Prosecution Insights
Last updated: August 06, 2026
Application No. 19/010,241

METHODS FOR INDUCING APOMIXIS IN PLANTS

Non-Final OA §102§103§112
Filed
Jan 06, 2025
Priority
Mar 13, 2024 — CN 202410284881.8
Examiner
MEYER, GEORGE WILLIAM
Art Unit
1661
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
China National Rice Research Institute
OA Round
1 (Non-Final)
100%
Grant Probability
Favorable
1-2
OA Rounds
9m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 100% — above average
100%
Career Allowance Rate
3 granted / 3 resolved
+40.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 4m
Avg Prosecution
17 currently pending
Career history
19
Total Applications
across all art units

Statute-Specific Performance

§101
13.0%
-27.0% vs TC avg
§103
45.7%
+5.7% vs TC avg
§102
8.7%
-31.3% vs TC avg
§112
30.4%
-9.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 3 resolved cases

Office Action

§102 §103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Response to Previous Communications This office actions is in response to the election filed 05/07/2026 by Yu Rao which states applicant elects Invention III without traverse, and elected a monocotyledon and rice for Claim 7 and Agrobacterium-mediated transformation for Claim 8, also without traverse. Priority Applicant claims priority to a Chinese application filed 03/13/2024 with the number CN202410284881.8. Status of Claims Claims 10-14 are new. Claims 3-5 are canceled. Claims 1-2 and 6-14 are pending. Claims 1-2 are withdrawn for being directed to non-elected invention(s). Claims 6-14 are examined herein. Claim Interpretation Claims 6 and 10-11, recite the phrase “expression components”, which is interpreted by the examiner to encompass a gene. Claim 10 recites “a nucleotide sequence of SEQ ID NO: 1” which is interpreted by the examiner to be the full length sequence of SEQ ID NO:1. Claim 12 recites a binary expression vector, named T225, comprising a pAtDD45 promoter driven by gOsWUS. The gOsWUS in Claim 12 is interpreted to represent genomic DNA encoding an OsWUS gene. The term “ pAtDD45” is interpreted to indicate the native promoter of AtDD45. Claim Objection Claims 6,10, and 12-13 are objected to for not italicizing gene names. Claim 8 is objected to for not italicizing “Agrobacterium”. Claim 13 is objected to because it is unclear if the promoter referenced in the claim is the promoters of the genes listed or the genes listed. Appropriate correction is required. Claim Rejections - 35 USC § 112 (b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 9 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 9 recites the relative phrases (i) “normal seed setting rate” and (ii) “high clonal seed efficiency” with the underlined words showing subjective terms (see MPEP 2173.05(b) IV Section 2173.02 recites “A decision on whether a claim is indefinite under 35 U.S.C. 112(b) or pre-AIA 35 U.S.C. 112, second paragraph requires a determination of whether those skilled in the art would understand what is claimed when the claim is read in light of the specification…. Therefore, it is important to analyze claim terms in view of the application’s specification from the perspective of those skilled in the relevant art since a particular term used in one patent or application may not have the same meaning when used in a different application”. Is a “normal” seed setting rate 100% of control or a value that is statistically similar? Under what conditions? Is a “higher” seed setting rate than the control, as was reported for T225#1 in table 1, “normal”? Similar indefiniteness rejection can be applied to plants with high clonal seed efficiency. Is 21.7% a high value as was seen in table 1? Or is it some other value? Claim Rejections - 35 USC § 112 (a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Written Description Claims 6-14 are rejected under 35 USC § U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The Federal Circuit has clarified the written description requirement. The court stated that a written description of an invention "requires a precise definition, such as by structure, formula, [or] chemical name, of the claimed subject matter sufficient to distinguish it from other materials". University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568; 43 USPQ2d 1398, 1406 (Fed. Cir. 1997). The court also concluded that "naming a type of material generally known to exist, in the absence of knowledge as to what that material consists of, is not description of that material". Id. Further, the court held that to adequately describe a claimed genus, Patent Owner must describe a representative number of the species of the claimed genus, and that one of skill in the art should be able to "visualize or recognize the identity of the members of the genus". The claims are broadly drawn to a method of inducing apomixis in plants using a vector containing MiMe-producing components and WUS gene ectopically expressed using an egg cell-specific promoter. Applicant describes: In rice, which is a diploid, introducing MiMe components can produce tetraploid offspring, and the WUS expression component can induce haploid production. When MiMe components and WUS expression components are combined, tetraploids can be reduced to diploids, thereby producing clonal seeds. Chunyou 84 (CY84) rice plants transformed with theT225 vector, which contained the gOsWUS from CY84 under the expression of the pAtDD45 promoter with sgMiMe, were apomictic. These plants had a seed setting rate that was ~72-83.3% and the proportion of diploids (i.e. clonal seeds) was 0-21.7%. Ectopic Expression of gZmWUS (NP _001105961 ) in maize and gSiWUS (XP _022680535) in Millet under egg cell-specific promoter for AtDD45 induces haploids. Applicant does not describe: The use of a vector that contains a WUS gene under the expression of an egg cell-specific promoter with MiMe-producing components that induces apomixis in all possible plant species. All WUS (including all OsWUS) genes capable of inducing haploid plants when expressed under an egg cell promoter. All possible egg cell-specific promoters. The instant disclosure and the instant claims do not set forth clear structural characteristics essential to identifying if the claimed construct would induce apomixis in all possible plants. For example, Heidemann, Bas, et al. "To infinity and beyond: recent progress, bottlenecks, and potential of clonal seeds by apomixis." The Plant Journal 121.4 (2025): e70054 recites “The second step in apomixis is the induction of the egg cell development into an embryo without fertilization by parthenogenesis. Despite progress with BBM, PAR, and WUS, significant bottlenecks must be overcome to establish fully penetrant synthetic apomixis in both dicot and monocot crop species” (see page 16 paragraph 3). This passage indicates that there is considerable work and testing that would need to be performed in using applicant’s method in all possible plant species as drawn to in Claims 6 and 8-13. Additionally, it implies that the applicant’s claims which encompass all possible WUS (including OsWUS in Claim 10) genes would require significant trial and error in testing if the gene can be used to convey apomixis in plants. Additionally, Claim 10 is directed to all rice WUS genes, including SEQ ID NO:1. This indicates there are multiple OsWUS genes. However, Tang, Huiwu, et al. "Changes in the expression pattern of OsWUS negatively regulate plant stature and panicle development in rice." G3: Genes, Genomes, Genetics 13.7 (2023): jkad100 teaches “A single WUS ortholog was identified in rice based on phylogenetic analyses and was found to be expressed in young leaf primordia, preferentially in the lateral leaf margins” (see page 2 paragraph 2) which indicates SEQ ID NO:1 is the only Rice WUS gene encompassed by Claim 10. Page 2 paragraph 2 also teaches there are multiple alleles (i.e. mutations) in this gene, such as tab1, moc3, and Srt1. Such mutant OsWUS genes were not included in the applicant’s disclosure and if they could or could not be used in a method for inducing apomixis were not disclosed. Heidemann et al 2025 also recites “ To achieve egg cell-specific expression most current studies have employed the Arabidopsis EC1.1 or EC1.2 promoters. However, they may not be optimal and further promoter discovery could identify more suitable promoters of parthenogenesis engineering” (see page 17 paragraph 3). Which indicates that the egg cell specific promoters used by the applicant and referenced in Claim 13 may require further testing to determine if they would be suitable for use in all plant species. Additionally, Sadravi, Shekoofeh, June Lee, and Jianfeng Xu. "Advances in promoter engineering strategies for enhanced recombinant protein expression in plants." Frontiers in Plant Science 16 (2025): 1747353 recites “Although numerous constitutive, inducible, and tissue-specific promoters have been reported, only a small subset has been thoroughly characterized in terms of strength, dynamics, and expression consistency... This hampers rational design and often leads to trial-and-error approaches in promoter selection”. This statement indicates there are likely other egg cell specific promoters not tested or listed in the applicant’s specification which would read upon the limitations of Claims 6-11 and 14. Therefore, given the lack of written description in the instant disclosure with regard to the structural and functional characteristics of the claimed compositions, namely (i) all possible plants, (ii) all possible WUS genes, and (iii) all possible egg cell-specific promoters, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 6-9,11, and 13 are rejected under 35 U.S.C. 102(a)(1) based upon a public use or sale or other public availability of the invention and are anticipated by Dan, Junhao, et al. "One-line hybrid rice with high-efficiency synthetic apomixis and near-normal fertility." Plant Cell Reports 43.3 (2024): 79 (published online 02/24/2024) as evidenced by Wang, Chun, et al. "Clonal seeds from hybrid rice by simultaneous genome engineering of meiosis and fertilization genes." Nature biotechnology 37.3 (2019): 283-286 (see IDS filed 03/17/2025). Dan et al 2024 is directed to engineering apomixis in rice using plasmids (i.e. binary expression vectors) with normal seed setting rates and high clonal seed efficiency. The use of WUS genes and various egg cell specific promoters are also disclosed. Regarding Claim 6, Dan et al 2024 teaches a method that uses a plasmid (i.e. binary expression vector), called p95c, which can be visualized in Figure 1d for inducing apomixis. This vector contained MiMe-producing components (i.e. Cas9 and gRNA) which knock out specific genes to generating MiMe mutants, see page 2 paragraph 6. This vector also contains an AtWUS (i.e. WUS) gene driven by a fusion promoter which contains an egg cell-specific promoter (i.e. pOsECA1-Like1) which was described on page 2 paragraph 6. Additionally page 2 paragraph 7 teaches a method for screening plants for mutations in genes which would cause MiMe (and would inherently include the WUS gene as the two constructs are on the same tDNA) meaning the method can be used to screen for MiMe and WUS ectopic expression lines and be used to obtain apomictic lines. The vectors described by Dan et al 2024 were “subsequently introduced into EHA105 competent cells [ i.e. Agrobacterium] 1 and transformed into YY4 hybrid [i.e. monocotyledon rice]” which anticipates Claims 7-8. Generated plants were examined for normal seed-setting rates and high clonal seed efficiency as was stated on page 3 paragraph 6, Figure 1h, and Table 1 which anticipates Claim 9. Dan et al 20242 also anticipates the limitations of Claim 11 as instant SEQ ID NOs: 6-8 align to sequences in Supplemental Table 5 (see below) which was used to design guide RNA to knockout PAIR1, REC8, and OSD1. While Dan et al 2024 does not explicitly state the U3 promoter drives expression of the gRNA that targets PAIR1, REC8, and OSD1. Page 3 paragraph 5, which is directed to how constructs were made that can be used to create MiMe mutants that produce diploid clonal gametes, cites Wang et al 2019. Figure 1 of Wang et al 2019 provides evidence by showing the structure of CRISPR–Cas9 vector targeting OSD1, PAIR1 and REC8 using “U3” promoters to drive expression of the gRNA targeting OSD1, PAIR1 and REC8 which address all the limitations of Claim 11. PNG media_image1.png 229 522 media_image1.png Greyscale SEQ ID NO:6 aagcaacccagtgcaccgctgg PAIR1 gRNA-2 aagcaacccagtgcaccgctgg SEQ ID NO:7 cggagagccttagtgccatggg RC OsREC8 gRNA-2 cggagagccttagtgccatggg RC (Reverse Complement) SEQ ID NO:8 ctgccgccgacgagcaacaag OsOSD1 gRNA-2 ctgccgccgacgagcaacaag Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 10 and 12-13 are rejected under 35 U.S.C. 103 as being unpatentable over the teachings of Dan et al 2024 as evidenced by Wang et al 2019 and applied to Claim 6 in further view of WO 2020211747 A1 (Cao), Susaki, Daichi, et al. "Dynamics of the cell fate specifications during female gametophyte development in Arabidopsis." PLoS biology 19.3 (2021): e3001123 and the sequences set in GeneBank Accession Nos. AK287621.1 and CR855152.1. Dan et al 2024 as evidenced by Wang et al 2019 teaches the expression of an AtWUS gene and three sgRNA expression cassettes driven by U3 promoters for targeting PAIR1, REC8, and OSD1 genes on a binary expression vector (i.e. limitations of Claim 12) as was described previously for the 35 USC § 102 rejection for Claim 113. Dan et al 2024 as evidenced by Wang et al 2019 does not explicitly teach the use of a binary expression vector called T225 comprising a pAtDD45 promoter driven gOsWUS or egg cell-specific promoters from the list in Claim 13 which drives ectopic expression of the WUS gene. Cao is directed to a method for selecting seeds that were generated through apomixis (i.e. asexual embryo seeds; see abstract) in rice (see paragraph bridging page 5 and 6). Their method for inducing apomixis appears to include “embryo autonomous genes driven by an egg cell-specific expression promoter [i.e. ectopic expression]… The embryogenic genes of the E1 include but are not limited to BBM1,WUS , LEC, CLAVATA, MYB115” (see claims section page 21 paragraph 1). This paragraph also teaches the use of an egg cell-specific promoter “atDD45” (i.e. Claims 12 and 13). The BBM1 gene sequence referenced in the Cao document (i.e. SEQ ID NO: 6) appears to be a rice gene as the first hit in an NCBI blast of SEQ ID NO: 6 is from rice (see alignment below). PNG media_image2.png 703 1288 media_image2.png Greyscale Query: Cao’s SEQ ID NO:6 Subject: NCBI result GeneBank AK287621.1 from Oryza sativa Japonica Query 1 ATGGCCTCCATCACCAACTGGCTCGGCTTCTCCTCCTCCTCCTTCTCCGGCGCCGGCGCC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4 ATGGCCTCCATCACCAACTGGCTCGGCTTCTCCTCCTCCTCCTTCTCCGGCGCCGGCGCC 63 Query 61 GACCCCGTCCTGCCCCACCCGCCGCTGCAAGAGTGGGGGAGCGCTTATGAGGGCGGCGGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 64 GACCCCGTCCTGCCCCACCCGCCGCTGCAAGAGTGGGGGAGCGCTTATGAGGGCGGCGGC 123 Query 121 ACGGTGGCGGCCGCCGGCGGGGAGGAGACGGCGGCGCCGAAGCTGGAGGACTTCCTCGGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 124 ACGGTGGCGGCCGCCGGCGGGGAGGAGACGGCGGCGCCGAAGCTGGAGGACTTCCTCGGC 183 Query 181 ATGCAGGTGCAGCAGGAGACGGCCGCCGCGGCGGCGGGGCACGGCCGTGGAGGCAGCTCG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 184 ATGCAGGTGCAGCAGGAGACGGCCGCCGCGGCGGCGGGGCACGGCCGTGGAGGCAGCTCG 243 Query 241 TCGGTCGTTGGGCTGTCCATGATCAAGAACTGGCTACGCAGCCAGCCGCCGCCCGCGGTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 244 TCGGTCGTTGGGCTGTCCATGATCAAGAACTGGCTACGCAGCCAGCCGCCGCCCGCGGTG 303 Query 301 GTTGGGGGAGAAGACGCTATGATGGCGCTCGCGGTGTCGACGTCGGCGTCGCCGCCGGTG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 304 GTTGGGGGAGAAGACGCTATGATGGCGCTCGCGGTGTCGACGTCGGCGTCGCCGCCGGTG 363 Query 361 GACGCGACGGTGCCGGCCTGCATTTCGCCGGATGGGATGGGGTCGAAggcggccgacggc 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 364 GACGCGACGGTGCCGGCCTGCATTTCGCCGGATGGGATGGGGTCGAAGGCGGCCGACGGC 423 Query 421 ggcggcgcggccgaggcggcggcggcggcggcggcgCAGAGGATGAAGGCGGCCATGGAC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 424 GGCGGCGCGGCCGAGGCGGCGGCGGCGGCGGCGGCGCAGAGGATGAAGGCGGCCATGGAC 483 Query 481 ACGTTCGGGCAGCGGACGTCCATCTACCGGGGTGTCACCAAGCACAGGTGGACAGGAAGG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 484 ACGTTCGGGCAGCGGACGTCCATCTACCGGGGTGTCACCAAGCACAGGTGGACAGGAAGG 543 Query 541 TATGAAGCCCATCTTTGGGATAACAGCTGCAGAAGAGAAGGTCAGACTCGCAAAGGCAGA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 544 TATGAAGCCCATCTTTGGGATAACAGCTGCAGAAGAGAAGGTCAGACTCGCAAAGGCAGA 603 Query 601 CAAGTCAATGCAGGAGGATATGATAAGGAAGAAAAAGCTGCTAGGGCTTATGATTTGGCT 660 ||||| || |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 604 CAAGTATATCTTGGAGGATATGATAAGGAAGAAAAAGCTGCTAGGGCTTATGATTTGGCT 663 Query 661 GCCCTTAAATACTGGGGCACTACAACGACGACGAATTTTCCGGTAAGCAACTACGAAAAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 664 GCCCTTAAATACTGGGGCACTACAACGACGACGAATTTTCCGGTAAGCAACTACGAAAAA 723 Query 721 GAGTTGGATGAAATGAAGCACATGAATAGGCAGGAATTTGTTGCATCCCTTAGAAGAAAA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 724 GAGTTGGATGAAATGAAGCACATGAATAGGCAGGAATTTGTTGCATCCCTTAGAAGAAAA 783 Query 781 AGCAGTGGATTTTCACGTGGTGCTTCCATATATCGTGGTGTTACAAGACACCATCAGCAT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 784 AGCAGTGGATTTTCACGTGGTGCTTCCATATATCGTGGTGTTACAAGACACCATCAGCAT 843 Query 841 GGAAGGTGGCAAGCAAGGATAGGACGGGTGGCAGGAAACAAGGATCTGTATTTGGGCACA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 844 GGAAGGTGGCAAGCAAGGATAGGACGGGTGGCAGGAAACAAGGATCTGTATTTGGGCACA 903 Query 901 TTTGGCACCCAAGAGGAAGCTGCAGAGGCATATGATATCGCTGCAATCAAATTCCGTGGT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 904 TTTGGCACCCAAGAGGAAGCTGCAGAGGCATATGATATCGCTGCAATCAAATTCCGTGGT 963 Query 961 CTCAATGCTGTGACAAACTTTGACATGAGCCGGTACGATGTCAAGAGCATCATTGAAAGC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 964 CTCAATGCTGTGACAAACTTTGACATGAGCCGGTACGATGTCAAGAGCATCATTGAAAGC 1023 Query 1021 AGCAATCTCCCAATTGGTACTGGAACCACCCGGCGATTGAAGGACTCCTCTGATCACACT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1024 AGCAATCTCCCAATTGGTACTGGAACCACCCGGCGATTGAAGGACTCCTCTGATCACACT 1083 Query 1081 GATAATGTCATGGACATCAATGTCAATACCGAACCCAATAATGTGGTATCATCCCACTTC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1084 GATAATGTCATGGACATCAATGTCAATACCGAACCCAATAATGTGGTATCATCCCACTTC 1143 Query 1141 ACCAATGGGGTTGGCAACTATGGTTCGCAGCATTATGGTTACAATGGATGGTCGCCAATT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1144 ACCAATGGGGTTGGCAACTATGGTTCGCAGCATTATGGTTACAATGGATGGTCGCCAATT 1203 Query 1201 AGCATGCAGCCGATCCCCTCGCAGTACGCCAACGGCCAGCCCAGGGCATGGTTGAAACAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1204 AGCATGCAGCCGATCCCCTCGCAGTACGCCAACGGCCAGCCCAGGGCATGGTTGAAACAA 1263 Query 1261 GAGCAGGACAGCTCTGTGGTTACAGCGGCGCAGAACCTGCACAATCTACATCATTTTAGT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1264 GAGCAGGACAGCTCTGTGGTTACAGCGGCGCAGAACCTGCACAATCTACATCATTTTAGT 1323 Query 1321 TCCTTGGGCTACACCCACAACTTCTTCCAGCAATCTGATGTTCCAGACGTCACAGGTTTC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1324 TCCTTGGGCTACACCCACAACTTCTTCCAGCAATCTGATGTTCCAGACGTCACAGGTTTC 1383 Query 1381 GTTGATGCGCCTTCGAGGTCCAGTGACTCATACTCCTTCAGGTACAATGGAACAAATGGC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1384 GTTGATGCGCCTTCGAGGTCCAGTGACTCATACTCCTTCAGGTACAATGGAACAAATGGC 1443 Query 1441 TTTCATGGTCTCCCGGGTGGAATCAGCTATGCTATGCCGGTTGCGACAGCGGTGGACCAA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1444 TTTCATGGTCTCCCGGGTGGAATCAGCTATGCTATGCCGGTTGCGACAGCGGTGGACCAA 1503 Query 1501 GGTCAGGGCATCCATGGCTATGGAGAAGATGGTGTGGCAGGCATTGACACCACACATGAC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1504 GGTCAGGGCATCCATGGCTATGGAGAAGATGGTGTGGCAGGCATTGACACCACACATGAC 1563 Query 1561 CTGTATGGCAGCCGTAATGTGTACTACCTTTCCGAGGGTTCGCTTCTTGCCGATGTCGAA 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1564 CTGTATGGCAGCCGTAATGTGTACTACCTTTCCGAGGGTTCGCTTCTTGCCGATGTCGAA 1623 Query 1621 AAAGAAGGCGACTATGGCCAATCTGTGGGGGGCAACAGCTGGGTTTTGCCGACACCGTAG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1624 AAAGAAGGCGACTATGGCCAATCTGTGGGGGGCAACAGCTGGGTTTTGCCGACACCGTAG 1683 Dan et al 2024 as evidenced by Wang et al 2019, Cao and AK287621.1 does not explicitly teach the use of a binary expression vector called T225 comprising a pAtDD45 promoter driven gOsWUS (SEQ ID NO:1) or other egg cell-specific promoters from the list in Claim 13 (besides AtDD45) which drives ectopic expression of the WUS gene. Susaki et al 2021 is referenced by Dan et al 2024 on page 3 paragraph 5 when disclosing the components of the fusion promoter in the p94C background. Susaki teaches EC1.1 (At1g76750) and EC1.2 (At2g21740) (i.e. AtDD45) genes encode the cysteine-rich proteins and are specifically expressed in the egg cell in Arabidopsis, indicating promoters from this genes would also be egg cell specific (see page 10 paragraph 1). Promoters from these genes are specifically listed in Claim 13. The use of an AtDD45 promoter was also a limitation of Claim 12. Dan et al 2024 as evidenced by Wang et al 2019, Cao, AK287621.1 and Susaki et al 2021 do not explicitly teach the use of a genomic OsWUS (gOsWUS) with a SEQ ID NO. 1. An NCBI BLAST of Applicant’s SEQ ID NO:1 clearly identifies it as a Rice WUS gene (see below). The top hit is GeneBank Accession No. CR855152.1 (see alignment below) and identifies this sequence as a rice genomic sequence and has been known in the art since 2006. PNG media_image3.png 505 1235 media_image3.png Greyscale Oryza sativa genomic DNA, chromosome 4, BAC clone: OSIGBa0099L20, complete sequence Sequence ID: CR855152.1Length: 82575Number of Matches: 1 Range 1: 32125 to 33172GenBankGraphicsNext MatchPrevious Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 1910 bits(1034) 0.0 1046/1051(99%) 3/1051(0%) Plus/Minus Query: Applicant’s SEQ ID NO:1 Sbjct Query 1 ATGGATCACATgcagcagcagcagcggcagcaggtgggtggagggggaggagaggaggtg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 33172 ATGGATCACATGCAGCAGCAGCAGCGGCAGCAGGTGGGTGGAGGGGGAGGAGAGGAGGTG 33113 Query 61 gcggggaggggtggtgtgccggtgtgccggccgagcgggaCGAGGTGGACGCCGACGACG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 33112 GCGGGGAGGGGTGGTGTGCCGGTGTGCCGGCCGAGCGGGACGAGGTGGACGCCGACGACG 33053 Query 121 GAGCAGATCAAGATCCTGCGGGAGCTGTACTACAGCTGCGGCATCAGGTCGCCCAACTCG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 33052 GAGCAGATCAAGATCCTGCGGGAGCTGTACTACAGCTGCGGCATCAGGTCGCCCAATTCG 32993 Query 181 GAGCAGATCCAGCGGATCGCCGCCATGCTGCGCCAGTACGGCCGCATCGAGGGCAAGAAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32992 GAGCAGATCCAGCGGATCGCCGCCATGCTGCGCCAGTACGGCCGCATCGAGGGCAAGAAC 32933 Query 241 GTCTTCTACTGGTTCCAGAACCACAAGGCCCGCGAGCGCCAGAAGAAGcgcctcaccacg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32932 GTCTTCTACTGGTTCCAGAACCACAAGGCCCGCGAGCGCCAGAAGAAGCGCCTCACCACG 32873 Query 301 ctcgacgtcaccaccaccaccgccgccgccgccgacgccgacgccagccacctcgccgTC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32872 CTCGACGTCACCACCACCACCGCCGCCGCCGCCGACGCCGACGCCAGCCACCTCGCCGTC 32813 Query 361 CTCTCCCTCTCGCCTACAGCAGCTGGTACGTTGCTGCGTCATGGCTAATTCCGATCGCTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32812 CTCTCCCTCTCGCCTACAGCAGCTGGTACGTTGCTGCGTCATGGCTAATTCCGATCGCTG 32753 Query 421 CTTCCCTGCTAAGCTGTAATGCGCGAGCCGGCGCCGAGCCGCCGATCGATGCTTCTGCGT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32752 CTTCCCTGCTAAGCTGTAATGCGCGAGCCGGCGCCGAGCCGCCGATCGATGCTTCTGCGT 32693 Query 481 GTGCAGGCGCGACGGCTCCCTCTTTCCCGGGCTTCTACGTCGGCAATGGCGGCGCCGTGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32692 GTGCAGGCGCGACGGCTCCCTCTTTCCCGGGCTTCTACGTCGGCAATGGCGGCGCCGTGC 32633 Query 541 AGACGGATCAGGCCAACGTCGTCAACTGGGACTGCACCGCCATGGCAGCCGAGAAAACCT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32632 AGACGGATCAGGCCAACGTCGTCAACTGGGACTGCACCGCCATGGCAGCCGAGAAAACCT 32573 Query 601 TCCTGCAGGTATGATCACACGTACTACTACCTCCTCCAGGTGTGTGTGAATTCACCATGC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32572 TCCTGCAGGTATGATCACACGTACTACTACCTCCTCCAGGTGTGTGTGAATTCACCATGC 32513 Query 661 AAGAGCAAGCTAATGTGCAATGCTGCAGGACTACATGGGCGTGAgcggcggcggcggcgc 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32512 AAGAGCAAGCTAATGTGCAATGCTGCAGGACTACATGGGCGTGAGCGGCGGCGGCGGCGC 32453 Query 721 cgccgcggcggcCCCGACGCCGTGGGCGATGACGACGACGACTCGCGAGCCCGAGACGCT 780 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct 32452 CGCCGCGGCGGCCCCGACGCCGTGGGCGATGACGACGAC---TCGCGAGCCCGAGACGCT 32396 Query 781 TCCACTCTTCCCAGTCGTCGGCGGCGGCGGCGACGGCGCGCATCGTCACGCCGGCCACGG 840 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct 32395 TCCACTCTTCCCAGTCGGCGGCGGCGGCGGCGACGGCGCGCATCGTCACGCCGGCCACGG 32336 Query 841 CGGTTTCCCGTCCAACTTCCAGCGCTGGGGTTCTGCTGCTGCTACCACCAACACCATTAC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32335 CGGTTTCCCGTCCAACTTCCAGCGCTGGGGTTCTGCTGCTGCTACCACCAACACCATTAC 32276 Query 901 GGTCcagcagcatttgcagcagcacaacttttacagcagcagcagcagccagctgcacag 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32275 GGTCCAGCAGCATTTGCAGCAGCACAACTTTTACAGCAGCAGCAGCAGCCAGCTGCACAG 32216 Query 961 ccaggatgggccggcagcaggcaCATCCCTGGAGCTCACTCTCAGCTCCTACTACTGCTC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 32215 CCAGGATGGGCCGGCAGCAGGCACATCCCTGGAGCTCACTCTCAGCTCCTACTACTGCTC 32156 Query 1021 ATGCTCACCTTACCCTGCAGGGTCCATGTGA 1051 ||||||||||||||||||||||||||||||| Sbjct 32155 ATGCTCACCTTACCCTGCAGGGTCCATGTGA 32125 It would have been prima facie obvious to combine the teachings of Dan et al 2024 as evidenced by Wang et al 2019, Cao, Susaki et al 2021 and the sequences set in GeneBank Accession No. AK287621.1 and CR855152.1 to identify an OsWUS gene (i.e. SEQ ID NO: 1) for inducing apomixis under ectopic expression as recited in Claim 10 and to identify these egg cell-specific promoters recited in Claims 12 and 13. While Cao does not explicitly teach an OsWUS sequence, it is heavily implied as the listed alternative gene (BBM1) appears to be a rice gene. Furthermore, one having ordinary skill in the art would have a high expectation of success that using an OsWUS gene would aid in producing apomixis in rice as a functional variant (i.e. AtWUS gene) has already been demonstrated to be useful in inducing apomixis in rice (see Dan et al 2024 and 35 U.S.C. 102 rejection above). Additionally, these promoters are known in the art, documented to be egg cell-specific, and commonly used to express genes used for inducing apomixis4 which would give one of ordinary skill in the art a high expectancy of success. While the prior art does not teach the use of a binary vector with these specific components, it would have been obvious to one of ordinary skill in the art to engineer them into a binary expression vector and call it T225. One of ordinary skill in the art would have been motivated to use them in a method for inducing apomixis “which can lead to the fixation of heterosis and reduce the cost of hybrid rice seed production” as was recited on page 8 paragraph 3 of Dan et al 2024. Claim 14 is rejected under 35 U.S.C. 103 as being unpatentable over the teachings of Dan et al 2024 as applied to Claim 6 in further view of Wang et al 2019. Dan et al 2024 does not explicitly teach the use of the hybrid rice, Chunyou 84 (CY84). Wang et al 2019 is also directed to using MiMe mutants so they propagate clonally through seeds (i.e. apomixis). Page 2 paragraph 2 of Wang et al recites the Chunyou84 (CY84) (i.e. the rice line recited in Claim 14) was used to generate osd1 pair1 rec8 (i.e. MiMe-producing components) and mtl quadruple mutants and named the mutant “Fix”. These Fix plants were able to generate clonal seeds (i.e. were apomictic) as was shown on Table 1. It would have been prima facie obvious to combine the teachings of Dan et al 2024 and Wang et al 2019 to identify a method that utilizes Chunyou 84 as this plant has already demonstrated an ability to be engineered for synthetic apomixis. Because this line has been used for similar studies (i.e. inducing apomixis) one of ordinary skill in the art would have a reasonable expectation of success a method that introduces binary expression vector also containing MiMe-producing components and a WUS ectopic expression component would also be apomictic. One would have been motivated to generate such a method as inducing apomixis in rice “can lead to the fixation of heterosis and reduce the cost of hybrid rice seed production” as was recited on page 8 paragraph 3 of Dan et al 2024. Conclusion Claims 6-14 are rejected. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to GEORGE W MEYER whose telephone number is (571)272-3733. The examiner can normally be reached Monday - Friday 8:00 am- 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /GEORGE W MEYER/ Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/ Supervisory Patent Examiner, Art Units 1661 & 1662 1 Referenced on page 3 paragraph 5 2 As evidenced by Wang, Chun, et al. "Clonal seeds from hybrid rice by simultaneous genome engineering of meiosis and fertilization genes." Nature biotechnology 37.3 (2019): 283-286. 3 Figure 1 of Wang et al 2019 shows the structure of CRISPR–Cas9 vector targeting OSD1, PAIR1 and REC8 using “U3” promoters to drive expression of the gRNA targeting OSD1, PAIR1 and REC8 which address all the limitations of Claim 11. 4 See Dan et al 2024 page 4 paragraph 1 and page 5 paragraph 3 which recites “Altogether, using AtDD45 and fusion promoter can yield one-line hybrid rice with high-frequency clonal seeds and near-normal fertility in combination with the MiMe”.
Read full office action

Prosecution Timeline

Jan 06, 2025
Application Filed
Jul 28, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
100%
Grant Probability
99%
With Interview (+0.0%)
2y 4m (~9m remaining)
Median Time to Grant
Low
PTA Risk
Based on 3 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month