DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I in the reply filed on 5/27/2026 is acknowledged.
Claims 14, 19, 65 & 68 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 5/27/2026
Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i).
The restriction is made FINAL.
Status of Claims
Claims 1-3, 6, 8, 11-12, 15, 16, 18, 20, 22-27, 32-36, 39-42, 49-52, 54-59, 62, 64, 66, 67 & 76 are under examination on the merits.
Claims 14, 19, 65 & 68 are withdrawn.
Nucleotide and/or Amino Acid Sequence Disclosures
This application contains sequence disclosures that are encompassed by the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.831(b). However, this application fails to comply with the requirements of 37 CFR 1.831 through 1.834.
The incorporation of sequence listing (paragraph [0002]) provides the size of the Sequence Listing file in kilobytes, but the size of the file in bytes is required. See 37 CFR 1.834(c)(1)(iii).
In addition, paragraph [0383] line 9 presents a nucleic acid sequence that is more than 10 bases and does not have a provided sequence identification number. This sequence does not match the sequence for SEQ ID NO: 204 in line 3. All nucleic acid sequences longer than 10 bases are required to be present in the sequence listing file and a SEQ ID NO provided when presented in the specification.
Full compliance with the sequence rules is required in response to this Office action. A complete response to this Office action must include both compliance with the sequence rules and a response to the issues set forth herein. Failure to fully comply with both of these requirements in the time period set forth in this Office action will be held to be non-responsive.
Specification
The disclosure is objected to because of the following informalities: Paragraph [0257] presents an unnumbered table.
Appropriate correction is required.
Drawings
The drawings are objected to because figure 7 (top and bottom) presents bar charts with 7 bars but only 6 x-axis labels for the bars. Figures 5 & 6 do have 7 labels, although the labels do not align with the bars in the charts. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Objections
Claims 1, 3, 6, 12, 15, 16, 26, 41, 42, 55 & 76 are objected to because of the following informalities:
Claim 1 (line 4) & claim 41 (lines 4-5): “polynucleotide having a” should be deleted.
Claim 3: needs a period at the end of the claim. MPEP 608.01(m).
Claim 6 (line 13): “and” should read --or--.
Claim 12 (line 16): a conjunction is needed between “SEQ ID NO: 7,” and “SEQ ID NO: 8”.
Claim 15 (line 13): “and” should read --or--, because this list of alternatives is not written in Markush format.
Claim 16 (line 15): “and” should read --or--.
Claim 26 (lines 4-5): “APG6 (Albino and Pale Green 6)” should read --Albino and Pale Green 6 (APG6)--.
Claim 42 (line 12): a conjunction is needed before the last option in the list.
Claim 54 (line 14): the abbreviation “HPPD” should be written out in full at first use.
Claim 55 (line 16): a conjunction is needed before “the other PPO herbicide”.
Claim 55 (line 2 of part c): “2,4,5-T (2,4,5-trichlorophenoxyacetic acid)” should read --2,4,5-trichlorophenoxyacetic acid (2,4,5-T)--.
Claim 76 (line 3): one instance of “further” should be deleted.
Appropriate correction is required.
Claim Interpretation
The formatting of claim 26 lines 11-22 has been interpreted to mean the limitation in these lines belongs to part b) and not part a), and claim 26 and its dependents have been examined accordingly.
Claim Rejections - 35 USC § 112
Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 32, 50, 55, 56 & 62 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. All dependent claims are included in the rejections below.
The term “about” in claim 32 (line 4) and claim 56 (line 2) is a relative term which renders the claim indefinite. The term “about” is not defined by the claim. The specification defines “about” as indicating a value or a range of values which would be understood as an equivalent of a stated value and can be greater or lesser than the value (paragraph [0152]), which does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention.
Claim 50 requires a soybean plant, plant seed, plant part, or plant cell obtained by the method of claim 35. Claim 35 is a method of obtaining a seed or a plant that is tolerant to PPO herbicides (lines 1-2). Claim 35 also comprises a step of obtaining a population of progeny seed or plants at least one of which comprises soybean event Gm_CSM63717 (lines 3-4). It is indefinite whether the plant of claim 50 is drawn to a plant obtained in lines 3-4, which may not comprise soybean event Gm_CSM63717 or have tolerance to PPO herbicides, or if claim 50 is drawn to plants obtained from the method as a whole, which requires identifying a plant or seed comprising the event. Because these two interpretations have different scopes, the claim is indefinite.
Claim 55 (line 5-6) recites “a salt of any thereof, and an ester of any thereof”. It is unclear if the claim encompasses esters of salts, as it is written, or if the claim is meant to encompass only salts of any of the listed diphenylethers and esters of any of the listed diphenylethers. Because the material encompassed by the list is unclear, claim 55 is indefinite.
Claim 55 (line 14) recites “its salts and esters”. The claim is indefinite as to whether “it” refers to carfentrazone or another triazolinone, making claim 55 indefinite.
Regarding claim 62, the phrase "such as" renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d). This applies to the examples in the parentheses of viable plant parts (line 5), the examples of foods for human consumption (lines 7-10), the example of plant parts processed for animal feed (lines 10-11), and the examples of bio-composite building materials (lines 11-12).
Claim 62 recites edamame and yuba in parentheses (line 9). It is unclear if the recited material is limited to only soy films that are yuba and only vegetable soybean that is edamame. Because it is unclear whether the limitations within the parentheses are part of the claimed invention, claim 62 is indefinite.
Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 6, 8, 11, 12, 15, 16, 18, 20, 24, 41, 42, 51, 52, 54, 55, 59, 62, & 66-67 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
A. Claims 6, 8, 18, 20, & 24 are drawn to or require a polynucleotide segment of sufficient length to function as a DNA probe that hybridizes specifically under “stringent hybridization conditions”. Claims 11, 12, 15, 16, 20, & 22 are drawn to or require a pair of DNA molecules comprising a fragment of SEQ ID NO: 10 or complement thereof and function as primers when used together in an amplification reaction to produce an amplicon diagnostic for soybean event Gm_CSM63717. Claims 12 & 16 encompass or require primers that amplify an amplicon which comprises a nucleotide sequence which comprises a fragment of SEQ ID NOs: 1-8 wherein the fragment is at least 10 nucleotides in length and comprises nucleotides 1000-1001 or 4201-4202 of SEQ ID NO: 10. Nucleotides 1000-1001 or 4201-4202 of SEQ ID NO: 10 are AC and CA respectively. The claims and specification describe one set of PCR conditions which would produce the diagnostic amplicon (paragraphs [0377], table 16-18) but these conditions are not required by the claims, so the sequence of the encompassed primers are very broad.
Thus, the claims broadly require DNA molecules that hybridize under “stringent hybridization conditions” to be diagnostic for soybean event Gm_CSM63717 or DNA molecules that are fragments of SEQ ID NO: 10 and which also amplify a fragment of SEQ ID NO: 1-8 that is 10 nucleotides long and comprises either AC or CA.
The instant specification defines hybridization as when a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (paragraph [0173]); however, this definition of “stringent hybridization conditions” encompasses different temperatures or salt concentrations leading to different “greater degrees” of hybridization. The specification describes different considerations in the selection of stringent conditions and provides example conditions (paragraphs [0173-0174]).
The specification defines “specific for” as meaning a probe or primer hybridizes under stringent hybridization conditions only to the target sequence. However, provided the range of conditions encompassed by the definition of “stringent hybridization conditions” in the specification, an unknowable number of probes or primers may be considered specific for sequences that are diagnostic for the presence of soybean event Gm_CSM63717.
The specification describes that the junction segments described in the instant specification may be diagnostic for the presence of event Gm_CSM63717 (paragraph [0136, 0155-0156]). The specification describes that the identification or detection of SEQ ID NOs: 1-10 is diagnostic that the plant has or comprises at least part of soybean event Gm_CSM63717. However, the specification also circularly describes hybridization of the DNA molecule under stringent hybridization conditions as diagnostic for the presence of soybean event Gm_CSM63717 (paragraph [0014, 0018]). Claims 6, 8, 18, 20, & 24 and 11, 12, 15, 16, 20, & 22 do not require SEQ ID NOs: 1-10 in their entirety.
The specification provides examples of primers and probes (SEQ ID NOs: 176-178, table 15). However, these examples are not representative of all DNA molecules capable of serving as a primer or probe diagnostic to soybean event Gm_CSM63717.
Given the diversity of sequences capable of hybridizing to or amplifying a target within soybean event Gm_CSM63717 that may or may not also hybridize to or amplify a target within another soybean background, and given the circular description in the specification of what constitutes a diagnostic DNA molecule, one of ordinary skill in the art would not conclude that Applicant was in possession of the full scope of primers or probes or even a representative sample of primers and probes encompassed by the claims. One of skill in the art would not recognize that Applicant was in possession of the necessary common attributes or features of the genus in view of the disclosed species.
Hence, Applicant has not, in fact, described DNA molecules that function as probes or primers diagnostic for soybean event Gm_CSM63717 over the full scope of the claims, and the specification fails to provide an adequate written description of the claimed invention. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
B. Claims 41, 42, 54, 55, 59 & 62 are drawn to a soybean plant or plant material comprising a recombinant DNA molecule comprising a sequence selected from SEQ ID NOs: 1-10 or a sequence that is at least 90% identical to SEQ ID NO: 9 or 10 or a construct comprising the expression cassette of claim 26. Claims 66 & 67 are drawn to methods requiring these plants. Claim 51 requires a DNA construct integrated in chromosome 13, flanked by at least 10 contiguous nucleotides of SEQ ID NO: 11, 14, 12 or 15, while claim 52 further requires SEQ ID NO: 36-105 or 106-175.
The claims broadly require any plant or plant material comprising a sequence selected from SEQ ID NOs: 1-10 or with 90% identity to SEQ ID NO: 9 or 10.
Polynucleotides with 90% identity to SEQ ID NO: 9 or 10 encompasses polynucleotides comprising 320 substitutions relative to the 3201 nucleotide-long SEQ ID NO: 9 and 520 substitutions relative to the 5201 nucleotide-long SEQ ID NO: 10.
The specification describes one soybean plant comprising SEQ ID NOs: 1-10: soybean event Gm_CSM63717, which comprises SEQ ID NOs: 1-10 exactly (figure 1). Soybean event Gm_CSM63717 does not comprise substitutions that constitute 90% sequence identity to SEQ ID NO: 9 or 10. Soybean event Gm_CSM63717 does not comprise one of SEQ ID NO: 1-10 without comprising all of SEQ ID NO: 1-10. The specification describes one soybean plant with recombinant DNA integrated in chromosome 13 and flanked by at least 10 nucleotides of SEQ ID NO: 11, 12, 14, or 15, and that plant, event Gm_CSM63717, is flanked by SEQ ID NOs: 11 and 12 exactly (figure 1). The specification describes no plant flanked by only part of SEQ ID NO: 11 or 12 or flanked by only one and not the other.
The specification describes generation of various constructs and events, including 18 constructs for site directed integration and 8 constructs for autoexcision of the selectable marker, and over 769 constructs transformed into soybean. The specification describes construction and testing of 769 proof-of-concept transformation constructs and testing 22,000 unique transformation events (paragraph [0309]), but these events do not all comprise the construct comprised by event Gm_CSM63717. The specification describes that over 200 constructs containing 121 PPO genes were assayed (paragraph [0314]). Ninety-seven constructs were advanced to field testing (paragraphs [0311- 0356] table 4, 5). How many of these constructs and events meet the limitations of claims 41, 42, 51, 52, 54, 55, 59 & 62 the specification does not describe.
The specification also describes design of target sites for site directed integration near to Gm_CSM63714, and plants successfully edited at the sites (paragraph [0319-0326], table 6 & 7). Four constructs were then tested in soybean, leading to 13,142 transformation events (paragraph [0327-0328]). Only 22 of those comprised a targeted insertion, and only 9 were homozygous, targeted insertions, and auto-excised (table 8). The specification describes analyzing the events to confirm the transgene had no SNPs (paragraph [0329]), but no plants comprising transgenes comprising SNPs were described. The transgenic insert of soybean event Gm_CSM63717 is described as having the elements and sequences of Table 1 and an 11-nucleotide genomic sequence deletion at the insertion (paragraph [0360-0362]).
The specification describes stacking Gm_CSM63717 with Gm_CSM63714 and MON89788 (paragraph [0357-0359]).
The specification provides a prophetic example of how one of skill in the art might alter or excise all or part of the transgenic insertion present in soybean event Gm_CSM63717 through genome editing such as CRISPR editing. The specification describes scanning flanking genomic sequences for originator guide RNA recognition sites to define and insert a Cognate guide RNA recognition site into the genome (paragraph [0379-0387]). Additionally, the specification describes a prophetic method of modifying soybean event Gm_CSM63717 using two guide RNAs to excise all or a part of the transgenic insertion as well as flanking genomic DNA segments (paragraphs [0388-0392]). The specification describes forming recombinant DNA molecules by inserting heterologous nucleic acid molecules diagnostic for the presence of soybean event Gm_CSM63717 into the genomic DNA Of a soybean plant (paragraph [0138]).
However, the specification does not describe plants created by Applicant with part of the transgenic insertion excised. More critically, excision of part of the event is not representative of the full scope of recombinant DNA molecules comprised by plants encompassed by the claims or integrated on chromosome 13 and flanked by sequences encompassed by the claims.
Therefore, Applicant has not described plants comprising DNA molecules or constructs over the full scope of the claims, and the specification fails to provide an adequate written description of the claimed invention. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
Enablement
Claims 2, 3, 6, 8, 11, 12, 15, 16, 18, 20, 22-25, 32-36, 42, 49-50, 54-59, 62, 64, & 76 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The claims all require seed comprising soybean event Gm_CSM63717 having been deposited as ATCC Accession No. PTA-127604.
Since the seed claimed is essential to the claimed invention, it must be obtainable by a repeatable method set forth in the specification or otherwise be readily available to the public.
The specification does not disclose a repeatable process to obtain the exact same seed in each occurrence and it is not apparent if such a seed is readily available to the public.
If a seed is not so obtainable or available, a deposit thereof may satisfy the requirements of 35 U.S.C. 112. So long as the number of seeds deposited complies with the requirements of the IDA where the deposit is made, the USPTO considers such a compliant submission as satisfying the rules under 37 CFR 1.801 through 1.809.
It is noted that Applicant has stated that seeds for Accession No. PTA-127604 have been deposited at the ATCC (paragraph [0308]), but there is no indication that the seeds have been accepted under the Budapest Treaty.
If the deposit of these seeds is made and accepted under the terms of the Budapest Treaty, then an affidavit or declaration by the Applicant, or a statement by an attorney of record over his or her signature and registration number, stating that the seeds will be irrevocably and without restriction or condition released to the public upon the issuance of a patent would satisfy the deposit requirement made herein.
If the deposit has not been made and accepted under the Budapest Treaty, then in order to certify that the deposit, meets the requirements set forth in 37 CFR 1.801-1.809, Applicant may provide assurance of compliance by an affidavit or declaration, or by a statement by an attorney of record over his or her signature and registration number showing that
(a) during the pendency of the application, access to the invention will be afforded to the Commissioner upon request;
(b) all restrictions upon availability to the public will be irrevocably removed upon granting of the patent;
(c) the deposit will be maintained in a public depository for a period of 30 years or 5 years after the last request or for the enforceable life of the patent, whichever is longer; and
(d) the viability of the biological material at the time of deposit will be tested (see 37 CFR 1.807).
In addition, the identifying information set forth in 37 CFR 1.809(d) should be added to the specification. See 37 CFR 1.801 - 1.809 [MPEP 2401-2411.05] for additional explanation of these requirements.
Scope of Enablement
Claims 41-42 & 54-55 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a soybean plant, plant seed, plant part, or plant cell comprising the full length of SEQ ID NO: 10 or 9 or the construct of claim 26 part a) which comprises the herbicide-tolerance trait, does not reasonably provide enablement for soybean plants, plant seeds, plant parts, or plant cells comprising a recombinant DNA molecule or DNA construct which does not comprise the herbicide-tolerance trait. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
Claims 41-42 & 54-55 are drawn to a soybean plant, plant seed, plant part, or plant cell comprising a recombinant DNA molecule comprising a sequence of SEQ ID NO: 1-10 or having a sequence that is at least 90% identical to SEQ ID NO: 10 or 9. Claim 42, part e, encompasses progeny of any generation, which may share nothing in common with the plant comprising soybean event Gm_CSM63717 except the required DNA molecule of claim 41. Claim 42, part f, limits the plant part but not the DNA molecule required. Claims 54-55 still encompass plants that do not comprise the entire construct of soybean event Gm_CSM63717 or the herbicide-tolerance trait.
One of skill in the art would understand how to generate the sequences encompassed by claims 41-42 & 54-55. Transformation of such sequences into soybean would also be well within the skill of an ordinary practitioner of the art. However, the instant invention enables one of skill in the art to make and use soybean plants comprising a PPO-herbicide tolerance gene. The instant disclosure does not teach how to use a soybean plant comprising sequences encompassed by claims 41-42 & 54-55 that does not have PPO-herbicide tolerance. One of skill in the art would be required to conduct undue trial and error experimentation to determine a use for plants encompassed by claims 41-42 & 54-55 without herbicide tolerance. Thus, plants of claims 41-42 & 54-55 are not enabled for use over the full scope of the claimed material by one of ordinary skill in the art.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 50 is rejected under 35 U.S.C. 102(a)(1) as anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over Hoffman et al US 2013/0055453 A1 (published 2/28/2013, hereafter Hoffman).
Claim 50 is drawn to a plant obtained by the method of claim 35. Claim 35 comprises a step wherein progeny plants are obtained from the plant of claim 3, which comprises soybean event Gm_CSM63717.
The plant of claim 3 is not required to be homozygous for soybean event Gm_CSM63717, so the plant obtained in claim 35 need not have soybean event Gm_CSM63717. "[E]ven though product-by-process claims are limited by and defined by the process, determination of patentability is based on the product itself. The patentability of a product does not depend on its method of production. If the product in the product-by-process claim is the same as or obvious from a product of the prior art, the claim is unpatentable even though the prior product was made by a different process." In re Thorpe, 777 F.2d 695, 698, 227 USPQ 964, 966 (Fed. Cir. 1985).
Hoffman discloses a soybean plant (abstract) which reads on instant claim 50 because the plants obtained by the method of instant claim 35 have no required structural features other than that they are soybean.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 6, 8, 11, 12, 18, 20 & 50 are rejected under 35 U.S.C. 103 as being unpatentable over Hoffman et al US 2013/0055453 A1 (published 2/28/2013, hereafter Hoffman).
Claims 6, 8, 11, 12, 18, 20 & 50 are drawn to a DNA molecule capable as serving as a probe or primer which is diagnostic to soybean event Gm_CSM63717 under stringent hybridization conditions, methods of using the primers and probe, a kit comprising the primers and probe, and a plant obtained from progeny of a plant comprising soybean event Gm_CSM63717.
Hoffman teaches a sequence described as a 5’ border and T-strand insert (Hoffman SEQ ID NO: 19) with 61% identity to SEQ ID NO: 3, or 32 identical nucleotides. See alignment below. These nucleotides are found within instant SEQ ID NO: 10 and constitute a fragment thereof. This sequence is found in soybean event pDAB8264.42.32.1, which comprises traits conferring resistance to glyphosate, aryloxyalkanoate, and glufosinate herbicides (abstract). This identical sequence is found within the 5’ genomic flanking sequence of event pDAB8264.42.32.1 (paragraph [0076]). The sequence includes both “CA” and “AC”. Hoffman teaches probes and/or primers and detection kits comprising probes and/or primers for detecting junction sequences (paragraph [0115]). Hoffman teaches that one common design is to have one primer, which is about at least 15 residues in length, hybridize in the flanking region and one primer hybridize in the insert to generate/amplify a amplicon that indicates the presence of an event (paragraph [0115]). Hoffman teaches examples of detecting event pDAB8264.42.32.1 and a motivation to detect the event to determine zygosity of plants in breeding populations (paragraphs [0206-0210]). Hoffman teaches that primers and probes based on flanking DNA can be used to confirm disclosed sequences by sequencing (paragraph [0134]).
US-13-548-720-19
Sequence 19, US/13548720
Publication No. US20130055453A1
GENERAL INFORMATION
APPLICANT: Dow AgroSciences LLC
APPLICANT: MS Technologies, LLC
APPLICANT: Hoffman, Thomas
APPLICANT: Parkhurst, Dawn M.
APPLICANT: Zhou, Ning
APPLICANT: Pareddy, Dayakar
APPLICANT: Cui, Yunxing C.
APPLICANT: Bard, Nathan
APPLICANT: Toledo, Sandra G.
APPLICANT: Bradfisch, Gregory A.
APPLICANT: Held, Bruce
APPLICANT: Sekar, Vaithilingam
APPLICANT: Wang, Yang
APPLICANT: Clark, Lauren
APPLICANT: Russell, Sean M.
APPLICANT: Smith, Kelley A.
APPLICANT: Wright, Terry R.
TITLE OF INVENTION: STACKED HERBICIDE TOLERANCE EVENT 8264.42.32.1, RELATED
TITLE OF INVENTION: TRANSGENIC SOYBEAN LINES, AND DETECTION THEREOF
FILE REFERENCE: DAS-P0211
CURRENT APPLICATION NUMBER: US/13/548,720
CURRENT FILING DATE: 2012-07-13
PRIOR APPLICATION NUMBER: 61/507,444
PRIOR FILING DATE: 2011-07-13
PRIOR APPLICATION NUMBER: 61/515,634
PRIOR FILING DATE: 2011-08-05
NUMBER OF SEQ ID NOS: 21
SEQ ID NO 19
LENGTH: 1550
TYPE: DNA
ORGANISM: Artificial
FEATURE:
OTHER INFORMATION: 5' border and T-strand insert
FEATURE:
NAME/KEY: T-strand insert
LOCATION: (1247)..(1550)
Query Match 61.3%; Score 36.8; Length 1550;
Best Local Similarity 85.4%;
Matches 41; Conservative 0; Mismatches 7; Indels 0; Gaps 0;
Qy 13 TATATTTTTGTAGTGAGACCAGTCAGCATCATCACACCAAAAGTTAGG 60
|| ||||| | | ||||||||||||||||||||||||||||||||
Db 1229 TAATTTTTTATTCTCTGACCAGTCAGCATCATCACACCAAAAGTTAGG 1276
Before the filing of the instant application, it would have been obvious to one of ordinary skill in the art to design primers or probes comprising a fragment of instant SEQ ID NO: 3. One of ordinary skill in the art would have been motivated to design primers or probes comprising a fragment of instant SEQ ID NO: 3 in order to determine zygosity of populations of event pDAB8264.42.32.1, because Hoffman teaches a sequence comprising a fragment of SEQ ID NO: 3 in the flanking region of soybean event pDAB8264.42.32.1. One of ordinary skill in the art would have had reasonable expectation of success, because design of primers and probes for detection of soybean events was routine in the art prior to the filing of the instant application.
Thus, the probe of claims 6, 8 and a kit comprising the probe (claim 20) are obvious over Hoffman, as is the method of instant claim 18, wherein a soybean sample is contacted with the DNA molecule and a sequencing reaction is performed. The probe, and the target sequence that is sequenced, would comprise a nucleotide sequence that is a fragment of SEQ ID NO: 3 that is at least 10 nucleotides long and comprises nucleotides 1000-1001 or 4201-4202 of SEQ ID NO: 10.
A primer set designed comprising a primer found in the sequence of Hoffman SEQ ID NO: 19 above would generate an amplicon that is a fragment of SEQ ID NO: 3, 5, 7 & 10 that is at least 10 nucleotides in length, making the primer set of claims 11 & 12 obvious.
Finally, instant claim 50 is drawn to a soybean plant obtained by the method of claim 35. The method of claim 35 requires a step of “obtaining” progeny seed of the plant of claim 3. The plant of claim 3 is not required to be homozygous for soybean event Gm_CSM63717, so the plant obtained in claim 35 need not have soybean event Gm_CSM63717. "[E]ven though product-by-process claims are limited by and defined by the process, determination of patentability is based on the product itself. The patentability of a product does not depend on its method of production. If the product in the product-by-process claim is the same as or obvious from a product of the prior art, the claim is unpatentable even though the prior product was made by a different process." In re Thorpe, 777 F.2d 695, 698, 227 USPQ 964, 966 (Fed. Cir. 1985). The soybean plants of Hoffman read on plants that are obtained by the method of claim 35, because the plants obtained by the method of claim 35 have no required structural features other than that they are soybean.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claim 6 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1 of copending Application No. 18/949,035 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because claim 6 is drawn to a DNA molecule comprising a polynucleotide segment of sufficient length to function as a DNA probe that hybridizes specifically under stringent hybridization conditions with soybean event Gm_CSM63717. The instant specification does not define stringent hybridization conditions, so the claim encompasses DNA molecules of any length or any sequence that may hybridize with soybean event Gm_CSM63717 to be diagnostic for soybean event Gm_CSM63717.
‘035 claim 1 is drawn to a recombinant DNA polynucleotide comprising a DNA sequence comprising a fragment with at least 95% sequence identity to ’035 SEQ ID NO: 1.
‘035 SEQ ID NO: 1 comprises a sequence that is 100% identical to a sequence of instant SEQ ID NO: 9. See alignment below. Instant SEQ ID NO: 9 is the insert of soybean event Gm_CSM63717. A DNA molecule comprising a sequence of ‘035 SEQ ID NO: 1 would be capable of hybridizing under stringent hybridization conditions with soybean event Gm_CSM63717 to be diagnostic for soybean event Gm_CSM63717 in a sample. Thus, a probe of instant claim 6 is obvious over ‘035 claim 1.
US-18-971-656-9
Sequence 9, US/18971656
Publication No. US20250197952A1
GENERAL INFORMATION
APPLICANT: Monsanto Technology LLC (en)
TITLE OF INVENTION: TRANSGENIC SOYBEAN EVENT GM_CSM63717 AND COMPOSITIONS AND METHODS FOR DETECTION AND USES THEREOF (en)
FILE REFERENCE: MONS:572US
CURRENT APPLICATION NUMBER: US/18/971,656
CURRENT FILING DATE: 2024-12-06
NUMBER OF SEQ ID NOS: 239
SEQ ID NO 9
LENGTH: 3201
TYPE: DNA
FEATURE:
NAME/KEY: source
LOCATION: 1..3201
QUALIFIERS: mol_type = other DNA
organism = synthetic construct
Query Match 100.0%; Score 400; Length 3201;
Best Local Similarity 100.0%;
Matches 400; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TCCTTCTGGAGGCCGCCGGCGGTGTTTTGGTTTTGTACTATATCTGTTTTTCTGTCTGTT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 731 TCCTTCTGGAGGCCGCCGGCGGTGTTTTGGTTTTGTACTATATCTGTTTTTCTGTCTGTT 672
Qy 61 TTGTGTACTGGTGCCAGCAAAGGGAGCTTGCTTTGTTGAACCTAGTTTCTGTAATTTGCT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 671 TTGTGTACTGGTGCCAGCAAAGGGAGCTTGCTTTGTTGAACCTAGTTTCTGTAATTTGCT 612
Qy 121 TCGTGTGATCAAGAATTGTATCTGCTGCACAGTTGTAAACTGTAATATATTTGAATAATT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 611 TCGTGTGATCAAGAATTGTATCTGCTGCACAGTTGTAAACTGTAATATATTTGAATAATT 552
Qy 181 AATAAATTTTATTTTGTCATACCCTGGAGATATCTGCACGCACGGTTTTGTTGCTTTGGT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 551 AATAAATTTTATTTTGTCATACCCTGGAGATATCTGCACGCACGGTTTTGTTGCTTTGGT 492
Qy 241 TTGGTTTGCGACTTGTCTGTTTGGGAGACAATAAGCTAGCTGCTTGAAATTTTGGTTATA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 491 TTGGTTTGCGACTTGTCTGTTTGGGAGACAATAAGCTAGCTGCTTGAAATTTTGGTTATA 432
Qy 301 TTTTCCCCACAAGAAATTTGTTTGGTGAATCTCTCGTCTTATATAATAAAAACGGCTTGT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 431 TTTTCCCCACAAGAAATTTGTTTGGTGAATCTCTCGTCTTATATAATAAAAACGGCTTGT 372
Qy 361 GTTTGTTTTTTTGGTTGCTACTGTTTGGAGCAAACACCAG 400
||||||||||||||||||||||||||||||||||||||||
Db 371 GTTTGTTTTTTTGGTTGCTACTGTTTGGAGCAAACACCAG 332
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Larue et al (2019) Pest Manag Sci. 76: 1031-1038 (published 10/20/2019, hereafter Larue).
Larue teaches that some microbial HemY PPOs demonstrate better tolerance to PPO-inhibiting herbicides than eukaryotic HemY-type PPOs (page 1032, left column, paragraph 2).
Larue teaches transformation of soybean with constructs for constitutive expression of HemG PPO variants and that the plants were screened in the field with PPO-inhibiting herbicides flumioxazin and S3100 (page 1033, right column, paragraph 2). Larue teaches a HemG PPO variant from Enterobacter cloacae named H_N90 and found in GenBank accession number MN102108 (page 1034, left column, paragraph 1). Larue teaches that soybean transformed with H_N90 had low injury following spray application with S3100 and flumioxazin (page 1036, right column, paragraph 3-page 1035, left column, paragraph 1).
The constitutive plant expression vectors driving PPO genes were codon optimized for plant expression, and some constructs had the addition of a chloroplast targeting peptide (page 1033, left column, paragraph 2). Larue teaches that the targeting peptide was from the albino or pale green 6 protein from Arabidopsis, and that HemG PPOs without a CTP failed to recover herbicide-tolerant plants (page 1034, right column, paragraph 3). Larue teaches that the constitutive promoter was a ubiquitin promoter (page 1035, right column, paragraph 3).
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-F 8:00am-4pm EDT.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/VICTORIA L DELEO/Examiner, Art Unit 1662
/Anne Kubelik/Primary Examiner, Art Unit 1663