DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim for the benefit of a prior-filed provisional application 63/613,641 filed December 21st, 2023 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged.
Thus, the earliest possible priority for the instant application is December 21st, 2023.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on March 18th, 2025 was considered, initialed, and attached hereto. A signed copy of the list of references cited is included with this Office Action.
Status of Claims
Claims 1-7 filed December 20th, 2024 are pending and examined herein.
Claim Objections
Claim 7 recites polymorphism (cc), an A/G genotype at position 28,718,208, without a chromosome number. It is recommended to amend the claim to include the chromosome number.
Claim Interpretation
Claim 3 recites “wherein said genetic marker is selected from any one or more of SEQ ID NOs: 1-31”. Under broadest reasonable interpretation, this is taken to mean that the genetic marker may be selected from one of the SEQ ID NOs, meaning it may be within the SEQ ID NO., or the genetic marker may be the SEQ ID NO.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-2 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claims do not fall within at least one of the four categories of patent eligible subject matter because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. Claims 1-2 are determined to be directed to subject matter that is an abstract idea or mental process. The rationale for this determination is explained below.
Claim 1 recites a method for determining the genotype for a soybean plant by detecting the presence or absence of polymorphisms corresponding to one or more of SEQ ID NOs: 1-30. Although claim 2 recites a method for developing a Phytophthora resistant soybean plant, the only active method steps recite detecting the presence or absence of the markers in any one or more of SEQ ID NOs: 1-31. This judicial exception is not integrated into a practical application because the additional steps of “obtaining a sample of nucleic acids”, “detecting in the nucleic acids”, and “applying marker enhanced selection”, merely involved gathering data and performing analysis that does not impose any meaningful limits on the judicial exception. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the additional elements, including obtaining nucleic acids, marker and SNP detection, using marker assisted selection to detect polymorphisms are well-understood, routine and conventional activities in the field.
Claims 1 and 2 only recite methods which consist of detecting and selecting based on if the plant has the genotype associated with Phytophthora resistance or SNP markers, or if the plant does not have this. These claims read on mental processes, or evaluating genotypic data and selecting or characterizing the plant based on the information, which is merely observational and judgmental. The claims do not require any transformational means to obtain the claimed nucleic acids or breeding of the plant, thus, the claims encompass data gathering for naturally occurring plants. As the steps of “obtaining a sample of nucleic acids from the soybean plants”, “detecting in the nucleic acids”, and “applying marker enhanced selection” are very generally recited, these are not interpreted as anything more than data collection and analysis. Likewise, the steps to SEQ ID NOs: 1-31 does not meaningfully limit or alter the steps to be performed.
For a claim directed to a judicial exception to be patent-eligible, the claim must include additional element sufficient to integrate the exception into practical application and to add significantly more than the exception itself (see MPEP § 2106 and MPEP § 2106.04(d)). The instant limitations as detailed above do not impose any technological improvement in genotyping or breeding and thus do not add meaningful limits or amount to significantly more than the judicial exception itself.
Claim 6 is rejected under 35 U.S.C. §101 because the claimed invention is directed to non-statutory subject matter. The claims do not fall within at least one of the four categories of patent eligible subject matter because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. Claim 6 is determined to be directed to subject matter that is naturally occurring, or to a law of nature/natural principle or natural phenomenon. The rationale for this determination is explained below.
Claim 6 is drawn to a marker for detecting resistance to Phytophthora comprising a polymorphism at a specific position relative to a reference genome, Glycine max Williams82a2.75. The claim does not specify the resistant allele, and as such, the claim is directed to naturally occurring DNA markers comprising naturally occurring genomic sequence variation (i.e., a product of nature). A naturally occurring DNA segment is not patent-eligible merely because it has been identified or isolated.
The claimed polymorphisms are only defined by the naturally occurring chromosomal position in reference to the Glycine max Williams82a2.75 reference genome. Claims to nature-based products are evaluated for whether they possess markedly different characteristics from their naturally occurring counter parts, yet no structural modifications, recombinant construction, probes, or other features that would render the claimed markers materially different from what exists in nature are present in the claims. The recitation of “a marker for detecting resistance to Phytophthora”, does not add meaningful limitation or integrate the judicial exception into practical application because it merely states an intended use of the markers. Thus, the claim is directed to a judicial exception.
Examine notes that claim 7 was not rejected under 35 USC § 101 because of the reference to the specific Phytophthora resistance SNP or InDel markers.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Indefiniteness
Claims 2 and 6-7 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 2 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being incomplete for omitting essential steps, such omission amounting to a gap between the steps. See MPEP § 2172.01.
Claim 2 recites a method for developing a Phytophthora resistant soybean plant, wherein the method comprises applying marker enhanced selection to detect one or more polymorphisms. The preamble states a method for developing a Phytophthora resistant soybean plant, however, the actual method steps do not recite a way to develop a plant; i.e., they never accomplish what is recited in the preamble. The steps instead appear to accomplish a method of detecting Phytophthora resistant polymorphisms within a soybean plant.
Claims 6-7 recite several positions across chromosomes 3, 13, and 18 of the Glycine max reference genome, Williams82a2.75, and claim polymorphisms relative to the reference genome. The recited polymorphisms are referenced as locations within the reference genome, however, the Williams82a2.75 reference genome appears to be a version of the commonly cited Williams82 Glycine max reference genome which has been released three times since its first release as a whole-genome shotgun approach in 20101. The pattern used by the DOE-JGI and SoyBase has generally taken the form Wm82.a4.v1, with the middle field ("a4") indicating assembly version and the last field (v1) indicating the annotation version. Thus, this is assumed to be a later version in the assemblies. As shown below, the chromosomal length of the Williams82 vary amongst versions and additionally vary in comparison to other cultivar genome assemblies, such as the Lee genome assembly (GLYMA.LEE.A1), a representative of the Southern soybean germplasm where Williams 82 is a representative of the Northern germplasm.
PNG
media_image1.png
830
1049
media_image1.png
Greyscale
Therefore, this is demonstrated to be a dynamic external reference genome, not a fixed sequence or bounded structure that would allow for identification of the polymorphisms outside of the singular reference framework. No guidance is provided for determining the marker coordinates if the reference assembly is updated, annotated, or interpreted differently across references or alternative genomes, such as the Lee reference genome shown above. The Applicant does not provide a specific definition for the Williams82a2.75. As this is essential for determining the metes and bounds of the claims, the claims are rendered indefinite.
One of ordinary skill in the art would not be reasonably appraised of the scope of the invention because the metes and bounds of the claims rely on a dynamic, external coordinate system that is not relevant to any soybean plant, instead of a claim-based, well defined structural framework.
Further, claim 7 recites a marker for detecting resistance to Phytophthora, wherein said marker comprises a polymorphism relative to the reference soybean genome. Claim 7 provides a list of polymorphisms (a)-(dd). The recitation of the polymorphism is unclear as it is unclear what the resistant allele is in the claim. For example, the (a) polymorphism is a G/T genotype at position 2,979,606 on chromosome 3. The Sequence Listing (XML file) filed 12/20/2024 further states that the k position (assumed to be the polymorphism) can be G or T, but does not specify if one or both G and T are resistant alleles. Table 3 of the instant specification has the G/T genotype in the SNP/InDel column, indicating that the polymorphism G genotype is a SNP and the T is an InDel polymorphism. However, column 4 of Table 3 showed the resistant allele as only the T genotype. The reverse is shown with polymorphism (f), a C/T genotype at position 3,390,452 on chromosome 3, wherein the designated SNP (C) is the resistant allele. Polymorphisms (aa)-(cc) do not have designated resistant alleles in Table 3, and additionally, polymorphism (cc) in claim 7 does not recite the chromosome number. It is unclear what the actual resistant allele is intended to be as claimed, thus the metes and bounds of the claim are unknown. Proper clarification is required.
Improper Markush Grouping
Claims 1-7 are rejected on the basis that they contain an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of SEQ ID NOs: 1-31 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: the claims encompass markers comprising polymorphisms on different chromosomes and/or in variable regions within the chromosomes. There is no conserved structure among all of the claimed marker groups as they are spread across the soybean genome. For example, a marker on the 3rd chromosome as compared to a marker on the 13th chromosome would comprise different associated polymorphisms and favorable alleles to indicate the gene of interest to confer the Phytophthora resistance trait to the soybean population.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Description
Claims 1-7 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are broadly drawn to a method of screening and identifying any soybean plants for any polymorphisms associated with Phytophthora resistance found in any one or more of SEQ ID NOs: 1-31. The claims are further drawn to creating a Phytophthora resistant soybean plant by crossing a plant with a genetic marker from within any of SEQ ID NOs: 1-31 with another soybean plant. Lastly, claim 6 provides a nucleotide position relative to a reference soybean genome and claim 7 provides resistance alleles.
The Applicant describes:
The development of thirty-one markers across chromosomes 3, 13, and 18 relative to the reference genome Williams82a2.75.
Resistance to Phytophthora sojae isolates PRR1 and PRR1S11 with RpsX resistance gene, resistance to PRR1 and Prr4 isolates with Rps3a and Rps3b.
The Applicant does not describe:
That the genes associated with the markers provide resistance to any and all Phytophthora species and isolates.
That any polymorphism within SEQ ID NOs: 1-31 provide resistance to Phytophthora or that one SNP that is capable of providing complete resistance to Phytophthora in a soybean plant.
That the sequences recited as SEQ ID NOs: 1-31 themselves provide resistance.
The germplasm or source for the original soybean parent plant or accession number that created the population used in the identification of many of the SNPs.
That the markers remain reliably association with Phytophthora resistance across all sources of soybean in breeding methods and genotyping, screening, or detecting of polymorphisms from any diverse sources for the presence or absence of the markers.
First, the Applicant does not describe resistant against any and all Phytophthora species and isolates. Phytophthora is a vast genus of oomycete plant pathogens that have been documented in agricultural and horticultural settings for over a century (Bourret, T. et al. 2023, “Cataloging Phytophthora Species of Agriculture, Forests, Horticulture, and Restoration Outplantings in California, U.S.A.: A Sequence-Based Meta-Analysis,” Plant Disease, 107:67-75) [Abstract]. As new isolates are continually isolated, identified, and described, there is no single, fixed number of Phytophthora isolates. Additionally, out of 80 Phytophthora taxa studied in sequence accessions in California, the most common species were P. gonapodyides, P. pseudosyringae, P. ramorum, P. cactorum, and P. crassamura, showing distribution across the agriculture land use category (17%), forest (47%), horticulture (12%), and restoration outplantings (15%) (10% could not be placed into one of the categories) [pg. 69, col. 2, ¶1-2]. Of the 800 isolates tested, P. sojae (the species described in the instant application) was not even represented. Although P. sojae is the most common Phytophthora spp. in soybean, there is a vast number of Phytophthora species and isolates across various ecosystems, and the only isolates tested in the instant application were PRR1, PRR1S11, and PRR4, the large genus of Phytophthora resistance is not reduced to practice.
Additionally, the Applicant concedes that Rps3 genes/alleles did not confer resistance to isolate PRR1S11, indicating that identification and detection of the markers related to Rps3, namely those found somewhere within SEQ ID NOs: 16-17, and 20-21, as shown in Table 3. It would not be clear to one of ordinary skill in the art that the Applicant was in possession of the invention as claimed as the Applicant specifies that not all the polymorphisms identified in any one or more of SEQ ID NOs: 1-31 are associated with resistance to any Phytophthora spp. Therefore, the genus claim of “one or more polymorphisms are selected from the SNPs or InDel in any one or more of SEQ ID NOs: 1-31” is not reduced to practice given the insufficient number of species described.
Second, the Applicant does not describe that detecting a single polymorphism would indicate Phytophthora resistance. Applicant describes marker development only in combination in the provided examples. See, for example, the RpsX validation, which states that a total of 23 KASP markers around the candidate gene were developed and used to screen germplasm to identify genotypes with RpsX allele [¶120]. As only 6 RpsX loci are described in Table 3, with one resistant allele documented for each, it is not clear if these are simply a sub-selection of the 23 KASP markers identified, but nonetheless, Applicant does not describe detecting only one marker for identifying genotypes with the RpsX allele.
Third, the Applicant does not describe that the SEQ ID NOs. themselves confer any resistance as claimed in claim 3 (part b.), wherein said genetic marker is selected from any one or more of SEQ ID NOs: 1-31. This appears to indicate that the SEQ ID NOs. themselves are the genetic markers, not simply that the genetic markers are within the SEQ ID NOs. The Applicant does not describe in the instant disclosure that the phenotype is correlated to the full sequences themselves, but rather that the associated resistance is entirely dependent on the SNPs and/or InDels within the sequences. For example, the instant specification suggests that the resistant allele T of the InDel polymorphism is at a specific location within the reference genome and corresponds to SEQ ID NO: 1 associated with marker ID. mGLY0025646. The Sequence Listing (XML file) filed 12/20/2024 states that the k at nucleotide position 200 may be G or T. The instant specification does not provide any further clarification as to whether the surrounding sequence may be predictive of Phytophthora resistance or reduced to practice Phytophthora resistance using the sequences as listed. There is insufficient structure provided such that one of ordinary skill in the art would not reasonably expect the sequences as claimed to be able to perform the function of conferring or detecting within a plant resistance to Phytophthora.
Fourth, Applicant describes several undefined populations of soybean germplasm used to identify genotypes RpsX, Rps3, and Rps8 alleles and validate efficiency against Phytophthora sojae isolates. For the RpsX resistance gene, Applicant indicates that this gene was initially reported in the Chinese soybean cultivar Xiu94-11, with the gene Glyma.03g027200 as the likely candidate gene of RpsX. 23 KASP markers around the candidate gene were developed and used for screening an undisclosed inventory of USDA germplasm to identify genotypes with the RpsX allele [¶120]. Some of the identified Plant Introduction (PI) lines were then used as the male parent with the susceptible Williams line as the female parent. Phenotypic analysis showed resistance to P. sojae isolates PRR1 and PRR1s11 in six populations.
For the Rps3a and Rps3b validation of genes and alleles, two PI lines (Rps3a and Rps3b) were crossed with PI518718A. The resulting with the donor alleles in the Rps3 locus displayed resistance to P. sojae isolates PRR1 And PRR4, but not PRR1S11. For the Rps8 validation, the locus of the gene was mapped using a cross between “a susceptible line and a resistant line.” 24 KASP markers were developed and the locus was refined to a more precise region of the Williams82a2.75 reference genome.
Validation of Rps4-6 was not described, nor was Rsp1 (SEQ ID NOs: 2, 5-12, and 28) or RspU N1 (SEQ ID NO: 27). Thus, the Applicant does not describe resistance of these alleles within the claimed sequences or reduce to practice detecting any polymorphisms related to these SEQ ID NOs. for a method of determining the genotype of a soybean plant, a method for developing a Phytophthora resistant soybean plant, or a method for producing a soybean plant with resistance to Phytophthora and plant thereof, as claimed in claims 1-5. Further, the use of these SNP markers as claimed in claims 6-7 is not reduced to practice because they have not been shown to be effective in Phytophthora resistance as claimed. Undue experimentation would be required for one of ordinary skill in the art to certify that the structure does indeed lead to the function. One of ordinary skill in the art would not recognize that the Applicant was in possession of the necessary features of the broadly claimed genus of Phytophthora resistance with the disclosed species.
Lastly, Applicant does not reduce to practice genotyping additional sources of soybean germplasm outside of the materials and methods for validating the three described Phytophthora isolates. Applicant merely describes using parental sources with a known resistance or resistance gene for only a few of the claimed sequences and markers. Applicant does not remark on transferability of makers across soybean germplasm, linkage stability, or predictive performance across soybean populations. In the art, this is dependent on the gene of interest and the germplasm at hand. For example, linkage disequilibrium blocks (genomic regions with high, non-random associations that allow researchers to use fewer SNPs to represent larger genomic segments) are generally smaller in wild species than in cultivated soybean species, meaning the SNPs may be insufficient to map the gene in wild populations (Song, Q. et al. 2024, “Development and implementation of nested single-nucleotide polymorphism (SNP) assays for breeding and genetic research applications”, The Plant Genome, 17, e20491) [pg. 6, col. 2, ¶2]. Thus, determining the genotype of any soybean plant was not sufficiently described and undue experimentation would be required to test whether or not the trait is actually present with detection of just a single marker in any soybean plant (such as wild soybean) as claimed.
Therefore, given the lack of written description in the instant disclosure with regard to the
structural and functional characteristics of the claimed methods and compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
Scope of Enablement
Claims 1-7 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for detecting resistance against several isolate of Phytophthora sojae with specific markers at specific positions and using those specific markers in resistant plants and methods for determining and developing some Phytophthora resistance, does not reasonably provide enablement for determining resistance against any Phytophthora, developing a soybean plant resistant to all Phytophthora with any one or more polymorphism within SEQ ID NOs: 1-31, and detecting a marker for resistance with only a position in an external reference genome. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make or use the invention commensurate in scope with these claims.
In re Wands lists a number of factors for determining whether or not undue experimentation would be required by one skilled in the art to make and/or use the invention. These factors are: (1) the
quantity of experimentation necessary; (2) the amount of direction or guidance presented; (3) the presence or absence of working examples of the invention; (4) the nature of the invention; (5) the state of the prior art; (6) the relative skill of those in the art; (7) the predictability or unpredictability of the art; (8) the breadth of the claim. In re Wands, 858 F.2d 731, 8 USPQ2d 1400 (Fed. Cir. 1988).
The nature of the invention is the use of genetic polymorphisms as markers to characterize, predict, and select for the presence of Phytophthora resistance in soybean plants. This requires one of ordinary skill in the art to be able to reliably determine the presence or absence of well-defined polymorphisms for use in the claimed methods of breeding and selection across the full scope of the claims, which is not provided in the instant disclosure.
Claims 1-5 are broadly drawn to a method of screening and identifying any soybean plants for any polymorphisms associated with Phytophthora resistance found in any one or more of SEQ ID NOs: 1-31. The claims are further drawn to creating a Phytophthora resistant soybean plant by crossing a plant with a genetic marker of SEQ ID NOs: 1-31 with another soybean plant. Lastly, claim 6 provides a nucleotide position relative to a reference soybean genome and claim 7 provides resistance alleles.
The Applicant teaches:
The development of thirty-one markers across chromosomes 3, 13, and 18 relative to the reference genome Williams82a2.75.
Validation of several Rps genes/alleles in plants inoculated with select P. sojae isolates.
Resistance to P. sojae isolates PRR1 and PRR1S11 with RpsX resistance gene, resistance to PRR1 and Prr4 isolates with Rps3a and Rps3b.
The Applicant does not teach:
That the genes associated with the markers provide resistance to any and all Phytophthora species and isolates.
That any polymorphism within SEQ ID NOs: 1-31 provide resistance to Phytophthora or that one polymorphism that is capable of providing complete resistance to Phytophthora in a soybean plant.
That SEQ ID NOs: 1-31 are themselves associated with Phytophthora resistance and may be used as genetic markers without reference to the polymorphisms.
That the markers remain reliably association with Phytophthora resistance across all sources of soybean in breeding methods and genotyping, screening, or detecting of polymorphisms from any diverse sources for the presence or absence of the markers.
How to reliably locate the polymorphisms for detecting resistance to Phytophthora.
First, the instant disclosure and the instant claims do not set forth sufficient structural characteristics essential to determining resistance to all Phytophthora species and isolates such that one would envision the SNPs required to detect every isolate in any soybean plant. The art teaches that new isolates of Phytophthora are continually isolated, identified and described, making the claim of “Phytophthora resistance” a broad claim (Bourret, T. et al. 2023, “Cataloging Phytophthora Species of Agriculture, Forests, Horticulture, and Restoration Outplantings in California, U.S.A.: A Sequence-Based Meta-Analysis,” Plant Disease, 107:67-75) [Abstract]. The instant specification provides guidance only for several isolates of Phytophthora sojae, and demonstrates that plants with the claimed markers are not resistant to all isolates [Table 2]. Table 3 shows that the locus for the genes/alleles are entirely Rps genes, or Resistance to Phytophthora sojae genes. A significant amount of experimentation would be required to determine if the polymorphisms corresponding to the SNPs within SEQ ID NOs: 1-31 accurately develop or produce a plant resistant to the broad scope of Phytophthora.
Second, it is unclear if detecting any one or more undefined polymorphisms selected from the SNPs or InDels in any one or more of SEQ ID NOs: 1-31 (as recited in claim 2), is sufficient to provide one of ordinary skill in the art with guidance to make or use the invention as claimed, as the defined polymorphisms appear to be essential to the detection of the resistance. Further, claims 6 and 7 are directed to markers comprising polymorphisms at specified nucleotide positions on specific chromosomes in relation to the Williams 82a2.75 reference genome. However, the instant specification does not establish that the mere presence of any polymorphism are the recited position is sufficient to detect Phytophthora resistance across the full scope of the claims. Even with specific polymorphisms defined as in claim 7, the presence of any single marker may not indicate resistance.
The art generally teaches that one marker is often insufficient to definitively determine a genotype. A single marker may be significantly linked to a resistance gene, but a combination of markers, flanking marker or haplotypes, are usually required for accurate selection in plant breeding. For example, a single marker might not be close enough to the resistance gene, leading to false positives or negatives, some Rps resistance is controlled by multiple genes, or a marker might identify a gene a gene that is effective against some isolates, but ineffective against others (You, H., 2023, “Soybean Variety Saedanbaek Confers a New Resistance Allele to Phytophthora sojae”, Plants (Basel), 12(23):3957) [Abstract]. Indeed, the Applicant concedes that the Rps3a and Rps3b marker validation of the genes/alleles did not lead to resistance to Phytophthora sojae isolate PRR1S11 [Table 2], providing a pointed example of a particular polymorphism that would not lead to the full scope of Phytophthora resistance.
Third, claim 3 states that the genetic marker is selected from any one of SEQ ID NOs: 1-31, indicating that the sequence itself is associated to Phytophthora resistance. There is no evidence in the specification to support the sequences without specificity for the determined polymorphisms would be able to be used in the method as claimed. One of ordinary skill in the art would not reasonable be able to make or use the invention to the broad scope it is currently claimed in claims 1-5.
Fourth, the disclosure does not provide enough guidance to establish predictive reliability in detecting resistance or in introducing resistance to another soybean line without resistance. As wild soybean plants tend to have smaller linkage disequilibrium blocks as compared to cultivated soybean populations, a limited number of markers may be insufficient to map to the resistance genes (Song, Q. et al. 2024, “Development and implementation of nested single-nucleotide polymorphism (SNP) assays for breeding and genetic research applications”, The Plant Genome, 17, e20491) [pg. 6, col. 2, ¶2]. Working examples were provided for the validation of several Rps genes, but use of the actual polymorphisms for detection and production of a plant with the scope of full resistance to Phytophothora was not demonstrated. Given that the scope of the claims is such that the marker for detecting resistance to Phytophthora may comprise a single polymorphism, it would require undue experimentation to determine whether the recited positions reliably predict resistance in different genetic backgrounds and breeding contexts.
Lastly, as the claimed markers comprising polymorphisms rely on a static external reference genome that has been shown to be indefinite (see 112(b) indefiniteness rejection), one of ordinary skill in the art would not be appraised as to how to dependably make or use the invention as claimed. It would not be possible to conduct genotyping of any soybean material without a reliable framework. The art teaches that existing SNP markers for which the genomic positions have been reported in Williams 82 need to be continuously updated with the advent of new assemblies [Song, Q. et al., 2024; pg. 3, col 1, ¶2]. Thus, consistency in detecting polymorphisms in an assembly of a reference genome is not predictable in the art and would need further experimentation to ensure the genotype would be successfully determined.
Although the Sequence Listing (XML file) filed 12/20/2024 recites a position within the SEQ ID NOs, it does not define if this is the resistant allele as listed in Table 3 (see 112(b) indefiniteness rejection). Additionally, as claimed, claims 1-5 only make reference to the SEQ ID NOs. without claiming the specific SNPs and claims 6-7 only claim the nucleotide position within the reference genome. Thus, the scope of the invention is wide and one of ordinary skill in the art would not have sufficient guidance with regard to making and/or using the claimed invention across its full scope without undue experimentation. The Applicant is only enabled for determining resistant against specific P. sojae isolates based on defined polymorphisms at specified positions within the SEQ ID NOs. associated with specifically claimed Rps resistant alleles, as taught in the instant specification.
Thus, the examples provided by the Applicant do not provide adequate working examples to enable the scope of the invention without undue experimentation. Given the breadth of the claims, the lack of guidance and working examples, the unpredictability in the art, and the state of the art, undue experimentation would be required to make and use the claimed invention, and therefore, the invention is not enabled throughout the broad scope of the claims.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-7 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Chaky, J. et al. U.S. Patent Application Publication No. US 20140178867 A1, “Genetic Loci Associated with Phytophthora Tolerance in Soybean and Methods of Use”, published 06/26/2014.
Claim 1 recites a method of determining the genotype of a soybean plant, wherein said method comprises obtaining a sample of nucleic acids from the soybean plant and detecting in the nucleic acids, a plurality of polymorphisms, wherein said plurality of polymorphisms correspond to the single nucleotide polymorphisms identified in SEQ ID NO: 28.
Claim 2 recites a method for developing a Phytophthora resistant soybean plant, wherein the method comprises applying marker enhanced selection to detect one or more polymorphisms, wherein said one or more polymorphisms are selected from the single nucleotide polymorphisms or InDel in SEQ ID NO: 28.
Claim 3 recites a method of producing a soybean plant that has resistance to Phytophthora as compared to a control plant, wherein the method comprises: a. Isolating a nucleic acid from a soybean plant; b. Detecting in the nucleic acid, the presence of one or more genetic markers that are associated with resistance to Phytophthora, wherein said genetic marker is selected from SEQ ID NO: 28; c. Selecting a first soybean plant based on the presence of the marker associated with resistance; d. Crossing a second soybean plant with said first soybean plant, wherein the second soybean plant does not comprise in its genome the marker associated with resistance to Phytophthora; e. Producing seed from said crossing; and f. Selecting a soybean plant grown from said seed that has resistance to Phytophthora and comprises the genetic marker associated with resistance to Phytophthora.
Claim 4 recites the method of claim 3, further comprising the step of backcrossing the plants produced from step (f).
Claim 5 recites a soybean plant produced by the method of claim 3, wherein the plant comprises the genetic marker associated with resistance to Phytophthora.
Claim 6 recites a marker for detecting resistance to Phytophthora, wherein said marker comprises a polymorphism relative to a reference soybean genome, for Glycine max at nucleotide position: In another embodiment, the one or more markers comprises a polymorphism relative to a reference soybean genome, for Glycine max at nucleotide position: (bb) 4,343,399 on chromosome 3, wherein the reference genome is the Glycine max reference genome (Williams82a2.75 reference genome).
Claim 7 recites a marker for detecting resistance to Phytophthora, wherein said marker comprises a polymorphism on the Glycine max relative to a reference soybean genome (o) a C/T genotype at position 4,343,399 on chromosome 3, wherein the reference genome is the Glycine max reference genome (Williams82a2.75 reference genome).
Regarding claim 1, Chaky teaches a method of identifying a first soybean plant or first soybean germplasm that displays tolerance or improved tolerance to Phytophthora infection, the method comprising detecting in the genome of said first soybean plant or in the genome of said first soybean germplasm at least one marker locus that is associated with the tolerance (i.e., a method of determining the genotype of a soybean plant) [claim 1]. Qualitative polymorphism at the DNA level at one or more specific marker loci are derived by genotyping a sample of seed or plant tissue (i.e., wherein said method comprises obtaining a sample of nucleic acids from the soybean plant and detecting in the nucleic acids a plurality of polymorphisms) [¶33]. Amplification primers for amplifying useful marker loci and suitable probes to detect useful marker loci or to genotype SNP alleles are provided (i.e., wherein said plurality of polymorphisms correspond to single nucleotide polymorphisms) [¶111].
Chaky teaches that the method involves amplifying a variant or fragment of one or more polynucleotides associated with the loci comprising SEQ ID NO: 159 [claim 12]. Chaky teaches a primer or primer pair for amplification comprising a variant or fragment of SEQ ID NO: 159 [claim 13]. The method further comprises providing one or more labeled nucleic acid probes suitable for detection of each marker locus being amplified comprising variant or fragment of SEQ ID NO: 159 [claim 28]. SEQ ID NO: 159 of Chaky has 98.8% identity to SEQ ID NO: 28 of the instant application (see alignment below) (i.e., wherein said plurality of polymorphisms corresponds to the single nucleotide polymorphisms identified in SEQ ID NO: 28). The instant claims do not specify where within the listed sequenced the SNPs must be located, thus a sequence with 98.8% identity with documented Phytophthora resistance is taken to read on the claims.
Query Match 98.8%; Score 395.8; Length 639;
Best Local Similarity 98.3%;
Matches 394; Conservative 5; Mismatches 2; Indels 0; Gaps 0;
Qy 1 TCATCAATGATTTTTAGAATATTTCCTTTATACAAAATGACAAATTCTATTATTAGGGAA 60
|||||||||||||:||||||||||||||||||||||||||||||||||||||||||||||
Db 99 TCATCAATGATTTYTAGAATATTTCCTTTATACAAAATGACAAATTCTATTATTAGGGAA 158
Qy 61 GTGGTATAAATAAAAGCATTTGTAAACCATTGAGGGATATGAATGAACAAAATACAAGCT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 159 GTGGTATAAATAAAAGCATTTGTAAACCATTGAGGGATATGAATGAACAAAATACAAGCT 218
Qy 121 TCCTTTCCTTCAGTGCCTTTTTCTCTCTTCTTCTTCCTTGCATTCTGGAGGTGCTAGTCC 180
|||||||||||:||||||||||||||||||||||||||||||||||||||||||||||||
Db 219 TCCTTTCCTTCRGTGCCTTTTTCTCTCTTCTTCTTCCTTGCATTCTGGAGGTGCTAGTCC 278
Qy 181 CGAATCCAGCAATTTCCCTGYGTTTGCACATAACATAGTTTCTAGTATTAGTTAAAGGGC 240
||||||||||||||||||||:|||||||| ||||||||||||||||||||||||||||||
Db 279 CGAATCCAGCAATTTCCCTGCGTTTGCACGTAACATAGTTTCTAGTATTAGTTAAAGGGC 338
Qy 241 AAAACTAAAAAATATGTGCACCAAAGAATAGGGGATGGCTAGTTTTTATGTTAGAATCTT 300
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Db 339 AAAACTAAAAAATATGTGCACCAAAGAATAGGGGATGGTTAGTTTTTATGTTAGAATCTT 398
Qy 301 ACGACAATTTGAACCTACTATCTCTTCTACTTTTTCTTTTAACACTTAATTTTTTTTTTT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||::
Db 399 ACGACAATTTGAACCTACTATCTCTTCTACTTTTTCTTTTAACACTTAATTTTTTTTTYK 458
Qy 361 ATCATTAAATTAATTTTATATCTTTGGATATTTTATTTATT 401
|||||||||||||||||||||||||||||||||||||||||
Db 459 ATCATTAAATTAATTTTATATCTTTGGATATTTTATTTATT 499
Regarding claim 2, the method further comprises selecting the first soybean plant or first soybean germplasm or a progeny thereof having the at least one marker locus, crossing the selected first soybean plant with a second soybean plant (i.e., a method for developing a Phytophthora resistant soybean plant) [claims 5-6]. Chaky teaches that the use of marker assisted selection (MAS) to select a soybean plant or germplasm which has a certain marker locus, haplotype or marker profile is provided (i.e., wherein the method comprises applying marker enhanced selection to detect one or more polymorphisms) [¶104]. Favorable genotypes associated with at least trait of interest may be identified by one or more methodologies [¶103]. In some examples one or more markers are used, including but not limited to AFLPs, RFLPs, ASH, SSRs, SNPs, indels. Chaky teaches the use of amplification primers for amplifying useful marker loci and suitable probes to detect useful marker loci or to genotype SNP alleles [¶111]. As detailed above, Chaky teaches detection of marker loci within SEQ ID NO: 159, a sequence with 98.8% identity to SEQ ID NO: 28 (i.e., wherein said one or more polymorphisms are selected from the single nucleotide polymorphisms in SEQ ID NO: 28).
Regarding claim 3, Chaky teaches methods for breeding of soybean varieties comprising Phytophthora tolerance markers or alleles and teaches that any of the disclosed marker loci, alleles, or marker profiled can be introduced to a soybean line via introgression, traditional breeding, or transformation (i.e., a method of producing a soybean plant that has resistance to Phytophthora as compared to a control plant) [¶130]. Chaky teaches genomic DNA extraction for testing and amplification using a standard CTAB protocol (i.e., isolating a nucleic acid from a soybean plant) [¶211].
Chaky teaches primers and probs to detect nucleic acids of interest, such as nucleic acids comprising marker loci [¶111]. As detailed above, Chaky teaches detection of marker loci within SEQ ID NO: 159, a sequence with 98.8% identity to SEQ ID NO: 28 (i.e., detecting in the nucleic acid, the presence of one or more genetic markers that are associated with resistance to Phytophthora, wherein said genetic marker is selected from SEQ ID NO: 28).
Chaky teaches a method of selecting the first soybean plant or first soybean germplasm or a progeny thereof having the at least one marker locus and crossing the selected first soybean plant with a second soybean plant (i.e., selecting a first soybean plant based on the presence of the marker associated with resistance; crossing a second soybean plant with said first soybean plant) [claims 5-6]. Chaky teaches that at least one of the first or second soybean plants is a plant that comprises at least one of the marker loci or marker profiles such that the progeny are capable of inheriting the marker loci or marker profile [¶132. Chaky teaches introgression of Phytophthora tolerance into non-tolerant or less-tolerant soybean germplasm (i.e., wherein the second soybean plant does not comprise in its genome the marker associated with resistance to Phytophthora) [¶127].
Chaky teaches that the method includes growing the crossed progeny plants under plant growth conditions to yield soybean plant progeny [¶132]. Progeny plants or seed can be sold commercially for soybean production, used for food, processed to obtain a desired constituent of the soybean, or further utilized in subsequent rounds of breeding (i.e., producing seed from said crossing). Soybean plant progeny or seed can be assayed for alleles associated with tolerance and, thereby, the desired progeny selected (i.e., selecting a soybean plant grown from said seed that has resistance to Phytophthora and comprises the genetic marker associated with resistance to Phytophthora).
Regarding claim 4, Chaky teaches that one application of MAS is to use the tolerance markers, haplotypes or marker profiles to increase the efficiency of backcrossing aimed at introducing a tolerance trait into a desired background. Chaky teaches that backcrossing is a process in which a breeder crosses a progeny variety back to one of the parental genotypes, one or more times. This may be done with the soybean plant grown from seed of the cross of the first soybean plant with the genetic marker and the second soybean plant, for example (i.e., the method of claim 3, further comprising the step of backcrossing the plants produced from step f).
Regarding claim 5, Chaky teaches progeny plants obtained from the disclosed methodology. Chaky teaches that progeny plants or seed can be sold commercially for soybean production, used for food, processed to obtain a desired constituent of the soybean, or further utilized in subsequent rounds of breeding (i.e., a soybean plant produced by the method of claim 3) [¶132]. Chaky teaches that such progeny can be assayed and selected for alleles associated with Phytophthora tolerance (i.e., wherein the plant comprises the genetic marker associated with resistance to Phytophthora).
Regarding claims 6-7, Examiner notes that the physical positions of the markers of Chaky are based on the Public JGI Glymal Williams82 reference, however, it is not possible to compare as there are multiple versions of the Williams 82 reference genome and the instant claims use the Williams82a2.75 reference genome.
Though the instantly claimed polymorphisms are based on the reference sequence and rejected for indefiniteness (see 112(b) indefiniteness rejection), it appears that Y at position 201 of SEQ ID NO: 28 can be either a C or a T to detect Phytophthora resistance (see Sequence Listing (XML file) filed 12/20/2024). SEQ ID NO: 159 of Chaky has a C at position 201 and thus reads on (bb) of claim 6 and (o) of claim 7.
Conclusion
No claims allowed.
Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EMILY K. JOHNSON whose telephone number is (571)272-5761. The examiner can normally be reached Monday - Friday 7:30 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EMILY K JOHNSON/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
1 SoyBase, Genome Assembly Page, https://www.soybase.org/resources/genome_info/
Prosecution Insights