SESAME HIGH OLEIC ACID CONTENT GENE SIFAD2-1 AND SNP MARKER THEREOF

§101 §102 §103 §112

DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Applicant’s claim for the benefit of a prior-filed application no. CN202211721838.0 filed December 30th, 2022, and PCT/CN2024/075023 filed January 31st, 2024, under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Should applicant desire to obtain the benefit of foreign priority under 35 U.S.C. 119(a)-(d) prior to declaration of an interference, a certified English translation of the foreign application must be submitted in reply to this action. 37 CFR 41.154(b) and 41.202(e). Failure to provide a certified translation may result in no benefit being accorded for the non-English application. Information Disclosure Statement The information disclosure statement (IDS) submitted on December 16th, 2024, was considered, initialed, and attached hereto. A signed copy of the list of references cited is included with this Office Action. Status of Claims Claims 1-7 filed September 4th, 2026, are pending. Claims 1-3 and 6-7 are withdrawn. Claims 4 and 5 are examined herein. Specification The use of the terms “Phanta”, “EvaGreen”, and “Roche 480 PCR thermal cycler” (LightCycler 480), which are trade names or marks used in commerce, have been noted in this application [¶64]. The terms should be accompanied by the generic terminology; furthermore the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the terms. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Objections In claim(s) 4 and 5, “SiFAD2” is used as abbreviation. It is suggested to insert a definition for SiFAD2 without bringing in new matter, immediately before the first appearance of “SiFAD2” in claim 4; and to enclose the appearance of “SiFAD2” in parentheses (in claim 4 only). Claim 4 recites the terms “positive Primer HO1 Primer F” and “reverse primer HO1 Primer R”. The recitation of “positive Primer” is objected to as an uncommon term in the art. This appears to be referring to a forward primer. Additionally, “Primer” should be all lowercase throughout the claim. Claim 5 is objected to for being dependent on an objected claim. Appropriate correction is required. Claim Interpretation Claims 4 and 5 recite a primer pair and a PCR amplification method, respectively, for obtaining the sesame high oleic acid gene SiFAD2-1 according to claim 1 or its allele Sifad2-1 according to claim 2. The allele of claim 2, Sifad2-1, is defined as the wild-type allele in the instant specification [¶8] with a plant phenotype of this allele being a normal phenotype (or a phenotype with a normal oleic acid content; i.e., the 2584th base in the normal phenotype is C) [¶9]. These claims are broadly interpreted as a primer pair and amplification method for obtaining the wild-type allele that does not confer the phenotype of high oleic acid or the sesame high oleic acid gene. Claims 4 and 5 recite the term “high” oleic acid content. As defined in the instant specification, “high” oleic acid content is an oleic acid content above 70% [¶33]. Examiner notes that claims 4 and 5 are not rejected under 35 USC § 101 as a product of nature or natural phenomenon as the nucleotide sequence of the Sifad2-1 allele is characterized as being from Yuzhi 11, a cultivated sesame plant, in the instant specification. Claim 5 recites “extracting genomic DNA from a high oleic acid germplasm HO995 or a sesame sample with normal oleic acid content Yuzhi 11”. It is understood that the high oleic acid content germplasm is HO995 and the normal oleic acid content germplasm is Yuzhi 11. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 5 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The term “normal” (oleic acid content) in claim 5 is a relative term which renders the claim indefinite. The term “normal” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The instant specification recites that samples with oleic acid content below 45% were classified as the normal wild-type [¶33], but contradicts this definition by stating that the normal oleic acid content of the hybrid combinations is <40% [Table 1]. One of skill in the art would not know the standard for “normal” with regard to the oleic acid given the lack of a stable definition in the instant specification. Claim Rejections - 35 USC § 102/103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim 4 is rejected as being unpatentable under pre-AIA 35 U.S.C. § 103(a), over Chen, Z. et al. (2014). “Variation in Seed Fatty Acid Composition and Sequence Divergence in the FAD2 Gene Coding Region between Wild and Cultivated Sesame.” J. Agric. Food Chem. 62(48):11706-11710. Claim 4 recites a primer pair for obtaining the sesame allele Sifad2-1 according to claim 2 by PCR amplification, characterized in that the primer is designed as follows: a positive Primer HO1 Primer F (SEQ ID NO. 6): 5'-TATGAGACCTCGTAAGGCAG- 3'; a reverse primer HO1 Primer R (SEQ ID NO. 7): 5'-GTAGGATGGAAGAAAATCTC- 3'. Regarding claim 4, Chen teaches variation in seed fatty acid composition in sesame accessions and teaches sequencing of the FAD2 coding region for fatty acid desaturase (FAD) within the accessions [Abstract]. Chen teaches that the objectives of the study were to (1) confirm fatty acid composition and O/L ratio using newly harvested seeds, (2) identify nucleotide diversity in the FAD2 gene coding region, and (3) identify nucleotide polymorphisms possibly contributing to alter the fatty acid profile and O/L ratio [pg. 11707, col. 1, ¶2]. Genomic DNA was extracted from fresh leaf tissue of cultivated S. indicum and wild S. radiatum [pg. 11707, col. 2, ¶2; Table 1]. For primer design for amplification of FAD2 coding region in the cultivated and wild species, the sequence of the FAD2 gene region was downloaded from GenBank (AY770501) [Table 2]. Due to nucleotide divergence between cultivated and wild sesame, some specific primers were designed only for wild species (including some degenerate primers) (Table 2). In total, 33 sets of primers were designed and synthesized. Different PCR conditions were used based on the amplicon size and annealing temperature for DNA fragment amplification. After trimming and editing each DNA sequence, gene coding sequences were aligned with a sesame reference sequence (AY770501) using Sequencher (ver. 4.10.1) [pg. 11701, col. 2, ¶4-5]. Following sequence alignment, nucleotide polymorphisms were identified among accessions. From the deduced amino acid sequence, substitutions were identified in the polypeptides. GenBank: AY7700501.1 discloses the Sesamum indicum microsomal oleic acid desaturase gene, 3762 bp in length, CDS 2407-35581. GenBank: AY7700501.1 shares 99% identity with SEQ ID NO: 2. Alignment statistics for match #1 Score Expect Identities Gaps Strand 5771 bits(3125) 0.0 3140/3146(99%) 5/3146(0%) Plus/Plus Query 1 CAGACAGGTCTATATTTATGAGACCTCGTAAGGCAGAACGCAACGCCACTCAAATATTTc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 620 CAGACAGGTCTATATTTATGAGACCTCGTAAGGCAGAACGCAACGCCACTCAAATATTTC 679 Query 61 accaccaccaccaccaGAACATTCAGAAACAAGAAATAAacacacacacacTAATAAAAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct 680 ACCACCACCACCACCAGAACATTCAGAAACAAGAAATAAACACACACACACT-ATAAAAC 738 Query 121 AGTTCTTGCGAAAGAAGGAAAGCGCTTCCGCAGAAGTGCTTTCACGCGAtttcttcttcc 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct 739 AGTTCTTGCGAAAGAAGGAAAGCGCTTCCGCAGAAGTGCTTTCACGCGATTTCTCCTTCC 798 Query 181 aagttttcaggtaacgtgcccccttttctcttctcttctattctcttttctcATAATTCA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 799 AAGTTTTCAGGTAACGTGCCCCCTTTTCTCTTCTCTTCTATTCTCTTTTCTCATAATTCA 858 Query 241 TGATCAATCTTTGAGTATTTTGGTGTTTGTGTGTCTCAAGAAAACCGCATTTTTATTTTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 859 TGATCAATCTTTGAGTATTTTGGTGTTTGTGTGTCTCAAGAAAACCGCATTTTTATTTTC 918 Query 301 TTGCAATGGTGTCTTTATTTCCTGTCGtttttttCAGCTATTAATGTTCTTTTGATGTAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 919 TTGCAATGGTGTCTTTATTTCCTGTCGTTTTTTTCAGCTATTAATGTTCTTTTGATGTAG 978 Query 361 ATGAGGTTTAATCGTATGTTCTTGAGCTGCATTACCTGATGATTCATGGATCTGAGGAAT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 979 ATGAGGTTTAATCGTATGTTCTTGAGCTGCATTACCTGATGATTCATGGATCTGAGGAAT 1038 Query 421 GTATGCGAttttttatttttgttttattttttGGTGGGCTTTCCCAAGAAGAATCTATTT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1039 GTATGCGATTTTTTATTTTTGTTTTATTTTTTGGTGGGCTTTCCCAAGAAGAATCTATTT 1098 Query 481 GGGGTTATTCTTGTGTGGTTTGGTGCAAATCTTTGGATTTTACGCAGTATTGGTGTCTGG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1099 GGGGTTATTCTTGTGTGGTTTGGTGCAAATCTTTGGATTTTACGCAGTATTGGTGTCTGG 1158 Query 541 ACCACATGATTGTGTCATTTATATTTGGATTTTGTCTTTATCTTTGTATGCATGTGGGAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1159 ACCACATGATTGTGTCATTTATATTTGGATTTTGTCTTTATCTTTGTATGCATGTGGGAT 1218 Query 601 GCAGGAAGAAAAAACTGTGGTAAATGTCTTTGAAGAGATTGATTTAGCATATATACAAGG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1219 GCAGGAAGAAAAAACTGTGGTAAATGTCTTTGAAGAGATTGATTTAGCATATATACAAGG 1278 Query 661 TTGCCTGGGCTTCAGTTTTGATGATTTTGATGTACATTGTGGAGATTTGATGGGTTGCAT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1279 TTGCCTGGGCTTCAGTTTTGATGATTTTGATGTACATTGTGGAGATTTGATGGGTTGCAT 1338 Query 721 GTGGCTCAAATCTTCTTGTAAGATTTGTTTTTTGTCCAAAAAATTTGGGATTTTTCCACT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1339 GTGGCTCAAATCTTCTTGTAAGATTTGTTTTTTGTCCAAAAAATTTGGGATTTTTCCACT 1398 Query 781 TTTATTGAACAGTAGATCTTTTCCTGTTTCAACCACAAAAGTTATTTCGGTTTGAAGTTT 840 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct 1399 TTTATTGAACAGTAGATCTTTTCCTGTTTCAACC-CAAAAGTTATTTCGGTTTGAAGTTT 1457 Query 841 TACATCAT-GATATAATT-GTAATAAATTTCGGTTAGGTCCGTAAAGAATCATTAATTAC 898 |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct 1458 TACATCATAGATATAATTAGTAATAAATTTCGGTTAGGTCCGTAAAGAATCATTAATTAC 1517 Query 899 ATCAATTAATATTGTTTAATGTACAAAAAGAGGGAATTTATGGTGATATCTATGAAGCCA 958 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1518 ATCAATTAATATTGTTTAATGTACAAAAAGAGGGAATTTATGGTGATATCTATGAAGCCA 1577 Query 959 TGCTATGCCTGGCTGGAATTCCGTCGATGAAAAAGACAGATTCCGGTGTGTGGTAGATTT 1018 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1578 TGCTATGCCTGGCTGGAATTCCGTCGATGAAAAAGACAGATTCCGGTGTGTGGTAGATTT 1637 Query 1019 CACTGTTAGTGAATACCCCACTTCAAAGAACGGTGCTGATTCAACTGCTCTAGTCCTCAG 1078 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1638 CACTGTTAGTGAATACCCCACTTCAAAGAACGGTGCTGATTCAACTGCTCTAGTCCTCAG 1697 Query 1079 GATTTTAGTACTACTTGTTTGCTGTTTGGAACACATGGCTGAAAATAAATGTCTGCTTTT 1138 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1698 GATTTTAGTACTACTTGTTTGCTGTTTGGAACACATGGCTGAAAATAAATGTCTGCTTTT 1757 Query 1139 CGACCTTGGCGCTTAGAGAATTTACTACCACATCTCATTTTTAGCATCCCAACGATGATT 1198 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1758 CGACCTTGGCGCTTAGAGAATTTACTACCACATCTCATTTTTAGCATCCCAACGATGATT 1817 Query 1199 TCTGCTGTCAGAATGAATGAATTGACTAAGAAGCAACTCGGTTatttgagattgaattgg 1258 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct 1818 TCTGCTGTCAGAATGAATGAATTGACTAAG-AGCAACTCGGTTATTTGAGATTGAATTGG 1876 Query 1259 ttgtttgtgattgttgttgatttgtttttgtcgttatgatcttttgaGGTATTCGCCATA 1318 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1877 TTGTTTGTGATTGTTGTTGATTTGTTTTTGTCGTTATGATCTTTTGAGGTATTCGCCATA 1936 Query 1319 CAATGCTGATACTAGTCGTTGTGATTTTCCGGTATATGTATTTGTGACGTATCGTTCTGT 1378 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1937 CAATGCTGATACTAGTCGTTGTGATTTTCCGGTATATGTATTTGTGACGTATCGTTCTGT 1996 Query 1379 AGTTTGGTAACTAATAGAATGCATGTGGTGGTAACTAATAGAATGCATGTTGTAGTAACA 1438 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1997 AGTTTGGTAACTAATAGAATGCATGTGGTGGTAACTAATAGAATGCATGTTGTAGTAACA 2056 Query 1439 AATGCACATTGTAGATTCTCGTGGATTTTTCGGGTGTTCGTTACCAGCACATTGCCGATT 1498 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2057 AATGCACATTGTAGATTCTCGTGGATTTTTCGGGTGTTCGTTACCAGCACATTGCCGATT 2116 Query 1499 CTGGTATGATTTTTGTCGTGTTCATTGTTTAGTTGCCTTTCTTGGCTGCCACTATTTCAT 1558 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2117 CTGGTATGATTTTTGTCGTGTTCATTGTTTAGTTGCCTTTCTTGGCTGCCACTATTTCAT 2176 Query 1559 TGAGAATGTAGGACGTTGTTCGATGCAAAAGAACTTTTGCCGACTAGAATGCAGGTGGCA 1618 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2177 TGAGAATGTAGGACGTTGTTCGATGCAAAAGAACTTTTGCCGACTAGAATGCAGGTGGCA 2236 Query 1619 ATCTGGAATCTCCTATTATGGGAGGAACTACTGTAATTGGGAGGTTTTGATTCAGACAAT 1678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2237 ATCTGGAATCTCCTATTATGGGAGGAACTACTGTAATTGGGAGGTTTTGATTCAGACAAT 2296 Query 1679 CTAGTAACAGTCTAGAAGCTACTTTGCCTTTAAATCTCAATGACCTTAAACGCCATGATG 1738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2297 CTAGTAACAGTCTAGAAGCTACTTTGCCTTTAAATCTCAATGACCTTAAACGCCATGATG 2356 Query 1739 GAGACATTTGAATCCATGTTTTGCAGGTAAATTGGGGGCGGCTTGACAAAATGGGAGCCG 1798 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2357 GAGACATTTGAATCCATGTTTTGCAGGTAAATTGGGGGCGGCTTGACAAAATGGGAGCCG 2416 Query 1799 GAGGACGCATGTCTGATCCAACAACGAAAGACGAACAAAAGAAGAACCCCCTCCAACGGG 1858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2417 GAGGACGCATGTCTGATCCAACAACGAAAGACGAACAAAAGAAGAACCCCCTCCAACGGG 2476 Query 1859 TGCCTTACGCAAAGCCTCCATTCACACTCGGTGACATCAAGAAGGCCATTCCACCACACT 1918 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2477 TGCCTTACGCAAAGCCTCCATTCACACTCGGTGACATCAAGAAGGCCATTCCACCACACT 2536 Query 1919 GCTTCGAGAGATCCGTCAGCCGTTCGTTCTCCTATGTCGTTTACGATCTCGTCATTGTTT 1978 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2537 GCTTCGAGAGATCCGTCAGCCGTTCGTTCTCCTATGTCGTTTACGATCTCGTCATTGTTT 2596 Query 1979 TCCTTCTCTACTACATTGCGACTTCTTACTTCCATCTGCTGCCATCCCCATACTGCTACC 2038 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2597 TCCTTCTCTACTACATTGCGACTTCTTACTTCCATCTGCTGCCATCCCCATACTGCTACC 2656 Query 2039 TAGCTTGGCCCATTTACTGGGCTGTACAAGGCTGCGTTTGCACCGGAATCTGGGTCATTG 2098 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2657 TAGCTTGGCCCATTTACTGGGCTGTACAAGGCTGCGTTTGCACCGGAATCTGGGTCATTG 2716 Query 2099 CCCATGAATGTGGCCACCATGCATTCAGCGATTACCAGTGGCTTGACGACACAGTTGGCC 2158 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2717 CCCATGAATGTGGCCACCATGCATTCAGCGATTACCAGTGGCTTGACGACACAGTTGGCC 2776 Query 2159 TCATCCTGCACTCTGCCCTGCTCGTGCCCTATTTCTCATGGAAATACAGCCACCGCCGCC 2218 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2777 TCATCCTGCACTCTGCCCTGCTCGTGCCCTATTTCTCATGGAAATACAGCCACCGCCGCC 2836 Query 2219 ACCACTCCAACACTGGATCCCTTGAGCGTGACGAAGTCTTCGTCCCAAAGCCAAAATCCA 2278 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2837 ACCACTCCAACACTGGATCCCTTGAGCGTGACGAAGTCTTCGTCCCAAAGCCAAAATCCA 2896 Query 2279 GAGTCTCGTGGTACTCCAAATACTTGAACAATCCACTTGGCAGAGTCATCACACTTGTGG 2338 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2897 GAGTCTCGTGGTACTCCAAATACTTGAACAATCCACTTGGCAGAGTCATCACACTTGTGG 2956 Query 2339 TTACTCTTACTCTCGGTTGGCCTCTATACTTGCTGTTTAATGTCTCTGGCAGGCCTTACA 2398 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2957 TTACTCTTACTCTCGGTTGGCCTCTATACTTGCTGTTTAATGTCTCTGGCAGGCCTTACA 3016 Query 2399 ACCGTTTTGCATGCCACTTTGACCCATATGGTCCAATATATAATGACCGTGAGAGACTTC 2458 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3017 ACCGTTTTGCATGCCACTTTGACCCATATGGTCCAATATATAATGACCGTGAGAGACTTC 3076 Query 2459 AAATCTTCATCTCCGATGCTGGTATAATTGCTGCTGTATGTGTGCTTTATCGTGTTGCTT 2518 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3077 AAATCTTCATCTCCGATGCTGGTATAATTGCTGCTGTATGTGTGCTTTATCGTGTTGCTT 3136 Query 2519 TGGTCAAAGGGTTGGCTTGGCTGGTATGTGTTTATGGGGTACCGTTACTCATTGTCAACG 2578 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3137 TGGTCAAAGGGTTGGCTTGGCTGGTATGTGTTTATGGGGTACCGTTACTCATTGTCAACG 3196 Query 2579 GTTTCCTTGTTTTGATCACATTCCTTCAGCACACTCACCCTTCGTTGCCGCACTATGATT 2638 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3197 GTTTCCTTGTTTTGATCACATTCCTTCAGCACACTCACCCTTCGTTGCCGCACTATGATT 3256 Query 2639 CTTCCGAGTGGGACTGGCTAAGGGGAGCTCTTGCAACTGTCGACAGAGATTATGGGGTGC 2698 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3257 CTTCCGAGTGGGACTGGCTAAGGGGAGCTCTTGCAACTGTCGACAGAGATTATGGGGTGC 3316 Query 2699 TAAATAAGGTGTTCCATAACATCACAGATACGCACGTGACTCACCACCTTTTCTCAACGA 2758 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3317 TAAATAAGGTGTTCCATAACATCACAGATACGCACGTGACTCACCACCTTTTCTCAACGA 3376 Query 2759 TGCCACATTACCATGCAATGGAGGCAACTAAGGCAATCAAGCCCATACTGGGCCAGTATT 2818 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3377 TGCCACATTACCATGCAATGGAGGCAACTAAGGCAATCAAGCCCATACTGGGCCAGTATT 3436 Query 2819 ATCAGTTTGATGGAACCCCGTTTTACAAGGCGATGTGGAGGGAGGCAAAGGAATGTCTGT 2878 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3437 ATCAGTTTGATGGAACCCCGTTTTACAAGGCGATGTGGAGGGAGGCAAAGGAATGTCTGT 3496 Query 2879 ATGTCGAGCCAGACGAGAGTACTCCAGACAAGGGTGTATTCTGGTACAAGAACAAGTTCT 2938 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3497 ATGTCGAGCCAGACGAGAGTACTCCAGACAAGGGTGTATTCTGGTACAAGAACAAGTTCT 3556 Query 2939 GAAGCCGAATAACATGTGGTTAGTGAAAATGGCGTCTTCTTATTTTGTCCTATGGAGATG 2998 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3557 GAAGCCGAATAACATGTGGTTAGTGAAAATGGCGTCTTCTTATTTTGTCCTATGGAGATG 3616 Query 2999 GAGGAACATCATCATGTTTTCTTTTTCTTCTTATAAGATGCGTCCTTTGTTAGTGTATTC 3058 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3617 GAGGAACATCATCATGTTTTCTTTTTCTTCTTATAAGATGCGTCCTTTGTTAGTGTATTC 3676 Query 3059 TCTGCATGTAATAAAATAAACTTCTACCCGAAACCTTGTCTGTGCTGGTCGGATTCTAGT 3118 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3677 TCTGCATGTAATAAAATAAACTTCTACCCGAAACCTTGTCTGTGCTGGTCGGATTCTAGT 3736 Query 3119 TCTGCAATAAATTGTCAAGTTTAGTG 3144 |||||||||||||||||||||||||| Sbjct 3737 TCTGCAATAAATTGTCAAGTTTAGTG 3762 Given that the Sifad2-1 allele is the allele corresponding to the normal oleic acid content, given that GenBank: AY770501.1 was present in the art at the time of filing and identified as Sesame indicum FAD2, and given that Chen teaches primer design using GenBank: AY770501.1 in multiple cultivars having a variety of oleic acid content, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to use the primers designed by Chen or design alternative primers (which is also suggested by Chen) to amplify and sequence DNA fragments in the FAD2 coding region. One would obtain the allele Sifad2-1 by PCR amplification as taught by Chen, given the high sequence identity to the sequence of the FAD2 gene region was downloaded from GenBank (AY770501). The deficiency of Chen is that the art does not explicitly teach the primer sequences of the instant claims, and the design of primers taught by Chen would perhaps not result in identical primer sequences. However, it would have been prima facie obvious and within the scope of an ordinary skill in the art at the time the invention was made to use the compositions and methods taught by Chen to create a primer set for obtaining the Sifad2-1 allele characterized by the nucleotide sequence of SEQ ID NO:2 from a finite number of available potential primer sequences. This would result in the Applicants’ invention with a reasonable expectation of success, and without any surprising results. Obviously, one of ordinary skill in the art would have been motivated to do so for the purpose of obtaining plants with nucleotide polymorphisms contributing to altered fatty acid profiles and oleic to linoleic acid ratios for breeding and enhanced nutritional value under growing yield demands (as taught by Chen [pg. 11706, col. 1, ¶1; pg. 11707, col. 1, ¶2). The selection of a segment of the gene would not change the inventive concept as primer design is routine in the art. The forward primer (SEQ ID NO: 6) aligns 100% to a portion of GenBank: AY770501 (See alignment below), but the reverse primer does not. This is likely because GenBank: AY770501 is a complete cds sequence, as opposed to SEQ ID NO: 2, which is the nucleotide sequence of the gene. Primers targeted to the coding region, as taught by Chen, would vary in sequence from those targeting a gene nucleotide sequence, which would include exons, introns, and flanking regulatory regions, which explains why GenBank: AY770501 does not align with the reverse complement of SEQ ID NO: 7. SEQ ID NO: 6 alignment with GenBank: AY770501 Score Expect Identities Gaps Strand 40.1 bits(20) 4e-08 20/20(100%) 0/20(0%) Plus/Plus Query 1 TATGAGACCTCGTAAGGCAG 20 |||||||||||||||||||| Sbjct 636 TATGAGACCTCGTAAGGCAG 655 In the instant case, the prior art teaches methods for creating primer sets to obtain SiFAD2 genes and alleles thereof in different germplasm with varying oleic acid content. Although the designed primer sets are targeted to the coding region, the primer sets would be able to identify the allele as claimed or can be designed as taught by Chen based on the plant accession. In the event that the plant accession varied from those taught by Chen, it would have been obvious to the ordinary artisan to design specific primers (such as those designed by Chen for the wild species which diverged in nucleotides as compared to the cultivated species), which would have necessarily resulted in primer sets able to obtain the Sifad2-1 allele. The technical problem of developing a primer pair for obtaining the allele Sifad2-1 would be solved by the methodology of Chen. PCR primer design is a technique that were routine in the art at the time the invention was made, as taught by the cited reference and the state of the art in general. Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Chen as applied to claim 4 above, and further in view of Chellamuthu, M. et al. (2021). “Genetically Modified Plants and Beyond.” Chapter: Genetic Engineering for Oil Modification. DOI: 10.5772/intechopen.101823. Claim 5 recites a PCR amplification method for obtaining the sesame allele Sifad2-1 according to claim 2, using the primer pair according to claim 4, characterized by comprising the following steps: (1) extracting genomic DNA from a sesame sample with normal oleic acid content Yuzhi 11; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification with the primer pair; when using the genomic DNA of the normal oleic acid content sesame sample Yuzhi 11 as the template, the allele Sifad2-l is obtained after amplification. Regarding claim 5, as detailed in the rejection of claim 4 detailed above, Chen teaches primer design for amplification and sequences of DNA fragments in the FAD2 coding region [pg. 11707, col. 2, ¶2]. Chen teaches that genomic DNA was extracted from fresh leaf tissue of wild and cultivated sesame plants. Chen does not explicitly teach extracting genomic DNA from Yuzhi 11 as the sesame sample with normal oleic acid content, however, Yuzhi 11 is a well-known and commonly grown sesame cultivar. For example, Chellamutha teaches that Yuzhi 11 is a modern cultivar with a genome assembly presently available, providing a significant tool for comparative genomic analysis and gene identification of genes like FADs [pg. 4, ¶2]. Chellamutha teaches that sesame genes for oil production and quality are likely to play major roles in other closely related oilseed species (for example, sunflower), allowing researchers to search for genes with similar functions [pg. 5, ¶2]. Chellamutha teaches that similar oil seed crops like safflower are primarily grown for their high-quality edible oil. Safflower lines with improved oleic acid have been linked to a defective fatty acid desaturase (FAD2-1) (fatty acid desaturase) enzyme in microsomes [pg. 9, ¶2]. Traditional breeding and genetic modification can be used to create high oleic cultivars. Given that Chen teaches primer design for amplification of the FAD2 coding region and Chellamutha teaches that Yuzhi 11 is a modern cultivar with a genome assembly known in the art, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to use genomic DNA from a sesame sample such as Yuzhi 11 to obtain the allele Sifad2-1 using the methods taught by Chen. As primer design is routine to one of ordinary skill in the art, it would not have been novel to design a primer pair and utilize such a pair in a PCR amplification method for obtaining the allele that would be innately within the genomic DNA of the “normal oleic acid content” Yuzhi 11 plant. The allele Sifad2-1 would be obtained after amplification based on the methods of Chen and the modern, commonly used Yuzhi 11 cultivar. One would have reasonable expectation of success given the methodology presented by Chen in designing a primer for a FAD2 gene based off the GenBank AY770501.1, annotated as Sesamum indicum microsomal oleic acid desaturase gene. One would be motivated to obtain such a gene, as Chellamutha teaches that the FAD2-1) (fatty acid desaturase) enzyme in microsomes has been linked to altered oleic acid in Safflower and teaches that this is a highly related plant species to sesame [pg. 5, ¶2; pg. 9, ¶2]. Primer design and PCR amplification for a known gene that is within a highly cultivated plant with a genome assembly is routine in the art and would be obvious to one of ordinary skill in the art. Conclusion No claims allowed. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to EMILY K. JOHNSON whose telephone number is (571)272-5761. The examiner can normally be reached Monday - Friday 7:30 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EMILY K JOHNSON/Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662 1 GenBank: AY770501.1, Sesamum indicum microsomal oleic acid desaturase gene, complete cds, published 2006. (See IDS filed 12/16/2024)