DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application is being examined under the pre-AIA first to invent provisions.
Status of the claims
Claims 1-64 have been cancelled.
Claims 65-78 are under examination.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of pre-AIA 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(b) the invention was patented or described in a printed publication in this or a foreign country or in public use or on sale in this country, more than one year prior to the date of application for patent in the United States.
Claims 65, 68, 71, 72, 73 and 76 remain rejected under pre-AIA 35 U.S.C. 102(a)(1) as being anticipated by Hajdukiewicz et al (Plant Molecular Biology, 25: 989-994, 1994).
Hajdukiewicz et al teach an agrobacterium comprising a construct comprising a DNA sequence encoding an aadA sequence inside a T-DNA sequence and a bacterial selection gene other than aadA, wherein the aadA sequence comprises SEQ ID NO:1. In addition, Hajdukiewicz et al disclose an aadA sequence which is 100% identical to the nucleotide sequence as set forth in SEQ ID NO:1 (see homology results below) ((claim 65), see, for example, page 990, first column, bridging paragraph where it teaches new Agrobacterium binary vectors. See, for example, page 991, Figure 1 where it teaches a construct comprising a DNA sequence encoding an aadA sequence. See, for example, page 992, first column to page 993, bridging paragraph where it teaches a bacterial selection other than aadA (i.e., kanamycin). See, for example the homology results disclosed below that show that Hajdukiewicz et al teach 100% homology to the claimed aadA sequence comprising SEQ ID NO:1).
Hajdukiewicz et al teach wherein the construct further comprises a coding sequence that confers a trait of agronomic interest or improved end use ((claims 68 and 73), see, for example, page 992, Figure 2 where it teaches kanamycin resistance).
Hajdukiewicz et al teach a composition comprising the agrobacterium of claim 65 and a medium comprising a bacterial selection compound other than spectinomycin ((claims 71 and 72), see, for example, page 993, first column, last paragraph to second column, bridging paragraph where it teaches plants that have been transformed with the pPZP binary vectors wherein transgenic shoots develop roots when inserted into a medium containing kanamycin thus obtaining plants with pPZP vectors.)
Hajdukiewicz et al teach a composition comprising the agrobacterium of claim 65 and a plant explant ((claim 76), see, for example, page 993, first column, last paragraph to second paragraph, bridging paragraph where it teaches transgenic plants were obtained with pPZP vectors by following a leaf disk (i.e., explant) protocol).
Accordingly, Hajdukiewicz et al anticipated the claimed invention.
RESULT 7
CVU10460/c
LOCUS CVU10460 6741 bp DNA circular SYN 28-JAN-1995
DEFINITION Binary cloning vector pPZP200 for plant transformation, complete
sequence.
ACCESSION U10460
VERSION U10460.1
KEYWORDS .
SOURCE Cloning vector pPZP200
ORGANISM Cloning vector pPZP200
other sequences; artificial sequences; vectors.
REFERENCE 1 (bases 1 to 6741)
AUTHORS Hajdukiewicz,P., Svab,Z. and Maliga,P.
TITLE The small, versatile pPZP family of Agrobacterium binary vectors
for plant transformation
JOURNAL Plant Mol. Biol. 25 (6), 989-994 (1994)
PUBMED 7919218
REFERENCE 2 (bases 1 to 6741)
AUTHORS Hajdukiewicz,P.
TITLE Direct Submission
JOURNAL Submitted (09-JUN-1994) Peter Hajdukiewicz, Waksman Institute,
Rutgers University, Old Hoes Lane, Piscataway, NJ 08855, USA
FEATURES Location/Qualifiers
source 1..6741
/organism="Cloning vector pPZP200"
/mol_type="genomic DNA"
/db_xref="taxon:35366
Query Match 100.0%; Score 792; Length 6741;
Best Local Similarity 100.0%;
Matches 792; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGGGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5870 ATGGGGGAAGCGGTGATCGCCGAAGTATCGACTCAACTATCAGAGGTAGTTGGCGTCATC 5811
Qy 61 GAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5810 GAGCGCCATCTCGAACCGACGTTGCTGGCCGTACATTTGTACGGCTCCGCAGTGGATGGC 5751
Qy 121 GGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAA 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5750 GGCCTGAAGCCACACAGTGATATTGATTTGCTGGTTACGGTGACCGTAAGGCTTGATGAA 5691
Qy 181 ACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5690 ACAACGCGGCGAGCTTTGATCAACGACCTTTTGGAAACTTCGGCTTCCCCTGGAGAGAGC 5631
Qy 241 GAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGT 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5630 GAGATTCTCCGCGCTGTAGAAGTCACCATTGTTGTGCACGACGACATCATTCCGTGGCGT 5571
Qy 301 TATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5570 TATCCAGCTAAGCGCGAACTGCAATTTGGAGAATGGCAGCGCAATGACATTCTTGCAGGT 5511
Qy 361 ATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5510 ATCTTCGAGCCAGCCACGATCGACATTGATCTGGCTATCTTGCTGACAAAAGCAAGAGAA 5451
Qy 421 CATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAG 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5450 CATAGCGTTGCCTTGGTAGGTCCAGCGGCGGAGGAACTCTTTGATCCGGTTCCTGAACAG 5391
Qy 481 GATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5390 GATCTATTTGAGGCGCTAAATGAAACCTTAACGCTATGGAACTCGCCGCCCGACTGGGCT 5331
Qy 541 GGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGC 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5330 GGCGATGAGCGAAATGTAGTGCTTACGTTGTCCCGCATTTGGTACAGCGCAGTAACCGGC 5271
Qy 601 AAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTAT 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5270 AAAATCGCGCCGAAGGATGTCGCTGCCGACTGGGCAATGGAGCGCCTGCCGGCCCAGTAT 5211
Qy 661 CAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCC 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5210 CAGCCCGTCATACTTGAAGCTAGACAGGCTTATCTTGGACAAGAAGAAGATCGCTTGGCC 5151
Qy 721 TCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTA 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5150 TCGCGCGCAGATCAGTTGGAAGAATTTGTCCACTACGTGAAAGGCGAGATCACCAAGGTA 5091
Qy 781 GTCGGCAAATAA 792
||||||||||||
Db 5090 GTCGGCAAATAA 5079
Response to arguments
Applicant argues that Hajdukiewicz does not teach or suggest an Agrobacterium comprising an aadA sequence and a bacterial selection gene other than aadA and that the only vector disclosed in Hajdukiewicz as comprising an aadA gene, the aadA gene is denoted as a bacterial marker gene. Applicant further argues that the kanamycin resistance is present in the Agrobacterium strain itself and is denoted as a plant marker gene, not a bacterial gene (see page 4, third paragraph to page 5, first paragraph of ‘Remarks’ filed February 19, 2026). Applicant's arguments have been fully considered but they are not persuasive.
Hajdukiewicz teaches Agrobacterium vectors that utilize T-DNA border regions comprising a aadA sequence inside the T-DNA (see, for example, page 991, Figure 1(b)). In addition, Hajdukiewicz teaches a bacterial selection gene other than aadA, namely the virulence strain EHA101 (see, for example, page 992, second column, first paragraph). Furthermore, Hajdukiewicz et al disclose an aadA sequence which is 100% identical to the nucleotide sequence as set forth in SEQ ID NO:1. Thus, the cited art meet the limitations required by the claims.
Claim Rejections - 35 USC § 103
The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under pre-AIA 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims under pre-AIA 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of pre-AIA 35 U.S.C. 103(c) and potential pre-AIA 35 U.S.C. 102(e), (f) or (g) prior art under pre-AIA 35 U.S.C. 103(a).
Claims 65-78 remain rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Hajdukiewicz et al (Plant Molecular Biology, 25: 989-994, 1994), in view of Scofield et al (Mol. Gen. Genet. 244: 189-196, 1994), in view of Zeng et al (Plant Cell Rep. 22:478-482, 2004).
The claims read on an Agrobacterium comprising a construct comprising a DNA sequence encoding an aminoglycoside adenyltransferase (aadA) sequence inside the T-DNA sequence and a bacterial selection gene other than aadA, wherein the aadA
sequence comprises SEQ ID NO:1 (claim 65); wherein the aadA sequence is fused to a chloroplast transit peptide encoding sequence (claim 66); wherein the aadA sequence comprises SEQ ID NO:2 (claim 67); wherein the construct further comprises a coding sequence that confers a trait of agronomic interest or improved end use (claims 68 and 73); wherein the coding sequence confers resistance to a herbicide (claims 69 and 74); wherein the coding sequence confers resistance to glyphosate, bialaphos, phosphinothricin, Basta, glufosinate, 2,4-D, an acetyl-coA carboxylase inhibitor, or dicamba (claims 70 and 75); a composition comprising the Agrobacterium of claim 65 and a medium comprising a bacterial selection compound other than spectinomycin (claim 71); wherein the bacterial selection compound is kanamycin (claim 72); a composition comprising the Agrobacterium of claim 65 and a plant explant (claim 76); wherein the explant comprises an embryonic meristem (claim 77); wherein the explant is a soybean, corn, cotton or canola explant (claim 78).
With regard to claim 65, Hajdukiewicz et al teach an agrobacterium comprising a construct comprising a DNA sequence encoding an aadA sequence inside a T-DNA sequence and a bacterial selection gene other than aadA, wherein the aadA sequence comprises SEQ ID NO:1. In addition, Hajdukiewicz et al disclose an aadA sequence which is 100% identical to the nucleotide sequence as set forth in SEQ ID NO:1 (see homology results below) (see, for example, page 990, first column, bridging paragraph where it teaches new Agrobacterium binary vectors. See, for example, page 991, Figure 1 where it teaches a construct comprising a DNA sequence encoding an aadA sequence. See, for example, page 992, first column to page 993, bridging paragraph where it teaches a bacterial selection other than aadA (i.e., kanamycin). See, for example the homology results disclosed above that show that Hajdukiewicz et al teach 100% homology to the claimed aadA sequence comprising SEQ ID NO:1).
With regard to claims 68 and 73, Hajdukiewicz et al teach wherein the construct further comprises a coding sequence that confers a trait of agronomic interest or improved end use (see, for example, page 992, Figure 2 where it teaches kanamycin resistance).
With regard to claims 71 and 72, Hajdukiewicz et al teach a composition comprising the agrobacterium of claim 65 and a medium comprising a bacterial selection compound other than spectinomycin (see, for example, page 993, first column, last paragraph to second column, bridging paragraph where it teaches plants that have been transformed with the pPZP binary vectors wherein transgenic shoots develop roots when inserted into a medium containing kanamycin thus obtaining plants with pPZP vectors.)
With regard to claim 76, Hajdukiewicz et al teach a composition comprising the agrobacterium of claim 65 and a plant explant (see, for example, page 993, first column, last paragraph to second paragraph, bridging paragraph where it teaches transgenic plants were obtained with pPZP vectors by following a leaf disk (i.e., explant) protocol).
Hajdukiewicz et al do not teach the limitations of claims 66, 67, 70, 74, 75, 77 and 78.
With regard to claims 66 and 67, Scofield et al teach an aadA sequence fused to a chloroplast transit peptide encoding sequence (see, for example, ‘Abstract’; page 190, ‘Materials and methods’ and Figure 1). Although none of the cited references specifically teach SEQ ID NO:2, it would have been obvious to one of ordinary skill in the art to fuse a chloroplast transit peptide to target a gene, including aadA, based on the teachings of Scofield et al. Without evidence to the contrary, it would have been obvious to one of ordinary skill in the art to use any chloroplast transit peptide, including SEQ ID NO: 2.
With regard to claims 69, 70, 74 and 75, Zeng et al teach a coding sequence conferring resistance to a herbicide (claims 69 and 74) wherein said resistance is to glufosinate (claims 70 and 75) (see, for example, page 479, ‘Materials and methods’ where it teaches agrobacterium-mediated transformation of soybean using the bar gene as a selectable marker coupled with the herbicide glufosinate as a selective agent).
With regard to claim 78, Zeng et al teach wherein the explant is a soybean (see, for example, page 480, Table 1 where it discloses the total number of explants and regenerated explants).
Response to arguments
Applicant argues that Hajdukiewicz, Scofield nor Zeng, alone or in any combination, teach or suggest an Agrobacterium comprising a construct comprising a DNA sequence encoding an aadA sequence inside the T-DNA sequence and a bacterial selection gene other than aadA (see page 5, last paragraph to page 6, bridging paragraph of ‘Remarks’ filed February 19, 2026). Applicant's arguments have been fully considered but they are not persuasive.
In response to applicant’s argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007).
Hajdukiewicz teaches Agrobacterium vectors that utilize T-DNA border regions comprising a aadA sequence inside the T-DNA (see, for example, page 991, Figure 1(b)). In addition, Hajdukiewicz teaches a bacterial selection gene other than aadA, namely the virulence strain EHA101 (see, for example, page 992, second column, first paragraph). In addition, Hajdukiewicz et al disclose an aadA sequence which is 100% identical to the nucleotide sequence as set forth in SEQ ID NO:1. Therefore, Hajdukiewicz teaches or suggests the limitations of claims 65, 68, 71-73 and 76. Scofield and Zeng do overcome the shortcomings of Hajdukiewicz because, as stated above, Scofield teach or suggest the limitations of claims 66 and 67, in that Scofield et al teach an aadA sequence fused to a chloroplast transit peptide encoding sequence (see, for example, ‘Abstract’; page 190, ‘Materials and methods’ and Figure 1). In addition, Zeng teach or suggest the limitations of claims 69, 70, 74 and 75, in that Zeng et al teach a coding sequence conferring resistance to a herbicide (claims 69 and 74) wherein said resistance is to glufosinate (claims 70 and 75) (see, for example, page 479, ‘Materials and methods’ where it teaches agrobacterium-mediated transformation of soybean using the bar gene as a selectable marker coupled with the herbicide glufosinate as a selective agent). Furthermore, Zeng teach or suggest the limitations of claim 78, in that Zeng et al teach wherein the explant is a soybean (see, for example, page 480, Table 1 where it discloses the total number of explants and regenerated explants). Although none of the cited references specifically teach SEQ ID NO:2, it would have been obvious to one of ordinary skill in the art to fuse a chloroplast transit peptide to target a gene, including aadA, based on the teachings of Scofield et al. Without evidence to the contrary, it would have been obvious to one of ordinary skill in the art to use any chloroplast transit peptide, including SEQ ID NO: 2.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 65-69, 71, 73 and 74 remain rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-9 of U.S. Patent No. 9,714,428. Although the claims at issue are not identical, they are not patentably distinct from each other because both the instant invention and the ‘428 patent claim constructs comprising sequences encoding aadA comprising SEQ ID NO:1 or SEQ ID NO:2, comprising a coding sequence that confers a trait of agronomic interest or improved end use or resistance to a herbicide. The claims are coextensive.
Claims 65-70 and 73-78 remain rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-8 of U.S. Patent No. 8,466,345. Although the claims at issue are not identical, they are not patentably distinct from each other because both the instant invention and the ‘’345 patent claim a construct comprising an aadA gene wherein one the sequences comprises SEQ ID NO:1 or SEQ ID NO:2 wherein the construct comprises a coding sequence that confers a trait of agronomic interest, improved end use or herbicide resistance. The claims are coextensive.
Response to arguments
Applicant requests that the rejection be held in abeyance until otherwise allowable subject matter has been identified (see page 6, last paragraph to page 7, bridging paragraph of ‘Remarks’ filed February 19, 2026).
Since allowable subject matter has not been identified, the rejection is maintained for the reasons of record as stated above.
Conclusion
No claims are allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEITH O. ROBINSON whose telephone number is (571)272-2918. The examiner can normally be reached Monday - Friday, 9:00 a.m. - 5:30 p.m. EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic, can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEITH O. ROBINSON/Primary Examiner, Art Unit 1661
Prosecution Insights