DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Claims
Claims 1-11 are pending.
Claims 1-11 are examined herein.
Claims 1-11 are rejected.
Priority
Application No. 18/977,511 filed on 12/11/2024 claims foreign priority to Chinese Application No. CN202410202773.1 filed on 02/23/2024.
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
No certified English translation of the foreign priority document has been filed.
Should applicant desire to obtain the benefit of foreign priority under 35 U.S.C. 119(a)-(d) prior to declaration of an interference, a certified English translation of the foreign application must be submitted in reply to this action. 37 CFR 41.154(b) and 41.202(e).
Failure to provide a certified translation may result in no benefit being accorded for the non-English application.
Claim Objections
In claim 6, “d” is used as an abbreviation. It is suggested to
insert a definition for d without bringing in new matter, immediately before the first
appearance of “d” in claim 6; and to enclose the appearance of “d” in
parentheses (in claim 6 only). Alternatively, replace “d” with the definition of “d” in each occurence.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 5-11 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 5 recites:
A method for using the kit according to claim 1, comprising introducing an Agrobacterium strain with an AnUFGT1 gene of Anthurium andraeanum into a pedicel of an unfolded young spathe of the Anthurium andraeanum 'Xueyu' using a syringe, and conducting phenotypic observation immediately after the unfolded young spathe unfolds; wherein the introducing specifically comprises the following steps: piercing the pedicel at a position of 1 cm to 3 cm below the unfolded spathe to form a first injection point by diagonally piercing 2 mm to 3 mm downward, gently and slowly pushing the syringe by 1 μL to 3 μL to allow first injection, and applying vaseline around an obtained needle hole while pulling out the syringe on a first day; conducting second injection at a position 0.4 cm to 0.6 cm upward from the first injection point on a same pedicel to form a second injection point on a second day; and conducting third injection at a position 0.4 cm to 0.6 cm upward from the second injection point on the same pedicel to obtain an injected young spathe.
Based on the claim, the pedicel which is a region of the stalk below the flower/ spathe is the site of agrobacterium injection, thus creating an injected pedicel. The claim also produced an injected young spathe. It is unclear how injection of one anatomical plant part, the pedicel, produces an injected plant part other than an injected pedicel (the other plant part being the spathe). For purposes of examination, the claim is broadly interpreted to require piercing the spathe with the specified quantities and at the specified times to obtain an injected young spathe, as supported by the final product of claim 5 (an injected young spathe) and by Fig. 2B-C in Applicant’s disclosure.
Claims 6-11 are further rejected as a function of their dependency.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-3 and 5-8 are rejected under 35 U.S.C. 103 as being unpatentable over Toves (Toves, P. J. (2022). Anthurium flower color: histology and genetic manipulation (Doctoral dissertation, University of Hawai'i at Manoa).), Li (Li, Z., Wang, J., Zhang, X., & Xu, L. (2015). Comparative transcriptome analysis of Anthurium “Albama” and its anthocyanin-loss mutant. PLoS One, 10(3), e0119027.), and Thorneycroft (Thorneycroft, D., Sherson, S. M., & Smith, S. M. (2001). Using gene knockouts to investigate plant metabolism. Journal of experimental botany, 52(361), 1593-1601.), and as evidenced by Barampuram (Barampuram, S., & Zhang, Z. J. (2010). Recent advances in plant transformation. Plant chromosome engineering: methods and protocols, 1-35.), Mikić (Mikić, A., Alomari, A., & Gowers, D. M. (2023). Classical recombinant DNA cloning. In DNA Manipulation and Analysis (pp. 1-24). New York, NY: Springer US.), and Engler (Engler, C., & Marillonnet, S. (2013). Golden gate cloning. In DNA cloning and assembly methods (pp. 119-131). Totowa, NJ: Humana Press.).
Claim 1 is drawn to a kit for rapid verification of an anthocyanin biosynthesis gene function, comprising Anthurium andraeanum 'Xueyu', a syringe, primers and a suspension solution.
Claim 2 is drawn to the kit according to claim 1, wherein the Anthurium andraeanum 'Xueyu' is a white variety lacking anthocyanin with a Plant Variety Rights NO. of CAN20090270.0, has a seedling age of 2 to 3 years, blooms normally under room-temperature cultivation, and is stored in National Gene Bank of Tropical Crops.
Claim 3 is drawn to the kit according to claim 2, wherein the primers have sequences shown in SEQ ID NO: 1 to SEQ ID NO: 4.
Claim 5 is drawn to a method for using the kit according to claim 1, comprising introducing an Agrobacterium strain with an AnUFGT1 gene of Anthurium andraeanum into a pedicel of an unfolded young spathe of the Anthurium andraeanum 'Xueyu' using a syringe, and conducting phenotypic observation immediately after the unfolded young spathe unfolds; wherein the introducing specifically comprises the following steps: piercing the pedicel at a position of 1 cm to 3 cm below the unfolded spathe to form a first injection point by diagonally piercing 2 mm to 3 mm downward, gently and slowly pushing the syringe by 1 μL to 3 μL to allow first injection, and applying vaseline around an obtained needle hole while pulling out the syringe on a first day; conducting second injection at a position 0.4 cm to 0.6 cm upward from the first injection point on a same pedicel to form a second injection point on a second day; and conducting third injection at a position 0.4 cm to 0.6 cm upward from the second injection point on the same pedicel to obtain an injected young spathe.
Claim 6 is drawn to the method according to claim 5, specifically comprising the following steps: (1) selecting an Anthurium andraeanum 'Xueyu' plant with the unfolded young spathe; (2) collecting bacterial cells with an expression vector of the AnUFGT1 gene, subjecting the bacterial cells to resuspension until an OD600 value reaches 0.8 to 1.0, and then collecting 10 μL to 20 μL of a resulting bacterial suspension using a sterile insulin syringe; (3) piercing the pedicel at the position of 1 cm to 3 cm below the unfolded spathe to form the first injection point by diagonally piercing 2 mm to 3 mm downward, gently and slowly pushing the syringe by 1 μL to 3 μL to allow the first injection, and applying the vaseline around the obtained needle hole while pulling out the syringe on the first day; conducting the second injection at the position 0.4 cm to 0.6 cm upward from the first injection point on the same pedicel to form the second injection point on the second day; and conducting the third injection at the position 0.4 cm to 0.6 cm upward from the second injection point on the same pedicel to obtain the injected young spathe; (4) placing a resulting injected Anthurium andraeanum 'Xueyu' plant back to the greenhouse to allow normal management with insect control; and (5) cutting an inflorescence promptly from a base 14 d to 15 d later when the injected young spathe is fully unfolded but before flowering, and inserting the inflorescence immediately into clean water and bringing to a laboratory to allow the phenotypic observation and photographic recording using a stereo microscope.
Claim 7 is drawn to the method according to claim 6, wherein the Anthurium andraeanum 'Xueyu' is a white variety lacking anthocyanin with a Plant Variety Rights NO. of CAN20090270.0, has a seedling age of 2 to 3 years, blooms normally under room-temperature cultivation, and is stored in National Gene Bank of Tropical Crops.
Claim 8 is drawn to the method according to claim 7, wherein the primers for cloning the AnUFGT1 gene in step (2) have sequences shown in SEQ ID NO: 1 to SEQ ID NO: 4.
Regarding claim 1, Toves teaches transient transformation of Anthurium andraeanum using a syringe to agro-infiltrate spathes with an Agrobacterium suspension to rapidly test how gene expression alters spathe color (p. 13, p. 76, ¶2, p. 77, ¶2, p. 79, ¶2). Toves teaches the structural gene F3’5’H, and transcription factors Delila and Rosea1 were provided by a colleague and plasmids containing the color genes were assembled and incorporated into Agrobacterium by another colleague (p. 78, ¶3), however does not specify how the plasmids were assembled. Because several of the most commonly used cloning methods, e.g. classical cloning, gateway cloning, and golden gate cloning, all use PCR products amplified using primers that are transferred to a recipient vector (see as evidenced by Barampuram, p. 22, Fig. 2; Micik, abstract, Fig. 1 and 3, p.6 section 1.5, p. 12 section 2.1 ; and Engler abstract, p. 121 section 2.1), Toves is reasonably interpreted to teach producing the plasmids using primers.
Regarding claim 5, Toves teaches introducing an Agrobacterium strain with an anthocyanin biosynthesis related gene into newly and fully unfurled spathes using a syringe to obtain an injected young spathe, and then visually observed for color change after infiltration (p. 77, 79). Because the syringe injection sites (see instant Fig. 2B) appear in the same areas as those in the spathes taught by Toves (Fig. 4.24), it is reasonably interpreted that the quantity of suspension was injected into similar positions as instantly claimed (see 112b).
Regarding claim 6, Toves teaches selecting an Anthurium andraeanum plant, introducing an Agrobacterium strain with an anthocyanin biosynthesis related gene into spathes using a syringe(p. 77-79). Specifically, Toves teaches the Agrobacterium is adjusted to an OD600 of 0.8 (p. 78-79), collecting 100uL of the suspension and injecting it into the spathes using a plastic syringe (p. 79). Because the syringe injection sites (see instant Fig. 2B) appear in the same areas as those in the spathes taught by Toves (Fig. 4.24), it is reasonably interpreted that the quantity of suspension was injected into similar positions as instantly claimed (see 112b). Toves further teaches detached spathes or plants with intact spathes were placed under fluorescent lighting at room temperature unless they were used for LED experiments (p. 79). Toves also teaches phenotypic observation and photographic recording using a stereo microscope of the spathes (p. 77-78).
However, Toves does not explicitly teach:
the method/ kit comprises Anthurium andraeanum 'Xueyu' (claims 1, 5, 6)
wherein the Anthurium andraeanum 'Xueyu' is a white variety lacking anthocyanin with a Plant Variety Rights NO. of CAN20090270.0, has a seedling age of 2 to 3 years, blooms normally under room-temperature cultivation, and is stored in National Gene Bank of Tropical Crops (claims 2 and 7)
wherein the primers have sequences shown in SEQ ID NO: 1 to SEQ ID NO: 4 (claims 3 and 8)
The bacterial cells have an expression vector of the AnUFGT1 gene (claims 5 and 6)
The plants were then put into the greenhouse; and cutting an inflorescence promptly from a base 14 d to 15 d later when the injected young spathe is fully unfolded but before flowering (claim 6)
Regarding the remaining limitation of claim 1, in analogous art, Li teaches about Anthurium “Alabama” and its anthocyanin loss mutant (title) (i.e the anthocyanin loss mutant is Anthurium andraeanum ‘Xueyu’). Specifically, Li teaches the anthocyanin-loss mutations is likely cause by expression changes( i.e. low expression) of AN2 and UFGT genes as compared to WT expression in ‘Alabama’ (abstract, conclusion). In other analogous art, Thorneycroft teaches a means of confirming the link between genotype and phenotype is to complement the mutant by transformation with a wild‐type cDNA or gene (transgenic complementation) (p. 1596, section titled Establishing the link between genotype and phenotype).
Regarding claims 2 and 7, Li teaches the anthocyanin-loss mutant plants (New Plant Variety right: ZL201310140892.0, The Office for the Protection of New Varieties of Plant, MOA, P.R. China) were collected from a greenhouse located in the experimental area at the Institute of Tropical Crop Genetic Resources, Chinese Academy of Tropical Agricultural Sciences (CATAS) (p. 15, Materials and Methods). The size and appearance of the plants used for experiments appear to be within the 2-3 year age range and flowering normally (Fig. 1). Additionally, Toves teaches agro-infiltrating spathes (i.e. the plant was flowering/ blooming). Because flowering takes 1-3 years from seed, the plant of which Toves uses for agro-infiltration is reasonably interpreted to have a seedling age approximately 2-3 years and is blooming normally.
Regarding claims 3 and 8, Li teaches using primers to amplify genes including UFGT (c30000038819_g1_i1) in WT and mutant Anthurium plants (p. 9 and Table 4). Li teaches the primers are ‘tccctcagagaccacaggaa’ and ‘agacttccgcgccaagtt’, which have the sequences of “tct” shown in SEQ ID NO: 1 (catcgcctgctccgcc), “ctc” shown in SEQ ID NO: 2 (caaactcggacaaactacgcc) and 3 (caaactcggacaaactacgcc), and “act” shown in SEQ ID NO: 4 (gctctagacaactcggacaaactacgcc). Because the claim is worded as “wherein the primers have sequences shown in SEQ ID NO: 1 to SEQ ID NO: 4”, the claims encompass any sequences (including as few as dinucleotides) shown in SEQ ID NOs: 1-4.
It would therefore be obvious to combine the teaching of Toves, Li, and Thorneycroft to arrive at the instantly claimed kit and method of using the kit with a reasonably expectation of because Toves teaches all of the kit components/compositions and many of the method steps except teaches an Anthurium andraeanum cultivar other than Anthurium andraeanum ‘Xueyu’, and inclusion of the known ‘Xueyu’ cultivar to transiently express genes could be achieved without encountering any special technical difficulties. One of ordinary skill in the art would have bene motivated to combine the teachings because Li teaches UFGT is one of few likely genes causing the anthocyanin loss- mutation (abstract, conclusion), Thorneycroft teaches genetic complementation is a known method to confirm the link between genotype and phenotype of mutant and wild-type plants, and Toves teaches a method of transient transformation in spathes to rapidly test gene expression and its affect on color change in spathes (p. 3-4, p. 13, p. 74, p. 84-86). Therefore, it would be prima facie obvious to use the rapid transient transformation method of Toves to express the WT UFGT gene (via genetic complementation) in the spathe of the mutant plant to test and determine if UFGT is in fact responsible for the anthocyanin-loss mutation. By doing so, the ordinary artisan would arrive at the instantly claimed kit and method of using the kit. Furthermore, the quantity of suspension collected in the syringe in the instant claims (10 to 20 uL) is obvious in view of the quantity collected in the syringe by Toves (100uL) because it would be prima facie obvious to collect any amount if the syringe for the same purpose that is agro-infiltrating the spathe. Similarly, it would be prima facie obvious to put the spathes in any condition that allows for proper growth, e.g. a room with fluorescent light as taught by Toves or a greenhouse as instantly claimed for the same purpose of growing the plant. Similarly, it would be prima facie obvious to cut the spathes in at any point that allows observation of the transient gene expression, e.g. soon after injection or not at all as taught by Toves, or 14 d to 15 d later when the injected young spathe is fully unfolded but before flowering as instantly claimed for the same purpose of observing transgene expression.
Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Toves and Li as applied to claims 1-3 above, and further in view of Jan (Jan, S. A., Shinwari, Z. K., Shah, S. H., Shahzad, A., Zia, M. A., & Ahmad, N. (2016). In-planta transformation: recent advances. Romanian Biotechnological Letters, 21(1), 11085-11091.) and Zhao (Zhao, H., Tan, Z., Wen, X., & Wang, Y. (2017). An improved syringe agroinfiltration protocol to enhance transformation efficiency by combinative use of 5-azacytidine, ascorbate acid and tween-20. Plants, 6(1), 9.).
Claim 4 is drawn to the kit according to claim 3, wherein the suspension solution is a solution of 4% to 6% of a sucrose + 0.01% to 0.03% of a silicon surfactant containing polycyclic ether-modified polydimethylsiloxane and polyoxyethylene polyoxypropylene copolymer as active ingredients.
Regarding claim 4, Toves and Li teach the limitations of claims 1-3 as set forth in the previous obviousness rejection. The teachings of Toves and Li as they are applied to claims 1-3 are set forth previously herein and are incorporated by reference.
However, Toves and Li do not explicitly teach wherein the suspension solution is a solution of 4% to 6% of a sucrose + 0.01% to 0.03% of a silicon surfactant containing polycyclic ether-modified polydimethylsiloxane and polyoxyethylene polyoxypropylene copolymer as active ingredients.
In analogous art, Jan teaches about recent advancements in in planta transformation (title), and teaches increasing transformation efficiency of a similar transient agroinfiltration method using a bacterial suspension that comprises 5% sucrose and 0.01% to 0.05% Silwet-L77 (p. 11087, section titled 3. In-Planta Transformation in Arabidopsis Plant, and p. 11089, section titled 5. In-Planta Transformation in Oilseeds Crops). In other analogous art, Zhao further reiterates that Neutral surfactants, such as Tween-20, Triton X-100 and Silwet L-77, play important roles in reducing surface tension and enhancing the entry of bacteria into plant tissues, and are usually used in genetic transformation, including infiltration methods (p. 2, ¶3). Because the only surfactant used or mentioned in the instant disclosure is Silwet-L77 (¶0021-0022, 0038), the silicon surfactant containing polycyclic ether-modified polydimethylsiloxane and polyoxyethylene polyoxypropylene copolymer as active ingredients as claimed is interpreted to be encompassed by the surfactant of Silwet-L77.
It would therefore be prima facie obvious to combine the teachings of Toves and Li with Jan and Zhao to arrive at the instant claimed methods with a reasonable expectation of success because one of ordinary skill could incorporate/ adjust the sucrose levels and inclusion of Silwet-L77 as taught by Jan and Zhao into the bacterial suspension of Toves without encountering any special technical difficulties. One of ordinary skill in the art would have been motivated to do so because Jan teaches another method of agroinfiltration had increased trnasformaiton rates using the specifiied sucrose and surfactant levels in the bacterial suspension, and one of ordinary skill in the art would be motivated to use this bacterial suspension composition in another agroinfiltration method for the same purpose. Additionally, Zhao teaches the surfactant reduces surface tension and enhancing the entry of bacteria into plant tissues.
Claims 9 is rejected under 35 U.S.C. 103 as being unpatentable over Toves and Li as applied to claims 1 and 5-8 above, and further in view of Komari (Komari, T., Takakura, Y., Ueki, J., Kato, N., Ishida, Y., & Hiei, Y. (2006). Binary vectors and super-binary vectors. Agrobacterium protocols, 15-42.).
Claim 9 is drawn to the method according to claim 8, wherein the expression vector in step (2) is constructed with a vector PBI121, restriction endonucleases KpnI and XbaI, an Escherichia coli strain DH5α, and an Agrobacterium strain EHA105.
Regarding claim 9, Toves and Li teach the limitations of claims 1 and 5-8 as set forth in the previous obviousness rejection. The teachings of Toves and Li as they are applied to claims 1 and 5-8 are set forth previously herein and are incorporated by reference. Toves further teaches in an alternative embodiment putting the cloning vector into E. Coli DH5α before transferring into an Agrobacterium strain for plant transformation (p. 145).
However, Toves and Li do not explicitly teach wherein the expression vector in step (2) is constructed with a vector PBI121, restriction endonucleases KpnI and XbaI, , and an Agrobacterium strain EHA105.
In analogous art, Komari teaches the pBI121 vector is used for plant transformation and comprises the XbaI restriction site (abstract, Fig. 2). Additionally, the instant disclosure provides evidence the pBI121 vector and/or PCR product for insertion into the vector also comprises a KpnI restriction site (¶0036). Komari also teach Agrobacterium strain EHA105 is one of several known agrobacterium strains used for plant transformation (p. 31).
It would therefore be obvious to combine the teachings to arrive at the instant method with a reasonable expectation of success because all of the cloning plasmids, restriction enzymes, and methods of transforming into E. coli and Agrobacteirum EHA 105 are known in the art to be used to produce plasmids for plant transformation, and incorporation of these compositions and methods could be achieved by the ordinary artisan without encountering any special technical difficulties. One of ordinary skill in the art would have been motivated to combine the teachings and used the known, alternative compositions and methods for the same purpose that is producing plasmids for transient transformation in plants. Furthermore, the selection of plasmid, bacteria strain, and restriction site/ enzymes are a matter of design choice and it would be obvious to select any of the species within the genus categories for the same purpose of designing a plasmid and bacteria harboring it for plant transformation.
Claims 10-11 are rejected under 35 U.S.C. 103 as being unpatentable over Toves, Li, and Komari as applied to claims 1 and 5-9 above, and further in view of Jan (Jan, S. A., Shinwari, Z. K., Shah, S. H., Shahzad, A., Zia, M. A., & Ahmad, N. (2016). In-planta transformation: recent advances. Romanian Biotechnological Letters, 21(1), 11085-11091.) and Zhao (Zhao, H., Tan, Z., Wen, X., & Wang, Y. (2017). An improved syringe agroinfiltration protocol to enhance transformation efficiency by combinative use of 5-azacytidine, ascorbate acid and tween-20. Plants, 6(1), 9.).
Claim 10 is drawn to the method according to claim 8, wherein the resuspension in step (2) is conducted using a solution of 4% to 6% of a sucrose + 0.01% to 0.03% of a silicon surfactant containing polycyclic ether-modified polydimethylsiloxane and polyoxyethylene polyoxypropylene copolymer as active ingredients.
Claim 11 is drawn to the method according to claim 10, wherein step (3) specifically comprises: piercing the pedicel at the position of 2 cm below the unfolded spathe to form the first injection point by diagonally piercing 2 mm to 3 mm downward, gently and slowly pushing the syringe by 2 μL to allow the first injection, and applying the vaseline around the obtained needle hole while pulling out the syringe on the first day; conducting the second injection at the position 0.5 cm upward from the first injection point on the same pedicel to form the second injection point on the second day; and conducting the third injection at the position 0.5 cm upward from the second injection point on the same pedicel to obtain the injected young spathe.
Regarding claim 10, Toves, Li, and Komari teach the limitations of claims 1 and 5-9 as set forth in the previous obviousness rejection. The teachings of Toves, Li, and Komari as they are applied to claims 1 and 5-9 are set forth previously herein and are incorporated by reference.
Regarding claim 11, as stated in the previous rejection, Toves teaches selecting an Anthurium andraeanum plant, introducing an Agrobacterium strain with an anthocyanin biosynthesis related gene into spathes using a syringe(p. 77-79). Because the syringe injection sites (see instant Fig. 2B) appear in the same areas as those in the spathes taught by Toves (Fig. 4.24), it is reasonably interpreted that the quantity of suspension was injected into similar positions as instantly claimed (see 112b). Toves further teaches detached spathes or plants with intact spathes were placed under fluorescent lighting at room temperature unless they were used for LED experiments (p. 79). Toves also teaches phenotypic observation and photographic recording using a stereo microscope of the spathes (p. 77-78).
However, Toves, Li, and Komari do not explicitly teach wherein the suspension solution is a solution of 4% to 6% of a sucrose + 0.01% to 0.03% of a silicon surfactant containing polycyclic ether-modified polydimethylsiloxane and polyoxyethylene polyoxypropylene copolymer as active ingredients (claim 10).
In analogous art, Jan teaches about recent advancements of in planta transformation (title), and teaches increasing transformation efficiency of a similar transient agroinfiltration method using a bacterial suspension that comprises 5% sucrose and 0.01% to 0.05% Silwet-L77 (p. 11087, section titled 3. In-Planta Transformation in Arabidopsis Plant, and p. 11089, section titled 5. In-Planta Transformation in Oilseeds Crops). In other analogous art, Zhao further reiterates that Neutral surfactants, such as Tween-20, Triton X-100 and Silwet L-77, play important roles in reducing surface tension and enhancing the entry of bacteria into plant tissues, and are usually used in genetic transformation, including infiltration methods (p. 2, ¶3). Because the only surfactant used or mentioned in the instant disclosure is Silwet-L77 (¶0021-0022, 0038), the silicon surfactant containing polycyclic ether-modified polydimethylsiloxane and polyoxyethylene polyoxypropylene copolymer as active ingredients as claimed is interpreted to be encompassed by the surfactant of Silwet-L77.
It would therefore be prima facie obvious to combine the teachings of Toves, Li, and Komari with Jan and Zhao to arrive at the instant claimed methods with a reasonable expectation of success because one of ordinary skill could incorporate/ adjust the sucrose levels and inclusion of Silwet-L77 as taught by Jan and Zhao into the bacterial suspension of Toves without encountering any special technical difficulties. One of ordinary skill in the art would have been motivated to do so because Jan teaches another method of agroinfiltration had increased trnasformaiton rates using the specifiied sucrose and surfactant levels in the bacterial suspension, and one of ordinary skill in the art would be motivated to use this bacterial suspension composition in another agroinfiltration method for the same purpose. Additionally, Zhao teaches the surfactant reduces surface tension and enhancing the entry of bacteria into plant tissues.
Conclusion and Inquiries
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA N STOCKDALE whose telephone number is (703)756-5395. The examiner can normally be reached M-F 8:30-5:00 CT.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
JESSICA N. STOCKDALE
Examiner
Art Unit 1663
/JESSICA NICOLE STOCKDALE/ Examiner, Art Unit 1663
/CHARLES LOGSDON/ Primary Examiner, Art Unit 1662
Prosecution Insights