Prosecution Insights
Last updated: October 02, 2026
Application No. 18/969,552

SOYBEAN PROMOTERS AND USES THEREOF

Non-Final OA §102§112
Filed
Dec 05, 2024
Priority
Apr 23, 2020 — provisional 63/014,232 +2 more
Examiner
MEADOWS, CHRISTINA L
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Syngenta AG
OA Round
1 (Non-Final)
76%
Grant Probability
Favorable
1-2
OA Rounds
9m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 76% — above average
76%
Career Allowance Rate
51 granted / 67 resolved
+16.1% vs TC avg
Strong +23% interview lift
Without
With
+23.2%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
33 currently pending
Career history
105
Total Applications
across all art units

Statute-Specific Performance

§101
7.0%
-33.0% vs TC avg
§103
28.4%
-11.6% vs TC avg
§102
15.1%
-24.9% vs TC avg
§112
45.4%
+5.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 67 resolved cases

Office Action

§102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of Claims Claims 1-20 are pending and are examined in this Office action. Election/Restrictions Applicant’s election of SEQ ID NOs: 8, 23, 24, 48, 49, and 50 in the reply filed on 06/17/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). SEQ ID NO: 8 is the full-length p11 promoter. SEQ ID NO: 23 is the p11v2 promoter – a truncated form with part of 5’ sequence removed; and SEQ ID NO: 24 is the p11v3 promoter – a truncated form with part of 5’ sequence removed and part of 3’ sequence removed. SEQ ID NO: 48 is the prGmCypCMP-01 promoter, SEQ ID NO: 49 is the prGmCypCMP-02 promoter, and SEQ ID NO: 50 is the prGmCypCMP-03 promoter. Information Disclosure Statement Initialed and dated copy of applicant’s information disclosure statements (IDS) filed on 02/12/2025 and 02/23/2026 are attached to the instant Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. Drawings The drawings are objected to because Figure 2 is mislabeled. Example 2 0f the instant specification (pages 22-23) describes Figure 2 as representing sequences SEQ ID NOs: 1-4, and Figure 2 is labeled as SEQ ID NOs: 2-5. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The use of the terms Genevestigator (page 21, line 25), Bio-Rad (page 22, line 20; page 26, line 8), Olympus (page 22, line 27; page 28, line 25), and New England Biolabs (page 25, line 26), which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore, the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Objections Claims 4, 6, 7, 9, 15, 16, 18, and 19 are objected to under 37 CFR 1.75(c) as being in improper form because a multiple dependent claim should refer to other claims in the alternative only and a multiple dependent claim shall NOT serve as a basis for any other multiple dependent claim. See MPEP § 608.01(n). Accordingly, the claims have not been further treated on the merits. In regard to claim 6, it is suggested to insert the article ---the--- between “wherein” and “expression cassette”. Claim Interpretation For claim 20, phrases that are “optional” within the claim are non-limiting. Improper Markush Grouping Claims 1-20 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117. The Markush grouping of SEQ ID NOs: 1-57 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: PNG media_image1.png 312 1228 media_image1.png Greyscale PNG media_image2.png 313 1202 media_image2.png Greyscale Referencing the above tables from search results done on elected instant SEQ ID NOs: 8 and 48, only non-elected instant SEQ ID NO: 47 (100%) has a greater than 90% identity to instant sequence SEQ ID NO: 8, and only instant SEQ ID NOs: 49 and 50 (98.1% and 97.8%, respectively) have a greater than 90% identity to instant sequence SEQ ID NO: 48. All other instant sequences are well below the threshold of 90% identity as required by claim 1. However, it is noted that SEQ ID NO: 8 fully comprises SEQ ID NO: 23 from 921-1894bp, SEQ ID NO: 24 from 921-1680bp, and SEQ ID NO: 48 from 1298-1799bp. Therefore, SEQ ID NOs: 8, 23, 24 and 48-50 are considered a group in and of themselves. The specification does not describe a common, core structure within SEQ ID NO: 8 or SEQ ID NO: 48 shared by all sequences of the instant application. To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Indefiniteness Claims 5 and 20 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. All dependent claims are included in these rejections unless they include a limitation that overcomes the deficiencies of the parent claim. Regarding claim 5, the phrase "such as" renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d). Claim 20 recites the limitation "transgenic plant, or part thereof" of claim 18. There is insufficient antecedent basis for this limitation in the claim. Neither claim 18, nor claim 16 from which claim 18 depends, recites a "transgenic plant, or part thereof". Claim 16 specifically recites “a plant or plant cell”. The recitation of “part thereof” in claim 20 broadens the claim to encompass multiple “plant parts” as listed in the instant Specification (page 12, lines 18-27). It is suggested to amend claim 20 to depend from claim 19, which does recite "a transgenic plant, or a plant part thereof". Claim Rejections - 35 USC § 112(a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Written Description Claims 1-20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. All dependent claims are included in this rejection unless they include a limitation that overcomes the deficiencies of the parent claim. Claims 1 and 4-20 are broadly drawn to an expression cassette comprising a nucleotide sequence having at least 90% identity with one or more of SEQ ID NO: 8, wherein the nucleotide sequence is operably linked to a heterologous nucleotide sequence. Claims 2 and 3 are broadly drawn to an expression cassette comprising a nucleotide sequence comprising one or more of SEQ ID NO: 8, or a biologically active fragment thereof, wherein the nucleotide sequence is operably linked to a heterologous nucleotide sequence. Polynucleotide sequences having at least 90% sequence identity relative to SEQ ID NO: 8 encompasses polynucleotide sequences having 189 insertions, deletions, and substitutions relative to the 1894 nucleotides of SEQ ID NO: 8. Polynucleotides with 189 insertions, deletions, or substitutions relative to SEQ ID NO: 8 encompass approximately 4189 unique polynucleotides. Applicant fails to teach which nucleic acids of SEQ ID NO: 8 can be altered and/or duplicated, and to which nucleic acids, and also which nucleic acids must not be changed, to maintain the functional activity of the encoded promoter. Applicant fails to teach which nucleic acids of SEQ ID NO: 8 can be altered and/or duplicated, and to which nucleic acids, and also which nucleic acids must not be changed, to maintain the functional ability of the sequence in the claimed expression cassette. Applicant also fails to teach which nucleic acids can be deleted and which region of the sequence can tolerate insertions and still have expression activity as a promoter, or simply as a component within an expression cassette. In regard to claims 2 and 3, the specification does not provide any description of the genus of promoters which are “biologically active fragments” of SEQ ID NO: 8 that possess promoter activity. The instant specification defines a “biologically active fragment” as a fragment of a reference sequence that has activity that is substantially equivalent to (e.g., at least 90% equivalent to) or greater than the activity of the reference sequence (page 7, lines 19-21). SEQ ID NO: 8 is the full-length p11 promoter sequence. The specification does not describe whether the “biologically active fragment” is required to be from the promoter component, the 5’-UTR component, or the 1st intron component of SEQ ID NO: 8. It is unclear if a “biologically active fragment” solely from the 5’-UTR component or the 1st intron component of SEQ ID NO: 8 would retain promoter activity. Furthermore, the specification does not describe any conserved regions of SEQ ID NO: 8 that would be required by the “biologically active fragment” in order to retain promoter activity. The specification fails to sufficiently describe the necessary structural features that must be retained by “biologically active fragments” as to establish a structure-function relationship with respect to the specific function of possessing promoter activity relative to SEQ ID NO: 8. Applicant has not provided adequate description regarding the impact on promoter activity driving gene expression of a “biologically active fragment” of SEQ ID NO: 8. Applicant has not adequately described the structural features that are required to be retained by members of the claimed genus as to establish a structure-function relationship, or the structural features required to distinguish members of the claimed genus from other chemical structures. Therefore, given that there have not been an adequate number of species reduced to practice to be representative of the broad genus of “biologically active fragments” of instant SEQ ID NO: 8, there is not an adequate description to support the breadth of the claims. One of ordinary skill in the art would not recognize that Applicant was in possession of the necessary common attributes or features of the genus in view of the disclosed species. Since the disclosure fails to describe the common attributes that identify members of the genus, and because the genus is both vast and highly diverse, SEQ ID NO: 8 is insufficient to describe the claimed genus. The number of species described by Applicant are insufficient to describe the recited genus by virtue of example, given the vast size of the recited genus and the lack of written description in the instant specification with regard to the structural and functional characteristics of the claimed compositions. Hence, Applicant has not, in fact, described the claimed compositions within the full scope of the claims, and the specification fails to provide an adequate written description of the claimed invention. Claim Rejections - 35 USC § 112(d) The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Failure to Further Limit Claim 20 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. As outlined in the 112(b) Indefiniteness rejection above, the recitation of “part thereof” in claim 20 broadens the claim to encompass multiple “plant parts” as listed in the instant Specification (page 12, lines 18-27). Claim 16 from which claim 18 depends (from which claim 20 depends), recites “a plant or plant cell” (instant Specification, page 12, lines 14-17), which does not encompass the multiple “plant parts” as listed in the instant Specification. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 2-20 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by ZHOU (Zhou et al., CN103667296A, 09/02/2015). Claim 2 is interpreted as “comprising a biologically active fragment” to mean any sequence that comprises a fragment in which the sequence itself is biologically active. In regard to instant claims 2 and 3, ZHOU teaches and claims SEQ ID NO: 1 as a 1057bp nucleotide sequence of the Glycine max SOY001P promoter (NCBI Accession BBF99425) which shares 100% similarity to instant SEQ ID NO: 8 (from 838-1894bp) (i.e., an expression cassette comprising a nucleotide sequence comprising one or more of SEQ ID NO: 8, or a biologically active fragment thereof, wherein the nucleotide sequence is operably linked to a heterologous nucleotide sequence) (Zhou, Specification, pages 10-11; claim 1). The alignment below shows SEQ ID NO: 1 as a “biologically active fragment” of instant SEQ ID NO: 8. Additionally, ZHOU teaches and claims an expression cassette comprising at least one heterologous nucleotide sequence operably linked to the SOY001P promoter of the invention (Zhou, Specification, page 4, paragraph 0009; claims 2 and 9). Query Match 55.8% Best Local Similarity 100.0% Qy 838 ATAATGCATGTGCCTGACCAGCTACGTCTAAGATGTTAATAAGATAGTACTTTTTAATGT 897 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATAATGCATGTGCCTGACCAGCTACGTCTAAGATGTTAATAAGATAGTACTTTTTAATGT 60 Qy 898 AATATTTTTTATTATTATTGATTAAGCTTTTTCTAGATATAAAATAATGCGGGTTTCAGT 957 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 AATATTTTTTATTATTATTGATTAAGCTTTTTCTAGATATAAAATAATGCGGGTTTCAGT 120 Qy 958 TTTCAATTGATAAATTAATAGTTAATATTTTTATAAAAATTAAAATATACAAAAATAAAG 1017 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTTCAATTGATAAATTAATAGTTAATATTTTTATAAAAATTAAAATATACAAAAATAAAG 180 Qy 1018 TGATAAAAATTAATAAATTTTCTATCCTTTTTGAGTTTTTGCTATAAAAATCTAAGGAGA 1077 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TGATAAAAATTAATAAATTTTCTATCCTTTTTGAGTTTTTGCTATAAAAATCTAAGGAGA 240 Qy 1078 AGTTCCCTGGTTCGGAACTGACGTAGACCAATTTTGTAAGAATCGACAATGACGGGTCTT 1137 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AGTTCCCTGGTTCGGAACTGACGTAGACCAATTTTGTAAGAATCGACAATGACGGGTCTT 300 Qy 1138 TTCCGATCCAAATGGTCCCTCCACAGTCCTTAGATCAATCCTTGTCCACATTCACTTGGC 1197 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 TTCCGATCCAAATGGTCCCTCCACAGTCCTTAGATCAATCCTTGTCCACATTCACTTGGC 360 Qy 1198 CCCATCTCCATGTTTTCTCACATCAACTAATTCTCAAGCAAAAAAATAAAATAGGTTCTT 1257 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CCCATCTCCATGTTTTCTCACATCAACTAATTCTCAAGCAAAAAAATAAAATAGGTTCTT 420 Qy 1258 TGAAGGAATGATACAGTGACCAATTTAATTTTTAAATATGTAAAAATTATGATAAATTAA 1317 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 TGAAGGAATGATACAGTGACCAATTTAATTTTTAAATATGTAAAAATTATGATAAATTAA 480 Qy 1318 TTCTATTAAATTTGTGAATTTATTTTATTATTAAGTTATAATATTTAATGACTAATTTGA 1377 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TTCTATTAAATTTGTGAATTTATTTTATTATTAAGTTATAATATTTAATGACTAATTTGA 540 Qy 1378 TAATATATTATATTTTTAAGATTAATTTGATATTAAAGGATAAAATTTATGATCAATTTT 1437 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TAATATATTATATTTTTAAGATTAATTTGATATTAAAGGATAAAATTTATGATCAATTTT 600 Qy 1438 TTTATTAAATTATATGTTAAAATTAATTTATTGTATTTTTTATATATTTGGAGATTAAAT 1497 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TTTATTAAATTATATGTTAAAATTAATTTATTGTATTTTTTATATATTTGGAGATTAAAT 660 Qy 1498 TTTTTTTTCTGTTCACACTTTGTCAGCACTTTTGTTGTTTTTTTTTTCAAAAAGAGAAAA 1557 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 TTTTTTTTCTGTTCACACTTTGTCAGCACTTTTGTTGTTTTTTTTTTCAAAAAGAGAAAA 720 Qy 1558 AGAGAATATAAATTTAAATTTAAAGCAGAAGAGAACGAAGCGGCGTCGTTTGTTGCGGCC 1617 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 AGAGAATATAAATTTAAATTTAAAGCAGAAGAGAACGAAGCGGCGTCGTTTGTTGCGGCC 780 Qy 1618 TGAAAAAAGTCCACACTCGTGAAAGTCATTGGCATAATGACGAGCATATCCGTGAGTGAC 1677 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TGAAAAAAGTCCACACTCGTGAAAGTCATTGGCATAATGACGAGCATATCCGTGAGTGAC 840 Qy 1678 CTCGGATCCGCTCCACTAACCCTAGTCAACTCCAAACTCAACCATAGTTACTTTACTTCA 1737 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CTCGGATCCGCTCCACTAACCCTAGTCAACTCCAAACTCAACCATAGTTACTTTACTTCA 900 Qy 1738 CTCACACCCCGCCACGTGTTCCAATCGAACGGTCACTTCTGCATCACGCGCCACTATAAA 1797 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CTCACACCCCGCCACGTGTTCCAATCGAACGGTCACTTCTGCATCACGCGCCACTATAAA 960 Qy 1798 TATCTCTCTCTCGTCATCCGCAACCCCAAGCAAAACCCTAATCCCTCTTTCTTCCTCTTC 1857 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 TATCTCTCTCTCGTCATCCGCAACCCCAAGCAAAACCCTAATCCCTCTTTCTTCCTCTTC 1020 Qy 1858 CTCAGTAGTGCGATTTTCGATTCTCTTCTCTGCAACT 1894 ||||||||||||||||||||||||||||||||||||| Db 1021 CTCAGTAGTGCGATTTTCGATTCTCTTCTCTGCAACT 1057 In regard to instant claim 4, ZHOU teaches the Glycine max SOY001P promoter can regulate and control the expression of any heterologous nucleotide sequence (encoding a target protein) in a host plant (i.e., wherein the heterologous nucleotide sequence is a nucleic acid of interest that encodes an RNA or protein of interest) (Zhou, page 5, paragraph 21). In regard to instant claim 5, ZHOU teaches the types of transgenes include, for example, resistance genes to which plants are resistant to abiotic stress, including drought, temperature, salts and toxins (insecticides and herbicides) (i.e., wherein the RNA or protein of interest is capable of conferring upon a plant a desired characteristic such as herbicide tolerance). Or the encoded protein gives the plants resistant genes resistant to biotic stress, such as fungi, viruses, bacteria, insects and nematodes, as well as diseases caused by these stresses (i.e., wherein the RNA or protein of interest is capable of conferring upon a plant a desired characteristic such as virus resistance, insect resistance, disease resistance, resistance to other pests) (Zhou, page 6, paragraph 21). In regard to instant claim 6, ZHOU teaches FIG. 2, a T-DNA region map expressing vector pHPG-SOY001P. LB and RB are the left boundary and the right boundary of the T-DNA, respectively; the hpt represents the hygromycin resistance gene (i.e., wherein the heterologous nucleotide sequence encodes a selectable marker or wherein expression cassette further comprises a selectable marker); Pnos represents the promoter of the Nos gene; Tnos represents the terminator of the Nos gene; GUS represents the gus protein gene; T35s represents the terminator of the 35s gene; KpnI and SpeI represent restriction endonuclease KpnI and SpeI restriction sites, respectively; and the promoter is the constitutive expression promoter SOY001P (Zhou, page 7, paragraphs 0034 and 0035; Figure 2, see below). PNG media_image3.png 110 704 media_image3.png Greyscale In regard to instant claims 7-10, ZHOU teaches that the plasmid that has been inserted into the SOY001P promoter sequence was verified by sequencing with KpnI and SpeI double enzymes, and the corresponding positive cloned plasmids were extracted and named pHPG-SOY001P. The plasmid pHPG-SOY001P is proceeded to Agrobacterium AGL0 bacterial strain, to utilize agrobacterium-mediated transformation to carry out co-transformation to Arabidopsis thaliana and tobacco (i.e., a vector comprising the expression cassette, instant claim 7; wherein the vector is a plasmid, virus, or Agrobacterium cell, instant claim 8; a plant cell comprising the expression cassette or vector, instant claim 9; wherein the plant cell is a dicot cell, instant claim 10) (Zhou, page 7, paragraphs 0034 and 0035). In regard to instant claims 11, 14, and 20, ZHOU claims an isolated constitutive expression promoter, wherein the nucleotide sequence of the promoter is as shown in SEQ ID NO: 1 (Zhou, claim 1); an expression cassette, comprising the constitutive expression promoter and a heterologous nucleotide sequence to be driven (Zhou, claim 2); an expression vector, comprising the constitutive expression promoter (Zhou, claim 3); a method for preparing a transgenic plant, characterized in that the transgenic plant comprises the expression cassette (Zhou, claim 4); wherein the plant is a dicotyledonous plant (Zhou, claim 5); wherein the dicotyledonous plant is selected from the group consisting of soybean or rape (Zhou, claim 6) (i.e., wherein the plant cell/plant/transgenic plant or part thereof is a Glycine max cell/plant/transgenic plant or part thereof). In regard to instant claims 12 and 13, ZHOU teaches that several seedlings were selected from transgenic Arabidopsis plants, GUS activity detection was performed, Arabidopsis seedlings show strong expression activity, and GUS staining results of flowers corresponding to seedlings also exhibit strong expression activity, indicating that the GUS gene driven by SOY001P promoter has strong expression in various tissues and organs of plants, and is a constitutive expression promoter (i.e., a transgenic plant comprising the plant cell of claim 9, instant claim 12; wherein the plant is a dicot, instant claim 13). In regard to instant claim 15, ZHOU claims wherein the derivative of the transgenic plant is at least a part of a seed, tissue or cell of the transgenic plant (Zhou, claim 7) (i.e., a seed from the transgenic plant of any one of claims 12 to 14). In regard to instant claims 16-19, Zhou teaches that a "transgenic event" is obtained by using an exogenous DNA vector (containing a nucleic acid expression cassette, which contains a promoter sequence provided by the present invention) for transforming a plant cell (i.e., introducing the expression cassette or vector into a plant or plant cell, instant claim 16), and then culturing the plant cell of the exogenous DNA construct with a genome to obtain a large amount of plant body, and screening according to the inserted exogenous gene to obtain a desired positive transgenic line (i.e., placing the plant or plant cell under conditions whereby an RNA or protein of interest and/or a selectable marker is expressed from the expression cassette or vector, instant claim 17; a transgenic plant produced by the method, or a plant part thereof, instant claim 19). A typical phenotype characteristic of a transgenic event is the expression of a gene of interest. At the genetic level, the "target gene" is part of the plant genome composition. A "transgenic event" also refers to a progeny containing exogenous DNA obtained by crossing a transgenic plant with other plants (i.e., crossing the plant to a second plant or self-crossing the plant to produce a progeny plant, instant claim 18) (Zhou, page 5, paragraph 0018). Summary No claim is allowed. Claim 1 is deemed free of the prior art. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA MEADOWS whose telephone number is (703)756-1430. The examiner can normally be reached Monday - Friday 9:00 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at 571-270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. CHRISTINA MEADOWS Examiner Art Unit 1663 /CHRISTINA L MEADOWS/Examiner, Art Unit 1663 /Amjad Abraham/SPE, Art Unit 1663
Read full office action

Prosecution Timeline

Dec 05, 2024
Application Filed
Jul 24, 2026
Non-Final Rejection mailed — §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12742173
ANTHOCYANIN BIOSYNTHESIS IN CARROT PLANTS
4y 8m to grant Granted Sep 22, 2026
Patent 12741994
PEPTIDE HAVING PLANT STEM CELL-INDUCING EFFECT AND PLANT PEST RESISTANCE-INDUCING EFFECT
3y 6m to grant Granted Sep 22, 2026
Patent 12714047
SOYBEAN VARIETY 5PCNG46
2y 5m to grant Granted Aug 25, 2026
Patent 12708080
METHOD FOR MAGNETIC TRANSFECTION OF MAIZE POLLEN
3y 2m to grant Granted Aug 18, 2026
Patent 12702104
SOYBEAN VARIETY
2y 6m to grant Granted Aug 11, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
76%
Grant Probability
99%
With Interview (+23.2%)
2y 7m (~9m remaining)
Median Time to Grant
Low
PTA Risk
Based on 67 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month