para, to page 8, right col, 1st para), and suggest applying the method to animals and plants (page 1, abstract; right col, 1st para). Bottcher et al continue to teach the advantage of FRT insertions being permitting removal after selection, thus teaching a motivation to use FRT sites. Tao et al teach making maize plant, parts and seeds having transgenic event in specific site of the genome ([0004], [0014], [0024], claims 13 and 38). The transgenes are inserted by site-specific integration ([0018], claims 20-28). Tao et al particularly teach targeting insertions in maize (Example 7, [0223]-[0234]). Tao et al teach the transgenes conferring traits including herbicide tolerance, insect resistance, disease resistance and more ([0170]). Tao et al further teach that plants comprise multiple target sites for multiple gene insertions within or across chromosomes ([0132], [0154]). Tao et al continue to teach that the first and second recombination sites are dissimilar with respect to one another ([0022], claim 47). Particularly, Tao et al teach making artificial FRT sequences (SEQ ID NO: 41, SEQ ID NO: 21 and SEQ ID NO: 24 of Tao et al) that are 100% identical to instant SEQ ID NOs: 578, 579 and 580. See “Sequence Matches” at the end of office action. Tao et al further teach using the above FRT sequences ([0019], [0033], Example 3, [0194]), table 1, claims 2, 6), and mutant FRT sequences ([0029], [0033], Example 4, [0195]), for site-specific transgene integration. Tao et al teach the advantage of using FRT site for insertions and transgenes is that the DNA of interest can be removed ([0005], [0122]). Thus, the modification can be reversed. Tao et al additionally teach the detailed method of locating candidate FRT sites (examples 2-3, [0191]-[0194]). It would have been obvious for one ordinary skill in the art to modify the invention rendered obvious by Nelson et al in view of Whitelaw et al, Liang et al and Lassner et al, such that the FRT sites and the specific FRT sites was used for the integration of transgenes, as taught by Bottcher et al and Tao et al. One ordinary skill in the art would have been motivated to do so for the advantage that the FRT insertions could be removed after selection as taught by Bottcher et al. The expectation of success would have been high because FRT sites had the added advantage to CRISPR/Cas editing, FRT sequences had been available, and the method of find and making FRT sequences had been taught. Therefore, the claims would have been obvious to one ordinary skill in the art. Response to Arguments Claim Rejections Under 35 U.S.C. § 112(b) The amendments overcame the previous rejections, but introduced new indefiniteness issues, as analyzed above. Claim Rejections Under 35 U.S.C. § 103 Obviousness Applicants traverse the rejection and argues that in light of the amendments, the rejections should be overcome. The rejections are not overcome, as analyzed above. No new reference is cited or needed. Sequence Matches Against instant SEQ ID NO: 45 ER998348/c LOCUS ER998348 1039 bp DNA linear GSS 06-FEB-2009 DEFINITION ZMMBHp0001H19.r ZMMBHp Zea mays genomic clone ZMMBHp0001H19 5', genomic survey sequence. ACCESSION ER998348 VERSION ER998348.1 DBLINK BioSample: SAMN00188282 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 1039) AUTHORS Nelson,W., Luo,M., Ma,J., Estep,M., Estill,J., He,R., Talag,J., Sisneros,N., Kudrna,D., Kim,H., Ammiraju,J.S., Collura,K., Bharti,A.K., Messing,J., Wing,R.A., SanMiguel,P., Bennetzen,J.L. and Soderlund,C. TITLE Methylation-sensitive linking libraries enhance gene-enriched sequencing of complex genomes and map DNA methylation domains JOURNAL BMC Genomics 9, 621 (2008) PUBMED 19099592 COMMENT Contact: Phillip SanMiguel Purdue University West Lafayette, IN, USA Email: pmiguel\@purdue.edu Plate: 0001 row: H column: 19 Class: BAC ends. FEATURES Location/Qualifiers source 1..1039 /organism="Zea mays" /mol_type="genomic DNA" /cultivar="B73" /db_xref="taxon:4577" /clone="ZMMBHp0001H19" /tissue_type="Immature ear" /clone_lib="SAMN00188282 ZMMBHp" /dev_stage="6-8 weeks" /lab_host="DH10B" /note="Vector: TOPOpcr4; Site_1: Eco RI; Site_2: Eco RI" ORIGIN Query Match 100.0%; Score 23; Length 1039; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCTAGCTGAGAAAATGTGCCCGG 23 ||||||||||||||||||||||| Db 346 GCTAGCTGAGAAAATGTGCCCGG 324 Against instant SEQ ID NO: 42 CG448323 LOCUS CG448323 782 bp DNA linear GSS 17-SEP-2003 DEFINITION OG7AK91TH ZM_0.7_1.5_KB Zea mays genomic clone ZMMBMa0847P13, genomic survey sequence. ACCESSION CG448323 VERSION CG448323.1 DBLINK BioSample: SAMN00182289 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 782) AUTHORS Whitelaw,C.A., Quackenbush,J., Van Aken,S., Utterback,T., Resnick,A., Fraser,C.M., Budiman,M.A., Bedell,J.A., Rohlfing,T., Citek,R.W., Nunberg,A., Robbins,D. and Lakey,N. TITLE Consortium for Maize Genomics JOURNAL Unpublished COMMENT Other_GSSs: OG7AK91TV Contact: Cathy Whitelaw TIGR 9712 Medical Center Drive, Rockville, MD 20850, USA Tel: 301-838-5843 Fax: 301-838-0208 Email: whitelaw\@tigr.org Seq primer: TR Class: methylation filtered. FEATURES Location/Qualifiers source 1..782 /organism="Zea mays" /mol_type="genomic DNA" /strain="B73" /db_xref="taxon:4577" /clone="ZMMBMa0847P13" /clone_lib="SAMN00182289 ZM_0.7_1.5_KB" /note="Vector: pBCSK-; Site_1: HincII; 0.7-1.5 kb methylation filtered genomic DNA library" ORIGIN Query Match 100.0%; Score 201; Length 782; Best Local Similarity 100.0%; Matches 201; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CTAGCTTGATGTGGATTCTCTGTTTTTTTTAACTCGAGTGCAACCAAAATAATAATAAAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 469 CTAGCTTGATGTGGATTCTCTGTTTTTTTTAACTCGAGTGCAACCAAAATAATAATAAAA 528 Qy 61 ATGCTCTGTTGTTGCAGCTTGGAGCTCTGGTACTACACTGCGGTGCTCATCCTTGTAGGG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 529 ATGCTCTGTTGTTGCAGCTTGGAGCTCTGGTACTACACTGCGGTGCTCATCCTTGTAGGG 588 Qy 121 TTCCTGAAGAACGCGCGGCTTCAGATTGACGTCATGTCCATCTGGTAACTAATTTTTATG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 589 TTCCTGAAGAACGCGCGGCTTCAGATTGACGTCATGTCCATCTGGTAACTAATTTTTATG 648 Qy 181 AACTAAGCAGCCCATGCATCA 201 ||||||||||||||||||||| Db 649 AACTAAGCAGCCCATGCATCA 669 Against instant SEQ ID NO: 48 BZ798211 LOCUS BZ798211 788 bp DNA linear GSS 17-MAR-2003 DEFINITION PUFJL49TD ZM_0.6_1.0_KB Zea mays genomic clone ZMMBTa357I02, genomic survey sequence. ACCESSION BZ798211 VERSION BZ798211.1 DBLINK BioSample: SAMN00182290 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 788) AUTHORS Whitelaw,C.A., Quackenbush,J., Van Aken,S., Utterback,T., Resnick,A., Fraser,C.M., Yuan,Y., San Miguel,P., Ma,J. and Bennetzen,J. TITLE Maize Genomics Consortium JOURNAL Unpublished COMMENT Other_GSSs: PUFJL49TB Contact: Cathy Whitelaw TIGR 9712 Medical Center Drive, Rockville, MD 20850, USA Tel: 301-838-5843 Fax: 301-838-0208 Email: whitelaw\@tigr.org Seq primer: TF Class: sheared ends. FEATURES Location/Qualifiers source 1..788 /organism="Zea mays" /mol_type="genomic DNA" /strain="B73" /db_xref="taxon:4577" /clone="ZMMBTa357I02" /clone_lib="SAMN00182290 ZM_0.6_1.0_KB" /note="Vector: pCR4-TOPO; Site_1: EcoRI; 0.6-1.0 kb high CoT selected genomic DNA library" ORIGIN Query Match 100.0%; Score 201; Length 788; Best Local Similarity 100.0%; Matches 201; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGTACTAAGGTAGGATATAATCAAATCGAACGCAAAGATCACAAAGAAACAGTCTAAGGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 320 GGTACTAAGGTAGGATATAATCAAATCGAACGCAAAGATCACAAAGAAACAGTCTAAGGG 379 Qy 61 TTTCAAAGCGTTGGACCAAGGCATCAGACTGGTGGAGTACATGCATCAGATTACACAATA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 380 TTTCAAAGCGTTGGACCAAGGCATCAGACTGGTGGAGTACATGCATCAGATTACACAATA 439 Qy 121 GAGCAAACCCTAGCAAAATTTCAATTGGGCTCAGGGAAGAAGCGAGTTTGGGTCACACAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 440 GAGCAAACCCTAGCAAAATTTCAATTGGGCTCAGGGAAGAAGCGAGTTTGGGTCACACAA 499 Qy 181 TTGTGGAGGCTCCAACCATCC 201 ||||||||||||||||||||| Db 500 TTGTGGAGGCTCCAACCATCC 520 Against instant SEQ ID NO: 578 US-11-487-300-41/c ; Sequence 41, Application US/11487300 ; Publication No. US20080047031A1 ; GENERAL INFORMATION: ; APPLICANT: Tao, Yumin ; APPLICANT: Bidney, Dennis ; APPLICANT: Gordon-Kamm, William ; APPLICANT: Lyznik, Leszek Alexander ; TITLE OF INVENTION: Novel FRT Recombination Sites and ; TITLE OF INVENTION: Methods of Use ; FILE REFERENCE: 1525-1 ; CURRENT APPLICATION NUMBER: US/11/487,300 ; CURRENT FILING DATE: 2006-07-14 ; PRIOR APPLICATION NUMBER: 60/700,225 ; PRIOR FILING DATE: 2005-07-18 ; NUMBER OF SEQ ID NOS: 72 ; SOFTWARE: FastSEQ for Windows Version 4.0 ; SEQ ID NO 41 ; LENGTH: 30 ; TYPE: DNA ; ORGANISM: Artificial Sequence ; FEATURE: ; OTHER INFORMATION: Minimal mutant FRT6 site US-11-487-300-41 Query Match 100.0%; Score 30; DB 29; Length 30; Best Local Similarity 100.0%; Matches 30; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGTTCCTATTCTTCAAAAAGTATAGGAACT 30 |||||||||||||||||||||||||||||| Db 30 AGTTCCTATTCTTCAAAAAGTATAGGAACT 1 Against instant SEQ ID NO: 579 US-11-487-300-21 ; Sequence 21, Application US/11487300 ; Publication No. US20080047031A1 ; GENERAL INFORMATION: ; APPLICANT: Tao, Yumin ; APPLICANT: Bidney, Dennis ; APPLICANT: Gordon-Kamm, William ; APPLICANT: Lyznik, Leszek Alexander ; TITLE OF INVENTION: Novel FRT Recombination Sites and ; TITLE OF INVENTION: Methods of Use ; FILE REFERENCE: 1525-1 ; CURRENT APPLICATION NUMBER: US/11/487,300 ; CURRENT FILING DATE: 2006-07-14 ; PRIOR APPLICATION NUMBER: 60/700,225 ; PRIOR FILING DATE: 2005-07-18 ; NUMBER OF SEQ ID NOS: 72 ; SOFTWARE: FastSEQ for Windows Version 4.0 ; SEQ ID NO 21 ; LENGTH: 30 ; TYPE: DNA ; ORGANISM: Artificial Sequence ; FEATURE: ; OTHER INFORMATION: Novel minimal FRT 12 site US-11-487-300-21 Query Match 100.0%; Score 30; DB 29; Length 30; Best Local Similarity 100.0%; Matches 30; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGTTCCTATACTCTATGTAGAATAGGAACT 30 |||||||||||||||||||||||||||||| Db 1 AGTTCCTATACTCTATGTAGAATAGGAACT 30 Against instant SEQ ID NO: 580 ; Sequence 24, Application US/11487300 ; Publication No. US20080047031A1 ; GENERAL INFORMATION: ; APPLICANT: Tao, Yumin ; APPLICANT: Bidney, Dennis ; APPLICANT: Gordon-Kamm, William ; APPLICANT: Lyznik, Leszek Alexander ; TITLE OF INVENTION: Novel FRT Recombination Sites and ; TITLE OF INVENTION: Methods of Use ; FILE REFERENCE: 1525-1 ; CURRENT APPLICATION NUMBER: US/11/487,300 ; CURRENT FILING DATE: 2006-07-14 ; PRIOR APPLICATION NUMBER: 60/700,225 ; PRIOR FILING DATE: 2005-07-18 ; NUMBER OF SEQ ID NOS: 72 ; SOFTWARE: FastSEQ for Windows Version 4.0 ; SEQ ID NO 24 ; LENGTH: 30 ; TYPE: DNA ; ORGANISM: Artificial Sequence ; FEATURE: ; OTHER INFORMATION: Novel minimal FRT 87 site US-11-487-300-24 Query Match 100.0%; Score 30; DB 29; Length 30; Best Local Similarity 100.0%; Matches 30; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGTTCCTATACTTTCTGGAGAATAGGAACT 30 |||||||||||||||||||||||||||||| Db 1 AGTTCCTATACTTTCTGGAGAATAGGAACT 30 Conclusion No claim is allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action. Contact information Any inquiry concerning this communication or earlier communications from the examiner should be directed to WAYNE ZHONG whose telephone number is (571)270-0311. The examiner can normally be reached 8:30am to 5:00pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic, can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Wayne Zhong/ Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Nov 07, 2024
Application Filed
Jun 05, 2026
Non-Final Rejection mailed — §103, §112
Jul 23, 2026
Response Filed
Aug 19, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12745740
PEPPER HYBRID DRPB3992 AND PARENTS THEREOF
2y 3m to grant Granted Sep 29, 2026
Patent 12733641
CELL DEATH INHIBITOR AND CELL DEATH INHIBITION METHOD
4y 8m to grant Granted Sep 15, 2026
Patent 12723251
MATERIALS AND METHODS FOR PUFA PRODUCTION, AND PUFA-CONTAINING COMPOSITIONS
3y 7m to grant Granted Sep 01, 2026
Patent 12716071
METHODS FOR PLANT TRANSFORMATION
5y 11m to grant Granted Aug 25, 2026
Patent 12709756
PLANT CELLS, PLANTS, AND SEEDS HAVING TARGETED ENHANCER ELEMENT INSERTIONS
3y 6m to grant Granted Aug 18, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
72%
Grant Probability
94%
With Interview (+21.5%)
2y 10m (~12m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 544 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month