Prosecution Insights
Last updated: October 02, 2026
Application No. 18/965,202

DISCOVERY OF SOYBEAN CYST NEMATODE RESISTANCE GENES BASED ON EPIGENETIC ANALYSIS

Non-Final OA §101§102§DP
Filed
Dec 02, 2024
Priority
Sep 27, 2018 — provisional 62/737,383 +3 more
Examiner
ZHONG, WAYNESHAOBIN
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University of Tennessee Research Foundation
OA Round
1 (Non-Final)
72%
Grant Probability
Favorable
1-2
OA Rounds
1y 0m
Est. Remaining
94%
With Interview

Examiner Intelligence

Grants 72% — above average
72%
Career Allowance Rate
393 granted / 544 resolved
+12.2% vs TC avg
Strong +22% interview lift
Without
With
+21.5%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
27 currently pending
Career history
566
Total Applications
across all art units

Statute-Specific Performance

§101
8.9%
-31.1% vs TC avg
§103
31.7%
-8.3% vs TC avg
§102
10.4%
-29.6% vs TC avg
§112
36.1%
-3.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 544 resolved cases

Office Action

§101 §102 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Information Disclosure Statement The Information Disclosure Statements filed on 12/2/2024 have been entered and considered. Initialed copies of the form PTO-1449 are enclosed with this action. Restriction/Election and Status of claims On 6/2/2026, Applicant elected Group II (claims 7-11), without traverse. In summary Claims 7-11 are examined in this office action. Non-elected claims are withdrawn. Priority Instant application 18965202, filed 12/02/2024, is a Continuation of 17278346, filed 03/22/2021, now U.S. Patent 12157896. 17278346 is a national stage entry of PCT/US2019/053329, International Filing Date: 09/27/2019. PCT/US2019/053329 Claims Priority from Provisional Application 62860451, filed 06/12/2019, and from Provisional Application 62737383, filed 09/27/2018. Provisional Application 62737383, filed 09/27/2018, did not disclose the elected SEQ ID NO: 210 and the subject matter thereof, thus, the priority is not recognized. Provisional Application 62860451, filed 06/12/2019, disclosed the elected SEQ ID NO: 210, thus, the priority is recognized. Claim Objections Claim 7 is objected for following informality: The term “miRNA” appears in a claim for the first time, the full name should be recited, followed by the abbreviation in a (). See the requirement of 37 CFR 1.71(a) for “full, clear, and exact terms”. Appropriate correction is required. Claim Interpretation Claim 7 recites a plant cell comprising an overexpressed gene, wherein the overexpressed gene encodes an miRNA comprising the sequence of SEQ ID NO: 210 or a homolog thereof. According to the sequence listing, SEQ ID NO: 210 is 151 nt long. In prior art, Ebhardt et al (Naturally occurring variations in sequence length creates microRNA isoforms that differ in argonaute effector complex specificity. Silence, p1-6, 2020) teach that micro RNAs (miRNAs) are small RNA sequences 20-24 nt in length (p1, right col, 2nd para). According to the specification (p13, last para, p14, 1st para), a homolog refers to a encoding polynucleotide sequence. Thus, SEQ ID NO: 210 is the gene encoding an miRNA, not the miRNA. The “a homolog” refers to a homolog of SEQ ID NO: 210. Accordingly, claim 7 is interpreted as: a plant cell comprising an overexpressed gene comprising SEQ ID NO: 210 that encodes an miRNA, or a homolog of SEQ ID NO: 210. In addition, the specification does not define “homolog”. Instead, the specification loosely and broadly describe homolog in page 13, last para to page 14, 1st to 2nd paras, by using terms like “for example”, “likewise”, “in various embodiments”, “typically” and so on (those terms would be indefinite in claims). Nevertheless, according to the specification, “gene homologous to a native gene would encode for a protein having the same biological activity as the corresponding protein encoded by the naturally occurring gene” (p14, 1st para). “a homolog of a protein has substantially the same biological activity as the protein” (p14, 2nd para). Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 7-11 are rejected under 35 U.S.C. 101 because the claimed invention is directed to natural product without significantly more. Claims recite a plant cell comprising an overexpressed gene comprising SEQ ID NO: 210 that encodes an miRNA, or a homolog of SEQ ID NO: 210. As analyzed above, according to specification (p13, last para, p14, 1st to 2nd para), “homologs” means mutants having similar structure and encoding protein having substantially same biological activities. The claimed cell is or encompasses natural product, as analyzed below: According to the sequence listing, SEQ ID NO: 210 is a natural sequence from Glycine max, soybean. Gene overexpression in plants and soybean is a common and natural phenomenon, including gene encoding miRNAs and SEQ ID NO: 210. For example, Tian et al (Genome-wide identification of soybean microRNA responsive to soybean cyst nematodes infection by deep sequencing. BMC Genomics. P1-13, 2017) teach and demonstrated identifying microRNAs (miRNAs) responsive to soybean cyst nematodes (SCN) in soybean plant cells, 537 known and 70 putative, and genes encoding the miRNAs (p1, Abstract; left col, 1st para). According to instant specification, the encoding genes of the microRNAs of Tian et al are structurally and functionally similar to SEQ ID NO: 210, and are homologs of SEQ ID NO: 210. Tian et al further teach that the miRNAs have different expression patterns at different infection stage (p6, fig 5, p8, left col, last para). Such different patterns read on overexpression (and/or reduced expression). In addition, claims recite a plant cell, a product, not a process. Thus, without a standard or a comparison, any expression over a baseline is considered overexpression. Hence, the claimed plant cell, overexpressing SEQ ID NO: 210 or overexpressing the homologs thereof, is not distinguishable from a natural soybean cell. Regarding dependent claims, claim 8 recites endogenous promoter as an option. Since the native microRNAs (of Tian et al) are expressed, the endogenous promoters are inherently there in the native soybean cells. The soybean cells of SCN infection and miRNA expression include seeds (p10, left col, 2nd para), thus, claims 9-10 recite natural products. The soybean cells of tian et al reads on that of claim 11. There is no non-natural part, not to mention significantly more, in the claims. Therefore, the claims are rejected over 35 USC 101. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Two rejections are made. Claims 7-11 are rejected under 35 U.S.C. 102 (a)(1) and 102 (a)(2) as being anticipated by Hewezi et al (USPGPUB 20170369900, published 12/28/2017, filed 12/30/2015). Instant claim 7 recites a plant cell comprising an overexpressed gene, wherein the overexpressed gene encodes an miRNA comprising the sequence of SEQ ID NO: 210 or a homolog thereof. As analyzed above, the claim is interpreted as a plant cell comprising an overexpressed gene comprising SEQ ID NO: 210 that encodes an miRNA, or a homolog of SEQ ID NO: 210. As analyzed above, the specification does not define “homolog”. Nevertheless, according to the specification, “gene homologous to a native gene would encode for a protein having the same biological activity as the corresponding protein encoded by the naturally occurring gene” (p14, 1st para). “a homolog of a protein has substantially the same biological activity as the protein” (p14, 2nd para). According to the specification (Table 1 in p20-22), SEQ ID NO: 210 is one of the sequences conferring SCN resistance. Hewezi et al teach and claim soybean plant, part and cell overexpressing genes encoding microRNAs (miRNAs) conferring SCN resistance ([0017], [0019], claims 41 and 43). Hewezi et al demonstrated success of the genes and the encoded miRNAs conferring SCN resistance (Example 6, [0077]-[0078], Table 2). Accordingly, the gene, the encoded miRNA of Hewezi et al, read on the homologs of SEQ ID NO: 210. The soybean cell comprising the gene and miRNA of Hewezi et al anticipates instant claim 7. Regarding dependent claims, Hewezi et al teach and demonstrated using endogenous and/or exogenous promoter to drive the genes ([0035]-[0036], Example 6 in Table 2), teaching the limitation of claim 8. The soybean plant cell of Hewezi et al teach the limitation of claims 9 and 11. Hewezi et al teach expressing the gene encoding the miRNA in seeds ([0036]), the limitation of claim 10. Therefore, Hewezi et al anticipate all of the claims. Claims 7-11 are rejected under 35 U.S.C. 102 (a)(1) as being anticipated by Tian et al (Genome-wide identification of soybean microRNA responsive to soybean cyst nematodes infection by deep sequencing. BMC Genomics. P1-13, 2017). Instant claims have been analyzed above. Tian et al teach and demonstrated identifying microRNAs (miRNAs) responsive to soybean cyst nematodes (SCN) in soybean plant cells, 537 known and 70 putative, and genes encoding the miRNAs (p1, Abstract; left col, 1st para). According to instant specification, the encoding genes of the microRNAs of Tian et al are structurally and functionally similar to SEQ ID NO: 210, and are homologs of SEQ ID NO: 210. Tian et al further teach that the miRNAs have different expression patterns at different infection stage (p6, fig 5, p8, left col, last para). Such different patterns read on overexpression (and/or reduced expression). In addition, claims recite a plant cell, a product, not a process. Thus, without a standard or a comparison, any expression over a baseline is considered overexpression. Thus, Tian et al anticipate claim 7. Regarding dependent claims, claim 8 recites endogenous promoter as an option. Since the microRNAs of Tian et al are expressed, the endogenous promoters are inherently there in Tian et al. Tian et al teach the cells of SCN infection include seeds (p10, left col, 2nd para), the limitation of claims 9-10. The soybean cells of tian et al reads on that of claim 11. Therefore, Tian et al anticipate all of the claims. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the claims at issue are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); and In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The USPTO internet Web site contains terminal disclaimer forms which may be used. Please visit http://www.uspto.gov/forms/. The filing date of the application will determine what form should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp. Two rejections are made. The instant application and US Patents share multiple inventors and the same applicant of University of Tennessee. Claims 7-11 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-7, 13-16 of US Patent 10457956. The USP claims: Claim 1. An elite soybean plant, or a part thereof, comprising an introgression or genetic modification resulting in the elite soybean plant or a part thereof an increased expression of: an miRNA selected from SEQ ID NOs: 12, 25 and 34 and/or the gene of SEQ ID NO: 196, wherein compared to the host soybean plant or a part thereof used to produce the elite soybean plant or a part thereof, the elite soybean plant or a part thereof exhibits an increased resistance to an SCN infection. Instant claim 7 recites a plant cell comprising an overexpressed gene, wherein the overexpressed gene encodes an miRNA comprising the sequence of SEQ ID NO: 210 or a homolog thereof. As analyzed above, the claim is interpreted as a plant cell comprising an overexpressed gene comprising SEQ ID NO: 210 that encodes an miRNA, or a homolog of SEQ ID NO: 210. Although the claims at issue are not identical, they are not patentably distinct from each other because: SEQ ID NO: 210 is not claimed in the US Patent. However, as analyzed above, the specification does not define “homolog”. Instead, the specification loosely and broadly describe homolog. Nevertheless, according to the specification, “gene homologous to a native gene would encode for a protein having the same biological activity as the corresponding protein encoded by the naturally occurring gene” (p14, 1st para). “a homolog of a protein has substantially the same biological activity as the protein” (p14, 2nd para). According to the specification (Table 1 in p20-22), SEQ ID NO: 210 is one of the sequences conferring SCN resistance. Thus, the reference claim 1 teaches the homolog of instant claim 1 in a more specific manner, including introgression of the encoding gene and the function limitation of SCN resistance. Regarding dependent claims, the heterologous promoter, seed, ovule or pollen, soybean or other cyst nematode-host plants, the reference claims 2-7 13-16 teach the limitations of instant claims 8-11. Therefore, the claims are obvious over each other. Claims 7-11 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3-8, 10-13 of US Patent 12157896. The USP claims: Claim 1. A plant cell comprising an overexpressed gene, wherein the overexpressed gene comprises a protein coding sequence of SEQ ID NO: 1 operably linked to a heterologous promoter or SEQ ID NO: 2 operably linked to a heterologous promoter and said plant cell is resistant to infection by soybean cyst nematode (SCN). Instant claim 7 recites a plant cell comprising an overexpressed gene, wherein the overexpressed gene encodes an miRNA comprising the sequence of SEQ ID NO: 210 or a homolog thereof. As analyzed above, the claim is interpreted as a plant cell comprising an overexpressed gene comprising SEQ ID NO: 210 that encodes an miRNA, or a homolog of SEQ ID NO: 210. Although the claims at issue are not identical, they are not patentably distinct from each other because: According to the specification, “gene homologous to a native gene would encode for a protein having the same biological activity as the corresponding protein encoded by the naturally occurring gene” (p14, 1st para). “a homolog of a protein has substantially the same biological activity as the protein” (p14, 2nd para). By sequence alignment, SEQ ID NOs: 1-2 are identical in the US Patent and instant application. SEQ ID NO: 210 is not claimed in the US Patent. However, according to the specification (Table 1 in p20-22), SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 210 are all from Glycine max, soybean, and have the same activity of conferring soybean cyst nematode (SCN) resistance. Thus, by BRI, SEQ ID NO: 2 and SEQ ID NO: 210 are homologs according to the applicant’s description. Thus, the reference claim 1 recite homologs of instant SEQ ID NO: 210 of claim 7, in a more specific manner—including heterologous promoter and including function limitation of resistant to infection by soybean cyst nematode (SCN). Regarding dependent claims, the heterologous promoter, seed, ovule or pollen, soybean or other cyst nematode-host plants, the reference claims 1, 3-8, 10-13, teach the limitations of instant claims 8-11. Therefore, the claims are obvious over each other. Remarks Prior art does not disclose a full-length sequence of SEQ ID NO: 210. The closest sequence matches are provided below, also for compact prosecution. Claims 7-11 do not require any function limitation(s). Thus, a rejection for lacking written description is not made. However, the “homolog” is interpreted by BRI based on the applicant’s own description, in the art and DP rejections. Sequence Matches Against instant SEQ ID NO: 210 Against polynucleotides RESULT 1 BM094464 LOCUS BM094464 528 bp mRNA linear EST 08-JUL-2004 DEFINITION saj16c06.y1 Gm-c1066 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1066-2819 5' similar to TR:Q37113 Q37113 ORF75, mRNA sequence. ACCESSION BM094464 VERSION BM094464.1 DBLINK BioSample: SAMN00161669 KEYWORDS EST. SOURCE Glycine max (soybean) ORGANISM Glycine max Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50 kb inversion clade; NPAAA clade; indigoferoid/millettioid clade; Phaseoleae; Glycine; Glycine subgen. Soja. REFERENCE 1 (bases 1 to 528) AUTHORS Shoemaker,R., Keim,P., Vodkin,L., Erpelding,J., Coryell,V., Khanna,A., Bolla,B., Marra,M., Hillier,L., Kucaba,T., Martin,J., Beck,C., Wylie,T., Underwood,K., Steptoe,M., Theising,B., Allen,M., Bowers,Y., Person,B., Swaller,T., Gibbons,M., Pape,D., Harvey,N., Schurk,R., Ritter,E., Kohn,S., Shin,T., Jackson,Y., Cardenas,M., McCann,R., Waterston,R. and Wilson,R. TITLE Public Soybean EST Project JOURNAL Unpublished COMMENT Contact: Shoemaker R/Public Soybean EST Project Public Soybean EST Project Washington University School of Medicine 4444 Forest Park Parkway, Box 8501, St. Louis, MO 63108, USA Tel: 314 286 1800 Fax: 314 286 1810 Email: est\@watson.wustl.edu When it has been determined, an EST from the other end of this clone is listed in the 'Other ESTs on clone' field. This clone is available through: Biogenetic Services, 801 32nd Ave. Brookings, SD 57006 USA (phone: 800 423 4163; email: info\@biogeneticservices.com) High quality sequence stop: 420. FEATURES Location/Qualifiers source 1..528 /organism="Glycine max" /mol_type="mRNA" /cultivar="Williams" /db_xref="taxon:3847" /clone="GENOME SYSTEMS CLONE ID: Gm-c1066-2819" /tissue_type="Leaf and shoot tip, salt stressed, 2 week old seedling" /clone_lib="SAMN00161669 Gm-c1066" /lab_host="DH10B" /note="Vector: pBluescript II SK+; Site_1: EcoRI; Site_2: XhoI; The cDNA library was constructed from mRNA isolated from unexpanded leaves and the shoot tips of 2 week old seedling from the cultivar Williams. The 2 week old seedlings were salt stressed in a solution of 500mM NaCl for 3 days prior to harvesting. Complementary DNA was synthesized from mRNA using a primer consisting of a poly(dT) sequence with a XhoI restriction site. EcoRI adapters were ligated to the blunt-ended cDNA fragments followed by XhoI digestion. The cDNA fragments were directionally cloned into the EcoRI-XhoI restriction site of the pBluescript vector. The ligated cDNA fragments were transformed into DH10B host cells (GibcoBRL). This library was constructed in the laboratory of Dr. Randy Shoemaker." ORIGIN Query Match 96.8%; Score 146.2; Length 528; Best Local Similarity 98.0%; Matches 148; Conservative 0; Mismatches 3; Indels 0; Gaps 0; Qy 1 GACACCAAAGATAGGGATATTAAACGAATGGAATTAGTATATGGATGTAATATAATGAAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 55 GACACCAAAGATAGGGATATTAAACGAATGGAATTAGTATATGGATGTAATATAATGAAA 114 Qy 61 TAGAGCCACTTTTGGGTTCCCTATGAAATGAGGCATAGAAAGGAGCCACTGTGAAGAAGT 120 |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| Db 115 TAGAGCCACTTTTGGGTTCCCTATGAAATGAGGCATGGAACGGAGCCACTGTGAAGAAGT 174 Qy 121 TTTACGAGTTACGAAGGAAACTTCGAGTTCA 151 ||||||||||||||||||||||||||| ||| Db 175 TTTACGAGTTACGAAGGAAACTTCGAGCTCA 205 RESULT 3 US-10-424-599-22233 (NOTE: this sequence has 3 duplicates in the database searched. See complete list at the end of this report) Sequence 22233, US/10424599 Publication No. US20040031072A1 GENERAL INFORMATION APPLICANT: La Rosa Thomas J APPLICANT: Kovalic David K APPLICANT: Zhou Yihua APPLICANT: Cao Yongwei TITLE OF INVENTION: Soy Nucleic Acid Molecules and Other Molecules Associated With TITLE OF INVENTION: Plants and Uses Thereof for Plant Improvement FILE REFERENCE: 38-21(53223)B CURRENT APPLICATION NUMBER: US/10/424,599 CURRENT FILING DATE: 2003-04-28 NUMBER OF SEQ ID NOS: 285684 SEQ ID NO 22233 LENGTH: 528 TYPE: DNA ORGANISM: Glycine max FEATURE: OTHER INFORMATION: Clone ID: PAT_MRT3847_120079C.1 Query Match 96.8%; Score 146.2; Length 528; Best Local Similarity 98.0%; Matches 148; Conservative 0; Mismatches 3; Indels 0; Gaps 0; Qy 1 GACACCAAAGATAGGGATATTAAACGAATGGAATTAGTATATGGATGTAATATAATGAAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 55 GACACCAAAGATAGGGATATTAAACGAATGGAATTAGTATATGGATGTAATATAATGAAA 114 Qy 61 TAGAGCCACTTTTGGGTTCCCTATGAAATGAGGCATAGAAAGGAGCCACTGTGAAGAAGT 120 |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| Db 115 TAGAGCCACTTTTGGGTTCCCTATGAAATGAGGCATGGAACGGAGCCACTGTGAAGAAGT 174 Qy 121 TTTACGAGTTACGAAGGAAACTTCGAGTTCA 151 ||||||||||||||||||||||||||| ||| Db 175 TTTACGAGTTACGAAGGAAACTTCGAGCTCA 205 Against encoded polypeptides RESULT 2 US-10-424-599-165075 (NOTE: this sequence has 3 duplicates in the database searched. See complete list at the end of this report) Sequence 165075, US/10424599 Publication No. US20040031072A1 GENERAL INFORMATION APPLICANT: La Rosa Thomas J APPLICANT: Kovalic David K APPLICANT: Zhou Yihua APPLICANT: Cao Yongwei TITLE OF INVENTION: Soy Nucleic Acid Molecules and Other Molecules Associated With TITLE OF INVENTION: Plants and Uses Thereof for Plant Improvement FILE REFERENCE: 38-21(53223)B CURRENT APPLICATION NUMBER: US/10/424,599 CURRENT FILING DATE: 2003-04-28 NUMBER OF SEQ ID NOS: 285684 SEQ ID NO 165075 LENGTH: 75 TYPE: PRT ORGANISM: Glycine max FEATURE: NAME/KEY: unsure LOCATION: (1)..(75) OTHER INFORMATION: unsure at all Xaa locations FEATURE: OTHER INFORMATION: Clone ID: PAT_MRT3847_120079C.1.pep Alignment Scores: Length: 75 Score: 86.00 Matches: 17 Percent Similarity: 85.0% Conservative: 0 Best Local Similarity: 85.0% Mismatches: 3 Query Match: 31.9% Indels: 0 Gaps: 0 US-18-965-202A-210 (1-151) x US-10-424-599-165075 (1-75) Qy 88 ATGAGGCATAGAAAGGAGCCACTGTGAAGAAGTTTTACGAGTTACGAAGGAAACTTCGAG 147 ||||||||| ||||||||| ||||||||||||||||||||||||||||||||| Db 1 MetArgHisGlyThrGluProLeuXaaArgSerPheThrSerTyrGluGlyAsnPheGlu 20 Conclusion No claim is allowed. Contact information Any inquiry concerning this communication or earlier communications from the examiner should be directed to WAYNE ZHONG whose telephone number is (571)270-0311. The examiner can normally be reached 8:30am to 5:00pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic, can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Wayne Zhong/ Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Dec 02, 2024
Application Filed
Jun 24, 2026
Non-Final Rejection mailed — §101, §102, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12745740
PEPPER HYBRID DRPB3992 AND PARENTS THEREOF
2y 3m to grant Granted Sep 29, 2026
Patent 12733641
CELL DEATH INHIBITOR AND CELL DEATH INHIBITION METHOD
4y 8m to grant Granted Sep 15, 2026
Patent 12723251
MATERIALS AND METHODS FOR PUFA PRODUCTION, AND PUFA-CONTAINING COMPOSITIONS
3y 7m to grant Granted Sep 01, 2026
Patent 12716071
METHODS FOR PLANT TRANSFORMATION
5y 11m to grant Granted Aug 25, 2026
Patent 12709756
PLANT CELLS, PLANTS, AND SEEDS HAVING TARGETED ENHANCER ELEMENT INSERTIONS
3y 6m to grant Granted Aug 18, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
72%
Grant Probability
94%
With Interview (+21.5%)
2y 10m (~1y 0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 544 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month