DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
The Information Disclosure Statements filed on 12/2/2024 have been entered and considered. Initialed copies of the form PTO-1449 are enclosed with this action.
Restriction/Election and Status of claims
On 6/2/2026, Applicant elected Group II (claims 7-11), without traverse.
In summary Claims 7-11 are examined in this office action. Non-elected claims are withdrawn.
Priority
Instant application 18965202, filed 12/02/2024, is a Continuation of 17278346, filed 03/22/2021, now U.S. Patent 12157896.
17278346 is a national stage entry of PCT/US2019/053329, International Filing Date: 09/27/2019.
PCT/US2019/053329 Claims Priority from Provisional Application 62860451, filed 06/12/2019, and
from Provisional Application 62737383, filed 09/27/2018.
Provisional Application 62737383, filed 09/27/2018, did not disclose the elected SEQ ID NO: 210 and the subject matter thereof, thus, the priority is not recognized.
Provisional Application 62860451, filed 06/12/2019, disclosed the elected SEQ ID NO: 210, thus, the priority is recognized.
Claim Objections
Claim 7 is objected for following informality:
The term “miRNA” appears in a claim for the first time, the full name should be recited, followed by the abbreviation in a ().
See the requirement of 37 CFR 1.71(a) for “full, clear, and exact terms”.
Appropriate correction is required.
Claim Interpretation
Claim 7 recites a plant cell comprising an overexpressed gene, wherein the overexpressed gene encodes an miRNA comprising the sequence of SEQ ID NO: 210 or a homolog thereof.
According to the sequence listing, SEQ ID NO: 210 is 151 nt long.
In prior art, Ebhardt et al (Naturally occurring variations in sequence length creates microRNA isoforms that differ in argonaute effector complex specificity. Silence, p1-6, 2020) teach that micro RNAs (miRNAs) are small RNA sequences 20-24 nt in length (p1, right col, 2nd para).
According to the specification (p13, last para, p14, 1st para), a homolog refers to a encoding polynucleotide sequence.
Thus, SEQ ID NO: 210 is the gene encoding an miRNA, not the miRNA. The “a homolog” refers to a homolog of SEQ ID NO: 210.
Accordingly, claim 7 is interpreted as: a plant cell comprising an overexpressed gene comprising SEQ ID NO: 210 that encodes an miRNA, or a homolog of SEQ ID NO: 210.
In addition, the specification does not define “homolog”. Instead, the specification loosely and broadly describe homolog in page 13, last para to page 14, 1st to 2nd paras, by using terms like “for example”, “likewise”, “in various embodiments”, “typically” and so on (those terms would be indefinite in claims).
Nevertheless, according to the specification, “gene homologous to a native gene would encode for a protein having the same biological activity as the corresponding protein encoded by the naturally occurring gene” (p14, 1st para). “a homolog of a protein has substantially the same biological activity as the protein” (p14, 2nd para).
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 7-11 are rejected under 35 U.S.C. 101 because the claimed invention is directed to natural product without significantly more.
Claims recite a plant cell comprising an overexpressed gene comprising SEQ ID NO: 210 that encodes an miRNA, or a homolog of SEQ ID NO: 210.
As analyzed above, according to specification (p13, last para, p14, 1st to 2nd para), “homologs” means mutants having similar structure and encoding protein having substantially same biological activities.
The claimed cell is or encompasses natural product, as analyzed below:
According to the sequence listing, SEQ ID NO: 210 is a natural sequence from Glycine max, soybean.
Gene overexpression in plants and soybean is a common and natural phenomenon, including gene encoding miRNAs and SEQ ID NO: 210.
For example, Tian et al (Genome-wide identification of soybean microRNA responsive to soybean cyst nematodes infection by deep sequencing. BMC Genomics. P1-13, 2017) teach and demonstrated identifying microRNAs (miRNAs) responsive to soybean cyst nematodes (SCN) in soybean plant cells, 537 known and 70 putative, and genes encoding the miRNAs (p1, Abstract; left col, 1st para).
According to instant specification, the encoding genes of the microRNAs of Tian et al are structurally and functionally similar to SEQ ID NO: 210, and are homologs of SEQ ID NO: 210. Tian et al further teach that the miRNAs have different expression patterns at different infection stage (p6, fig 5, p8, left col, last para). Such different patterns read on overexpression (and/or reduced expression). In addition, claims recite a plant cell, a product, not a process. Thus, without a standard or a comparison, any expression over a baseline is considered overexpression.
Hence, the claimed plant cell, overexpressing SEQ ID NO: 210 or overexpressing the homologs thereof, is not distinguishable from a natural soybean cell.
Regarding dependent claims, claim 8 recites endogenous promoter as an option. Since the native microRNAs (of Tian et al) are expressed, the endogenous promoters are inherently there in the native soybean cells.
The soybean cells of SCN infection and miRNA expression include seeds (p10, left col, 2nd para), thus, claims 9-10 recite natural products.
The soybean cells of tian et al reads on that of claim 11.
There is no non-natural part, not to mention significantly more, in the claims.
Therefore, the claims are rejected over 35 USC 101.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Two rejections are made.
Claims 7-11 are rejected under 35 U.S.C. 102 (a)(1) and 102 (a)(2) as being anticipated by Hewezi et al (USPGPUB 20170369900, published 12/28/2017, filed 12/30/2015).
Instant claim 7 recites a plant cell comprising an overexpressed gene, wherein the overexpressed gene encodes an miRNA comprising the sequence of SEQ ID NO: 210 or a homolog thereof. As analyzed above, the claim is interpreted as a plant cell comprising an overexpressed gene comprising SEQ ID NO: 210 that encodes an miRNA, or a homolog of SEQ ID NO: 210.
As analyzed above, the specification does not define “homolog”. Nevertheless, according to the specification, “gene homologous to a native gene would encode for a protein having the same biological activity as the corresponding protein encoded by the naturally occurring gene” (p14, 1st para). “a homolog of a protein has substantially the same biological activity as the protein” (p14, 2nd para).
According to the specification (Table 1 in p20-22), SEQ ID NO: 210 is one of the sequences conferring SCN resistance.
Hewezi et al teach and claim soybean plant, part and cell overexpressing genes encoding microRNAs (miRNAs) conferring SCN resistance ([0017], [0019], claims 41 and 43).
Hewezi et al demonstrated success of the genes and the encoded miRNAs conferring SCN resistance (Example 6, [0077]-[0078], Table 2).
Accordingly, the gene, the encoded miRNA of Hewezi et al, read on the homologs of SEQ ID NO: 210. The soybean cell comprising the gene and miRNA of Hewezi et al anticipates instant claim 7.
Regarding dependent claims, Hewezi et al teach and demonstrated using endogenous and/or exogenous promoter to drive the genes ([0035]-[0036], Example 6 in Table 2), teaching the limitation of claim 8.
The soybean plant cell of Hewezi et al teach the limitation of claims 9 and 11.
Hewezi et al teach expressing the gene encoding the miRNA in seeds ([0036]), the limitation of claim 10.
Therefore, Hewezi et al anticipate all of the claims.
Claims 7-11 are rejected under 35 U.S.C. 102 (a)(1) as being anticipated by Tian et al (Genome-wide identification of soybean microRNA responsive to soybean cyst nematodes infection by deep sequencing. BMC Genomics. P1-13, 2017).
Instant claims have been analyzed above.
Tian et al teach and demonstrated identifying microRNAs (miRNAs) responsive to soybean cyst nematodes (SCN) in soybean plant cells, 537 known and 70 putative, and genes encoding the miRNAs (p1, Abstract; left col, 1st para).
According to instant specification, the encoding genes of the microRNAs of Tian et al are structurally and functionally similar to SEQ ID NO: 210, and are homologs of SEQ ID NO: 210.
Tian et al further teach that the miRNAs have different expression patterns at different infection stage (p6, fig 5, p8, left col, last para). Such different patterns read on overexpression (and/or reduced expression). In addition, claims recite a plant cell, a product, not a process. Thus, without a standard or a comparison, any expression over a baseline is considered overexpression. Thus, Tian et al anticipate claim 7.
Regarding dependent claims, claim 8 recites endogenous promoter as an option. Since the microRNAs of Tian et al are expressed, the endogenous promoters are inherently there in Tian et al.
Tian et al teach the cells of SCN infection include seeds (p10, left col, 2nd para), the limitation of claims 9-10.
The soybean cells of tian et al reads on that of claim 11.
Therefore, Tian et al anticipate all of the claims.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the claims at issue are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); and In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO internet Web site contains terminal disclaimer forms which may be used. Please visit http://www.uspto.gov/forms/. The filing date of the application will determine what form should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Two rejections are made. The instant application and US Patents share multiple inventors and the same applicant of University of Tennessee.
Claims 7-11 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-7, 13-16 of US Patent 10457956.
The USP claims:
Claim 1. An elite soybean plant, or a part thereof, comprising an introgression or genetic modification resulting in the elite soybean plant or a part thereof an increased expression of: an miRNA selected from SEQ ID NOs: 12, 25 and 34 and/or the gene of SEQ ID NO: 196, wherein compared to the host soybean plant or a part thereof used to produce the elite soybean plant or a part thereof, the elite soybean plant or a part thereof exhibits an increased resistance to an SCN infection.
Instant claim 7 recites a plant cell comprising an overexpressed gene, wherein the overexpressed gene encodes an miRNA comprising the sequence of SEQ ID NO: 210 or a homolog thereof. As analyzed above, the claim is interpreted as a plant cell comprising an overexpressed gene comprising SEQ ID NO: 210 that encodes an miRNA, or a homolog of SEQ ID NO: 210.
Although the claims at issue are not identical, they are not patentably distinct from each other because:
SEQ ID NO: 210 is not claimed in the US Patent.
However, as analyzed above, the specification does not define “homolog”. Instead, the specification loosely and broadly describe homolog. Nevertheless, according to the specification, “gene homologous to a native gene would encode for a protein having the same biological activity as the corresponding protein encoded by the naturally occurring gene” (p14, 1st para). “a homolog of a protein has substantially the same biological activity as the protein” (p14, 2nd para).
According to the specification (Table 1 in p20-22), SEQ ID NO: 210 is one of the sequences conferring SCN resistance.
Thus, the reference claim 1 teaches the homolog of instant claim 1 in a more specific manner, including introgression of the encoding gene and the function limitation of SCN resistance.
Regarding dependent claims, the heterologous promoter, seed, ovule or pollen, soybean or other cyst nematode-host plants, the reference claims 2-7 13-16 teach the limitations of instant claims 8-11.
Therefore, the claims are obvious over each other.
Claims 7-11 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3-8, 10-13 of US Patent 12157896.
The USP claims:
Claim 1. A plant cell comprising an overexpressed gene, wherein the overexpressed gene comprises a protein coding sequence of SEQ ID NO: 1 operably linked to a heterologous promoter or SEQ ID NO: 2 operably linked to a heterologous promoter and said plant cell is resistant to infection by soybean cyst nematode (SCN).
Instant claim 7 recites a plant cell comprising an overexpressed gene, wherein the overexpressed gene encodes an miRNA comprising the sequence of SEQ ID NO: 210 or a homolog thereof. As analyzed above, the claim is interpreted as a plant cell comprising an overexpressed gene comprising SEQ ID NO: 210 that encodes an miRNA, or a homolog of SEQ ID NO: 210.
Although the claims at issue are not identical, they are not patentably distinct from each other because:
According to the specification, “gene homologous to a native gene would encode for a protein having the same biological activity as the corresponding protein encoded by the naturally occurring gene” (p14, 1st para). “a homolog of a protein has substantially the same biological activity as the protein” (p14, 2nd para).
By sequence alignment, SEQ ID NOs: 1-2 are identical in the US Patent and instant application.
SEQ ID NO: 210 is not claimed in the US Patent.
However, according to the specification (Table 1 in p20-22), SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 210 are all from Glycine max, soybean, and have the same activity of conferring soybean cyst nematode (SCN) resistance. Thus, by BRI, SEQ ID NO: 2 and SEQ ID NO: 210 are homologs according to the applicant’s description.
Thus, the reference claim 1 recite homologs of instant SEQ ID NO: 210 of claim 7, in a more specific manner—including heterologous promoter and including function limitation of resistant to infection by soybean cyst nematode (SCN).
Regarding dependent claims, the heterologous promoter, seed, ovule or pollen, soybean or other cyst nematode-host plants, the reference claims 1, 3-8, 10-13, teach the limitations of instant claims 8-11.
Therefore, the claims are obvious over each other.
Remarks
Prior art does not disclose a full-length sequence of SEQ ID NO: 210. The closest sequence matches are provided below, also for compact prosecution.
Claims 7-11 do not require any function limitation(s). Thus, a rejection for lacking written description is not made. However, the “homolog” is interpreted by BRI based on the applicant’s own description, in the art and DP rejections.
Sequence Matches
Against instant SEQ ID NO: 210
Against polynucleotides
RESULT 1
BM094464
LOCUS BM094464 528 bp mRNA linear EST 08-JUL-2004
DEFINITION saj16c06.y1 Gm-c1066 Glycine max cDNA clone GENOME SYSTEMS CLONE
ID: Gm-c1066-2819 5' similar to TR:Q37113 Q37113 ORF75, mRNA
sequence.
ACCESSION BM094464
VERSION BM094464.1
DBLINK BioSample: SAMN00161669
KEYWORDS EST.
SOURCE Glycine max (soybean)
ORGANISM Glycine max
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50
kb inversion clade; NPAAA clade; indigoferoid/millettioid clade;
Phaseoleae; Glycine; Glycine subgen. Soja.
REFERENCE 1 (bases 1 to 528)
AUTHORS Shoemaker,R., Keim,P., Vodkin,L., Erpelding,J., Coryell,V.,
Khanna,A., Bolla,B., Marra,M., Hillier,L., Kucaba,T., Martin,J.,
Beck,C., Wylie,T., Underwood,K., Steptoe,M., Theising,B., Allen,M.,
Bowers,Y., Person,B., Swaller,T., Gibbons,M., Pape,D., Harvey,N.,
Schurk,R., Ritter,E., Kohn,S., Shin,T., Jackson,Y., Cardenas,M.,
McCann,R., Waterston,R. and Wilson,R.
TITLE Public Soybean EST Project
JOURNAL Unpublished
COMMENT Contact: Shoemaker R/Public Soybean EST Project
Public Soybean EST Project
Washington University School of Medicine
4444 Forest Park Parkway, Box 8501, St. Louis, MO 63108, USA
Tel: 314 286 1800
Fax: 314 286 1810
Email: est\@watson.wustl.edu
When it has been determined, an EST from the other end of this
clone is listed in the 'Other ESTs on clone' field. This clone is
available through: Biogenetic Services, 801 32nd Ave. Brookings, SD
57006 USA (phone: 800 423 4163; email: info\@biogeneticservices.com)
High quality sequence stop: 420.
FEATURES Location/Qualifiers
source 1..528
/organism="Glycine max"
/mol_type="mRNA"
/cultivar="Williams"
/db_xref="taxon:3847"
/clone="GENOME SYSTEMS CLONE ID: Gm-c1066-2819"
/tissue_type="Leaf and shoot tip, salt stressed, 2 week
old seedling"
/clone_lib="SAMN00161669 Gm-c1066"
/lab_host="DH10B"
/note="Vector: pBluescript II SK+; Site_1: EcoRI; Site_2:
XhoI; The cDNA library was constructed from mRNA isolated
from unexpanded leaves and the shoot tips of 2 week old
seedling from the cultivar Williams. The 2 week old
seedlings were salt stressed in a solution of 500mM NaCl
for 3 days prior to harvesting. Complementary DNA was
synthesized from mRNA using a primer consisting of a
poly(dT) sequence with a XhoI restriction site. EcoRI
adapters were ligated to the blunt-ended cDNA fragments
followed by XhoI digestion. The cDNA fragments were
directionally cloned into the EcoRI-XhoI restriction site
of the pBluescript vector. The ligated cDNA fragments were
transformed into DH10B host cells (GibcoBRL). This library
was constructed in the laboratory of Dr. Randy Shoemaker."
ORIGIN
Query Match 96.8%; Score 146.2; Length 528;
Best Local Similarity 98.0%;
Matches 148; Conservative 0; Mismatches 3; Indels 0; Gaps 0;
Qy 1 GACACCAAAGATAGGGATATTAAACGAATGGAATTAGTATATGGATGTAATATAATGAAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 55 GACACCAAAGATAGGGATATTAAACGAATGGAATTAGTATATGGATGTAATATAATGAAA 114
Qy 61 TAGAGCCACTTTTGGGTTCCCTATGAAATGAGGCATAGAAAGGAGCCACTGTGAAGAAGT 120
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||
Db 115 TAGAGCCACTTTTGGGTTCCCTATGAAATGAGGCATGGAACGGAGCCACTGTGAAGAAGT 174
Qy 121 TTTACGAGTTACGAAGGAAACTTCGAGTTCA 151
||||||||||||||||||||||||||| |||
Db 175 TTTACGAGTTACGAAGGAAACTTCGAGCTCA 205
RESULT 3
US-10-424-599-22233
(NOTE: this sequence has 3 duplicates in the database searched.
See complete list at the end of this report)
Sequence 22233, US/10424599
Publication No. US20040031072A1
GENERAL INFORMATION
APPLICANT: La Rosa Thomas J
APPLICANT: Kovalic David K
APPLICANT: Zhou Yihua
APPLICANT: Cao Yongwei
TITLE OF INVENTION: Soy Nucleic Acid Molecules and Other Molecules Associated With
TITLE OF INVENTION: Plants and Uses Thereof for Plant Improvement
FILE REFERENCE: 38-21(53223)B
CURRENT APPLICATION NUMBER: US/10/424,599
CURRENT FILING DATE: 2003-04-28
NUMBER OF SEQ ID NOS: 285684
SEQ ID NO 22233
LENGTH: 528
TYPE: DNA
ORGANISM: Glycine max
FEATURE:
OTHER INFORMATION: Clone ID: PAT_MRT3847_120079C.1
Query Match 96.8%; Score 146.2; Length 528;
Best Local Similarity 98.0%;
Matches 148; Conservative 0; Mismatches 3; Indels 0; Gaps 0;
Qy 1 GACACCAAAGATAGGGATATTAAACGAATGGAATTAGTATATGGATGTAATATAATGAAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 55 GACACCAAAGATAGGGATATTAAACGAATGGAATTAGTATATGGATGTAATATAATGAAA 114
Qy 61 TAGAGCCACTTTTGGGTTCCCTATGAAATGAGGCATAGAAAGGAGCCACTGTGAAGAAGT 120
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||
Db 115 TAGAGCCACTTTTGGGTTCCCTATGAAATGAGGCATGGAACGGAGCCACTGTGAAGAAGT 174
Qy 121 TTTACGAGTTACGAAGGAAACTTCGAGTTCA 151
||||||||||||||||||||||||||| |||
Db 175 TTTACGAGTTACGAAGGAAACTTCGAGCTCA 205
Against encoded polypeptides
RESULT 2
US-10-424-599-165075
(NOTE: this sequence has 3 duplicates in the database searched.
See complete list at the end of this report)
Sequence 165075, US/10424599
Publication No. US20040031072A1
GENERAL INFORMATION
APPLICANT: La Rosa Thomas J
APPLICANT: Kovalic David K
APPLICANT: Zhou Yihua
APPLICANT: Cao Yongwei
TITLE OF INVENTION: Soy Nucleic Acid Molecules and Other Molecules Associated With
TITLE OF INVENTION: Plants and Uses Thereof for Plant Improvement
FILE REFERENCE: 38-21(53223)B
CURRENT APPLICATION NUMBER: US/10/424,599
CURRENT FILING DATE: 2003-04-28
NUMBER OF SEQ ID NOS: 285684
SEQ ID NO 165075
LENGTH: 75
TYPE: PRT
ORGANISM: Glycine max
FEATURE:
NAME/KEY: unsure
LOCATION: (1)..(75)
OTHER INFORMATION: unsure at all Xaa locations
FEATURE:
OTHER INFORMATION: Clone ID: PAT_MRT3847_120079C.1.pep
Alignment Scores:
Length: 75
Score: 86.00 Matches: 17
Percent Similarity: 85.0% Conservative: 0
Best Local Similarity: 85.0% Mismatches: 3
Query Match: 31.9% Indels: 0
Gaps: 0
US-18-965-202A-210 (1-151) x US-10-424-599-165075 (1-75)
Qy 88 ATGAGGCATAGAAAGGAGCCACTGTGAAGAAGTTTTACGAGTTACGAAGGAAACTTCGAG 147
||||||||| ||||||||| |||||||||||||||||||||||||||||||||
Db 1 MetArgHisGlyThrGluProLeuXaaArgSerPheThrSerTyrGluGlyAsnPheGlu 20
Conclusion
No claim is allowed.
Contact information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to WAYNE ZHONG whose telephone number is (571)270-0311. The examiner can normally be reached 8:30am to 5:00pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic, can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/Wayne Zhong/
Primary Examiner, Art Unit 1662
Prosecution Insights