Prosecution Insights
Last updated: August 06, 2026
Application No. 19/013,087

BIOLOGICAL DEVICES FOR THE DETECTION OF ALZHEIMER'S DISEASE AND CONCUSSIONS AND METHODS OF USE THEREOF

Non-Final OA §103
Filed
Jan 08, 2025
Priority
Jan 11, 2024 — provisional 63/619,819
Examiner
ZAHORIK, AMANDA MARY
Art Unit
Tech Center
Assignee
Bio Capital Holdings LLC
OA Round
1 (Non-Final)
56%
Grant Probability
Moderate
1-2
OA Rounds
2y 0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 56% of resolved cases
56%
Career Allowance Rate
40 granted / 71 resolved
-3.7% vs TC avg
Strong +49% interview lift
Without
With
+49.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
47 currently pending
Career history
115
Total Applications
across all art units

Statute-Specific Performance

§101
6.2%
-33.8% vs TC avg
§103
33.0%
-7.0% vs TC avg
§102
16.4%
-23.6% vs TC avg
§112
31.3%
-8.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 71 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Please note: The Examiner handling this application has changed and is now Amanda Zahorik in Art Unit 1636. Application Status This action is written in response to applicant’s correspondence received 06/04/2026. Claims 1-30 are currently pending. Claims 28 and 29 are withdrawn from prosecution as being drawn to non-elected subject matter. Accordingly, claims 1-27 and 30 are examined herein. The restriction requirement mailed 06/02/2026 is still deemed proper. Applicant elected the invention of Group I, a DNA construct, vector, device and composition (claims 1-27 and 30), without traverse in the response filed 06/04/2026. . Election/Restrictions Applicant's election without traverse of the invention of Group I, a DNA construct, vector, device and composition in the reply filed on 06/04/2026 is acknowledged. It is noted that, on further consideration, claim 30 more properly belongs in Group II, because it is a composition produced by the method of claim 28 and depends from claim 28. Claims 28-30 are therefore withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: Determining the scope and contents of the prior art. Ascertaining the differences between the prior art and the claims at issue. Resolving the level of ordinary skill in the pertinent art. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-2, 7-16, 18 and 21-26 are rejected under 35 U.S.C. 103 as being unpatentable over U.S. PGPUB 2021/0011029 A1 to Cuero (hereinafter ‘Cuero’) in view of Yang (Yang et al. Lipid metabolism and storage in neuroglia: role in brain development and neurodegenerative diseases. Cell & Bioscience (2022) 12:106.) and Lockridge (Lockridge et al. A nexus of lipid and O-Glcnac metabolism in physiology and disease. Front. Endocrinol. (2022) 13:943576.). Regarding claim 1, Cuero teaches DNA constructs comprising genes for expressing amyloid precursor protein and TonB, which increase the production of the two proteins while also reducing costs, making them more widely accessible for medical research purposes (Abstract). Cuero also teaches that both B-amyloid and tau form the plaques and tangles in the brains of Alzheimer’s patients (para [0004]). Cuero does not teach that the construct also comprises genes for MAPT, adipose triglyceride lipase, an acyl-CoA dehydrogenase, and an OGlcNAcase. Yang teaches that lipid metabolism and storage has a role in neurodegenerative diseases, such as Alzheimer’s (Abstract, p. 2/16 left 2nd para, p. 10/16 § Lipid accumulation in some common neurodegenerative diseases, 1st para). Yang further notes that, “Disruption of lipid metabolism and energy homeostasis are prevalent in neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS)…In addition, LDs are thought to be the initial sites of α-synuclein aggregation in patients with Alzheimer’s disease (AD) and Parkinson’s disease (PD)”. Yang also describes how, “ATGL is the rate-limiting enzyme for LD-associated triglyceride hydrolysis, and activation of ATGL is the first step of lipolytic hydrolysis.”(p. 5/16 last para). Lastly, Yang indicates that there was a need in the art for further study of the role of lipid droplets in neurodegenerative disease, noting, “factors in the brain resulting in lipid accumulation and storage on neurodegenerative pathologies has received growing attention. Despite a growing number of studies describing the potential link between glial cell lipid metabolism and storage on brain development and neurodegeneration, many fundamental questions remain unresolved.” (p. 12/16). In summary, Yang teaches that lipid metabolism and storage (in lipid droplets) are strongly linked to neurodegenerative disease, particularly in regards to mitochondrial lipid metabolism; that further research into the association is required; and that ATGL is a rate-limiting enzyme for lipid-droplet-associated lipolysis. Yang does not teach the association of acyl-CoA dehydrogenase and OGlcNAcase with lipid metabolism and neurodegenerative disease. Lockridge teaches that the O-linked B-N-acetylglucosamine (O-GlcNAc) regulatory system “interacts extensively with lipids and is required to main lipid homeostasis” (Abstract). Lockridge further states, “The adipocyte O-GlcNAc regulatory system influences LD FFA storage and release through effects on PLIN1. Yang et al. have shown that OGT and PKA compete for two of the same PLIN1 target sites, S517 and S492, with opposing effects on the stimulated activation of lipolysis (16). Accordingly, adipocyte OGT loss (Adipoq-CreER) increases the interaction between CGI-58 and ATGL on the LD surface and enhances both fasting and b-adrenergic stimulated lipolysis” (p. 17). Lockridge further discloses that, “lipid influence over the O-GlcNAc regulatory system arises from the use of acetyl-CoA, derived from fatty acid oxidation (FAO)”. Lastly, Lockridge teaches that, “a shortened version of OGA (sOGA)…shows selective localization to LDs and mitochondria, where lipid metabolic processes are highly active” (p. 07). As evidenced by Swigoňová, “The acyl-CoA dehydrogenases are mitochondrial flavoenzymes involved in fatty acid and amino acid catabolism. The degradation of fatty acids, also known as β-oxidation, is a spiral reaction of four enzymatic steps that takes place in mitochondria and peroxisomes. The first and rate-limiting step is the desaturation of the acyl-CoA esters that is catalyzed by enzymes from two protein families, the acyl-CoA dehydrogenases (ACADs) and the acyl-CoA oxidases (ACOXs).” (pp. 1-2) (Swigoňová et al. Acyl-CoA Dehydrogenases: Dynamic History of Protein Family Evolution). In summary, Lockridge teaches that the O-GlcNAc regulatory system is a nexus of lipid homeostasis, and is involved in regulation of lipolysis via ATGL as well as influenced by acetyl-CoA derived from fatty acid oxidation. As evidenced by Swigoňová, acetyl-CoA dehydrogenases are key enzymes in the mitochondrial fatty acid oxidation process. It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the DNA construct for studying protein interactions in Alzheimer’s and other neurodegenerative diseases, as taught by Cuero, to further comprise genes encoding MAPT, adipose triglyceride lipase, an acyl-CoA dehydrogenase, and an OGlcNAcase, as taught by the combination of Yang and Lockridge and evidenced by Swigoňová. The ordinary artisan would have been motivated to design a DNA construct comprising genes relevant to Alzheimer’s disease pathogenesis based on Cuero’s teachings that such constructs were useful for studying protein interactions involved in the process. Based on Yang’s teachings that dysregulation of lipid metabolism is a significant but understudied component of the development of neurodegenerative disease, combined with Yang’s, Lockridge’s and Swigoňová’s teachings that OGA, acetyl-CoA dehydrogenases, and ATGL are key proteins involved in mitochondrial lipid metabolism. The ordinary artisan would further have been motivated to focus on, in addition to the major plaque-forming B-amyloid and tau (MAPT) proteins, key proteins involved in mitochondrial lipid metabolism, such as those taught by Yang, Lockridge and Swigoňová. The ordinary artisan would have had a reasonable expectation of designing a DNA construct capable of expressing those genes based on Cuero’s teachings of how to make and use such a construct. Regarding claim 2, Cuero teaches SEQ ID NO: 3, which is a gene encoding an amyloid precursor protein and has a sequence with 100% identity to SEQ ID NO: 1, as shown in the alignment below: RESULT 2 US-16-903-995-3 Sequence 3, US/16903995 Publication No. US20210011029A1 GENERAL INFORMATION APPLICANT: Bio Capital Holdings, LLC TITLE OF INVENTION: Biological Devices and Methods of Use Thereof TITLE OF INVENTION: for the Detection of Amyloid Proteins FILE REFERENCE: 930201-1090 CURRENT APPLICATION NUMBER: US/16/903,995 CURRENT FILING DATE: 2020-06-17 NUMBER OF SEQ ID NOS: 11 SEQ ID NO 3 LENGTH: 2102 TYPE: DNA ORGANISM: Homo sapiens Query Match 100.0%; Score 2088; Length 2102; Best Local Similarity 100.0%; Matches 2088; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGCTGCCCGGTTTGGCACTGCTCCTGCTGGCCGCCTGGACGGCTCGGGCGCTGGAGGTA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7 ATGCTGCCCGGTTTGGCACTGCTCCTGCTGGCCGCCTGGACGGCTCGGGCGCTGGAGGTA 66 Qy 61 CCCACTGATGGTAATGCTGGCCTGCTGGCTGAACCCCAGATTGCCATGTTCTGTGGCAGA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 67 CCCACTGATGGTAATGCTGGCCTGCTGGCTGAACCCCAGATTGCCATGTTCTGTGGCAGA 126 Qy 121 CTGAACATGCACATGAATGTCCAGAATGGGAAGTGGGATTCAGATCCATCAGGGACCAAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 127 CTGAACATGCACATGAATGTCCAGAATGGGAAGTGGGATTCAGATCCATCAGGGACCAAA 186 Qy 181 ACCTGCATTGATACCAAGGAAGGCATCCTGCAGTATTGCCAAGAAGTCTACCCTGAACTG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 187 ACCTGCATTGATACCAAGGAAGGCATCCTGCAGTATTGCCAAGAAGTCTACCCTGAACTG 246 Qy 241 CAGATCACCAATGTGGTAGAAGCCAACCAACCAGTGACCATCCAGAACTGGTGCAAGCGG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 247 CAGATCACCAATGTGGTAGAAGCCAACCAACCAGTGACCATCCAGAACTGGTGCAAGCGG 306 Qy 301 GGCCGCAAGCAGTGCAAGACCCATCCCCACTTTGTGATTCCCTACCGCTGCTTAGTTGGT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 307 GGCCGCAAGCAGTGCAAGACCCATCCCCACTTTGTGATTCCCTACCGCTGCTTAGTTGGT 366 Qy 361 GAGTTTGTAAGTGATGCCCTTCTCGTTCCTGACAAGTGCAAATTCTTACACCAGGAGAGG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 367 GAGTTTGTAAGTGATGCCCTTCTCGTTCCTGACAAGTGCAAATTCTTACACCAGGAGAGG 426 Qy 421 ATGGATGTTTGCGAAACTCATCTTCACTGGCACACCGTCGCCAAAGAGACATGCAGTGAG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 427 ATGGATGTTTGCGAAACTCATCTTCACTGGCACACCGTCGCCAAAGAGACATGCAGTGAG 486 Qy 481 AAGAGTACCAACTTGCATGACTACGGCATGTTGCTGCCCTGCGGAATTGACAAGTTCCGA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 487 AAGAGTACCAACTTGCATGACTACGGCATGTTGCTGCCCTGCGGAATTGACAAGTTCCGA 546 Qy 541 GGGGTAGAGTTTGTGTGTTGCCCACTGGCTGAAGAAAGTGACAATGTGGATTCTGCTGAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 547 GGGGTAGAGTTTGTGTGTTGCCCACTGGCTGAAGAAAGTGACAATGTGGATTCTGCTGAT 606 Qy 601 GCGGAGGAGGATGACTCGGATGTCTGGTGGGGCGGAGCAGACACAGACTATGCAGATGGG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 607 GCGGAGGAGGATGACTCGGATGTCTGGTGGGGCGGAGCAGACACAGACTATGCAGATGGG 666 Qy 661 AGTGAAGACAAAGTAGTAGAAGTAGCAGAGGAGGAAGAAGTGGCTGAGGTGGAAGAAGAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 667 AGTGAAGACAAAGTAGTAGAAGTAGCAGAGGAGGAAGAAGTGGCTGAGGTGGAAGAAGAA 726 Qy 721 GAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 727 GAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAA 786 Qy 781 CCCTACGAAGAAGCCACAGAGAGAACCACCAGCATTGCCACCACCACCACCACCACCACA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 787 CCCTACGAAGAAGCCACAGAGAGAACCACCAGCATTGCCACCACCACCACCACCACCACA 846 Qy 841 GAGTCTGTGGAAGAGGTGGTTCGAGTTCCTACAACAGCAGCCAGTACCCCTGATGCCGTT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 847 GAGTCTGTGGAAGAGGTGGTTCGAGTTCCTACAACAGCAGCCAGTACCCCTGATGCCGTT 906 Qy 901 GACAAGTATCTCGAGACACCTGGGGATGAGAATGAACATGCCCATTTCCAGAAAGCCAAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 907 GACAAGTATCTCGAGACACCTGGGGATGAGAATGAACATGCCCATTTCCAGAAAGCCAAA 966 Qy 961 GAGAGGCTTGAGGCCAAGCACCGAGAGAGAATGTCCCAGGTCATGAGAGAATGGGAAGAG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 967 GAGAGGCTTGAGGCCAAGCACCGAGAGAGAATGTCCCAGGTCATGAGAGAATGGGAAGAG 1026 Qy 1021 GCAGAACGTCAAGCAAAGAACTTGCCTAAAGCTGATAAGAAGGCAGTTATCCAGCATTTC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1027 GCAGAACGTCAAGCAAAGAACTTGCCTAAAGCTGATAAGAAGGCAGTTATCCAGCATTTC 1086 Qy 1081 CAGGAGAAAGTGGAATCTTTGGAACAGGAAGCAGCCAACGAGAGACAGCAGCTGGTGGAG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1087 CAGGAGAAAGTGGAATCTTTGGAACAGGAAGCAGCCAACGAGAGACAGCAGCTGGTGGAG 1146 Qy 1141 ACACACATGGCCAGAGTGGAAGCCATGCTCAATGACCGCCGCCGCCTGGCCCTGGAGAAC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1147 ACACACATGGCCAGAGTGGAAGCCATGCTCAATGACCGCCGCCGCCTGGCCCTGGAGAAC 1206 Qy 1201 TACATCACCGCTCTGCAGGCTGTTCCTCCTCGGCCTCGTCACGTGTTCAATATGCTAAAG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1207 TACATCACCGCTCTGCAGGCTGTTCCTCCTCGGCCTCGTCACGTGTTCAATATGCTAAAG 1266 Qy 1261 AAGTATGTCCGCGCAGAACAGAAGGACAGACAGCACACCCTAAAGCATTTCGAGCATGTG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1267 AAGTATGTCCGCGCAGAACAGAAGGACAGACAGCACACCCTAAAGCATTTCGAGCATGTG 1326 Qy 1321 CGCATGGTGGATCCCAAGAAAGCCGCTCAGATCCGGTCCCAGGTTATGACACACCTCCGT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1327 CGCATGGTGGATCCCAAGAAAGCCGCTCAGATCCGGTCCCAGGTTATGACACACCTCCGT 1386 Qy 1381 GTGATTTATGAGCGCATGAATCAGTCTCTCTCCCTGCTCTACAACGTGCCTGCAGTGGCC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1387 GTGATTTATGAGCGCATGAATCAGTCTCTCTCCCTGCTCTACAACGTGCCTGCAGTGGCC 1446 Qy 1441 GAGGAGATTCAGGATGAAGTTGATGAGCTGCTTCAGAAAGAGCAAAACTATTCAGATGAC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1447 GAGGAGATTCAGGATGAAGTTGATGAGCTGCTTCAGAAAGAGCAAAACTATTCAGATGAC 1506 Qy 1501 GTCTTGGCCAACATGATTAGTGAACCAAGGATCAGTTACGGAAACGATGCTCTCATGCCA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1507 GTCTTGGCCAACATGATTAGTGAACCAAGGATCAGTTACGGAAACGATGCTCTCATGCCA 1566 Qy 1561 TCTTTGACCGAAACGAAAACCACCGTGGAGCTCCTTCCCGTGAATGGAGAGTTCAGCCTG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1567 TCTTTGACCGAAACGAAAACCACCGTGGAGCTCCTTCCCGTGAATGGAGAGTTCAGCCTG 1626 Qy 1621 GACGATCTCCAGCCGTGGCATTCTTTTGGGGCTGACTCTGTGCCAGCCAACACAGAAAAC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1627 GACGATCTCCAGCCGTGGCATTCTTTTGGGGCTGACTCTGTGCCAGCCAACACAGAAAAC 1686 Qy 1681 GAAGTTGAGCCTGTTGATGCCCGCCCTGCTGCCGACCGAGGACTGACCACTCGACCAGGT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1687 GAAGTTGAGCCTGTTGATGCCCGCCCTGCTGCCGACCGAGGACTGACCACTCGACCAGGT 1746 Qy 1741 TCTGGGTTGACAAATATCAAGACGGAGGAGATCTCTGAAGTGAAGATGGATGCAGAATTC 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1747 TCTGGGTTGACAAATATCAAGACGGAGGAGATCTCTGAAGTGAAGATGGATGCAGAATTC 1806 Qy 1801 CGACATGACTCAGGATATGAAGTTCATCATCAAAAATTGGTGTTCTTTGCAGAAGATGTG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1807 CGACATGACTCAGGATATGAAGTTCATCATCAAAAATTGGTGTTCTTTGCAGAAGATGTG 1866 Qy 1861 GGTTCAAACAAAGGTGCAATCATTGGACTCATGGTGGGCGGTGTTGTCATAGCGACAGTG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1867 GGTTCAAACAAAGGTGCAATCATTGGACTCATGGTGGGCGGTGTTGTCATAGCGACAGTG 1926 Qy 1921 ATCGTCATCACCTTGGTGATGCTGAAGAAGAAACAGTACACATCCATTCATCATGGTGTG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1927 ATCGTCATCACCTTGGTGATGCTGAAGAAGAAACAGTACACATCCATTCATCATGGTGTG 1986 Qy 1981 GTGGAGGTTGACGCCGCTGTCACCCCAGAGGAGCGCCACCTGTCCAAGATGCAGCAGAAC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1987 GTGGAGGTTGACGCCGCTGTCACCCCAGAGGAGCGCCACCTGTCCAAGATGCAGCAGAAC 2046 Qy 2041 GGCTACGAAAATCCAACCTACAAGTTCTTTGAGCAGATGCAGAACTGA 2088 |||||||||||||||||||||||||||||||||||||||||||||||| Db 2047 GGCTACGAAAATCCAACCTACAAGTTCTTTGAGCAGATGCAGAACTGA 2094 Regarding claims 7-9, Cuero teaches wherein the construct further comprises at least one promoter, which is a GAL1 promoter, and it is positioned before the gene that encodes the amyloid precursor protein (para [0098]). Regarding claims 10-11, Cuero teaches wherein the DNA construct further comprises at least one terminator which is a CYC1 terminator (para [0098]). Regarding claims 12-14, Cuero teaches wherein the DNA construct further comprises a green fluorescent reporter protein (para [0098]). Regarding claim 15 Cuero teaches wherein the green fluorescent protein has SEQ ID NO: 9 (para [0151]), which has 100% homology to SEQ ID NO. 6: PNG media_image1.png 980 562 media_image1.png Greyscale Regarding claims 16 and 18, Cuero does not teach wherein the construct comprises the genes and regulatory elements in the particular orders recited in the claims. However, in para [0151], Cuero does teach that the genes in the DNA construct may be arranged in a variety of orders. It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have tried arranging the parts of the construct (i.e., the order of genes) in various orders to determine the optimal order. Given five genes, there was a finite number of identified, predictable solutions, and, based on Cuero’s disclosures, it would have been within the grasp of the ordinary artisan to try the various possible rearrangements. Regarding claims 21-24, Cuero teaches pYES2 plasmid vector comprising the DNA construct (para [0076]). Regarding claim 25, Cuero teaches a biological device comprising host cells transformed with the DNA construct ([0109]). Regarding claims 26-27, Cuero teaches wherein the host cells comprise fungi (S. cerevisiae) or bacteria (E. coli) (para [0115]). Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Cuero, Yang and Lockridge as applied to claims 1-2, 7-16, 18 and 21-26, further in view of U.S. PGPUB US20040194158 A1 to Botas (hereinafter ‘Botas’). Cuero, Yang and Lockridge render obvious the DNA construct of claim 1, from which the instantly rejected claim depends, as described above. Cuero, Yang and Lockridge do not teach wherein the gene that encodes MAPT has SEQ ID NO. 2 or at least 70% homology thereto. Botas teaches a nucleotide encoding a MAPT gene sequence for modeling neurogenerative disorders, SEQ ID NO: 4, which has 75.3 identity to SEQ ID NO: 2 (results available in SCV). It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the DNA construct comprising a generic MAPT gene as taught by Cuero, Yang and Lockridge to comprise the specific MAPT sequence as taught by Botas, to achieve the predictable outcome of a coding sequence capable of expressing MAPT in a model for neurodegenerative disorders. Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Cuero, Yang and Lockridge as applied to claims 1-2, 7-16, 18 and 21-26, further in view of GenBank Accession No. AY894804.1. Cuero, Yang and Lockridge render obvious the DNA construct of claim 1, from which the instantly rejected claim depends, as described above. Cuero, Yang and Lockridge do not teach wherein the gene that encodes adipose triglyceride lipase has SEQ ID NO. 3 or at least 70% homology thereto. GenBank Accession No. AY894804.1 teaches the nucleotide sequence of the human adipose triglyceride lipase (ATGL) mRNA, which has 71% homology to SEQ ID NO: 3 (results available in SCV). It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the DNA construct comprising a generic ATGL gene as taught by Cuero, Yang and Lockridge to comprise the specific ATGL sequence as taught by GenBank Accession No. AY894804.1, to achieve the predictable outcome of a coding sequence capable of expressing ATGL. Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Cuero, Yang and Lockridge as applied to claims 1-2, 7-16, 18 and 21-26, further in view of GenBank: Accession No. AK312629.1. Cuero, Yang and Lockridge render obvious the DNA construct of claim 1, from which the instantly rejected claim depends, as described above. Cuero, Yang and Lockridge do not teach wherein the gene that encodes the acyl-CoA dehydrogenase has SEQ ID NO. 4 or at least 70% homology thereto. GenBank: Accession No. AK312629.1 teaches the nucleotide sequence of human acyl-CoA dehydrogenase, which has 78.5% homoloy to SEQ ID NO: 4. It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the DNA construct comprising a generic acetyl-CoA dehydrogenase gene as taught by Cuero, Yang and Lockridge to comprise the specific acetyl-CoA dehydrogenase sequence as taught by GenBank: Accession No. AK312629.1, to achieve the predictable outcome of a coding sequence capable of expressing acetyl-CoA dehydrogenase. Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Cuero, Yang and Lockridge as applied to claims 1-2, 7-16, 18 and 21-26, further in view of U.S. PGPUB 20210382063 A1 to Cuero (hereinafter ‘PGPUB ‘063’). Cuero, Yang and Lockridge render obvious the DNA construct of claim 1, from which the instantly rejected claim depends, as described above. Cuero, Yang and Lockridge do not teach wherein the gene that encodes the OGlcNAcase has SEQ ID NO. 5 or at least 70% homology thereto. PGPUB ‘063 teaches SEQ ID NO: 3, a sequence encoding OGlcNA (a.k.a., OGlcNAcase; see para [0039]) in a biological device/DNA construct. It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the DNA construct comprising a generic OGlcNAcasee gene as taught by Cuero, Yang and Lockridge to comprise the specific OGlcNAcase sequence as taught by PGPUB ‘063, to achieve the predictable outcome of a coding sequence capable of expressing OGlcNAcase. Claims 17 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Cuero, Yang and Lockridge as applied to claims 1-2, 7-16, 18 and 21-26, further in view of U.S. PGPUB US20040194158, GenBank Accession No. AY894804.1, GenBank: Accession No. AK312629.1 and U.S. PGPUB 20210382063 A1. Cuero, Yang and Lockridge render obvious the DNA construct of claim 1, from which the instantly rejected claim depends, as described above. Cuero, Yang and Lockridge do not teach the specific sequences recited in claims 17 and 19. However, Cuero, Yang and Lockridge do render obvious the constructs of claims 16 and 18, as described above. U.S. PGPUB US20040194158, GenBank Accession No. AY894804.1, GenBank: Accession No. AK312629.1 and U.S. PGPUB 20210382063 A1 all, variously, teach the recited sequences, also as already described above in the rejections of claims 3-6. It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the DNA construct comprising the recited genetic components as taught by Cuero, Yang and Lockridge to comprise the specific gene sequences as taught by U.S. PGPUB US20040194158, GenBank Accession No. AY894804.1, GenBank: Accession No. AK312629.1 and U.S. PGPUB 20210382063 A1, to achieve the predictable outcome of a construct comprising genes capable of expressing the desired proteins. Conclusion No claim is allowed at this time. Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA M ZAHORIK whose telephone number is (703)756-1433. The examiner can normally be reached M-F 8:00-16:00 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMANDA M ZAHORIK/Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jan 08, 2025
Application Filed
Jul 14, 2026
Non-Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12674166
RNAI CONSTRUCTS FOR INHIBITING PNPLA3 EXPRESSION AND METHODS OF USE THEREOF
5y 0m to grant Granted Jul 07, 2026
Patent 12674167
APTAMER SPECIFICALLY BINDING TO CANCER STEM CELLS, AND USE THEREOF
4y 9m to grant Granted Jul 07, 2026
Patent 12668795
INHIBITOR OF MIR-129 AND USES THEREOF
4y 9m to grant Granted Jun 30, 2026
Patent 12667629
INCREASED PACKAGING EFFICIENCY OF VECTOR FOR CARDIAC GENE THERAPY
3y 0m to grant Granted Jun 30, 2026
Patent 12662508
COMPOUNDS AND METHODS FOR MODULATING ANGIOTENSINOGEN EXPRESSION
4y 0m to grant Granted Jun 23, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
56%
Grant Probability
99%
With Interview (+49.1%)
3y 7m (~2y 0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 71 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month