GENELIGHT CULTURES AND EXTRACTS AND APPLICATIONS THEREOF

DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicants’ arguments and amendments filed on June 5, 2026, have been received and entered. Claim 1 has been amended, while claims 19-22 have been canceled. Claims 1-18, 23-30 are pending in the instant application. Election/Restrictions Applicants’ election without traverse of claims 1-22 (group I) in the reply filed on June 26, 2026, was acknowledged. Claims 23-30 were withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on June 5, 2026. Claims 1-18 are under consideration. Claim Objections Claim 18 is objected to as being dependent upon a rejected base claim but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-3, 6-14 16, remain rejected under 35 U.S.C. 103 as being unpatentable over Rengifo (US 20220183301, 6/16/2022), Tan et al (Appl Environ Microbiol 2013;79(16):4838–4844) and Suzuki et al (Plant Science, 2006, 170, 5, 1010-1019). Claims are directed to a DNA construct comprising the following genetic components:(a) a gene that encodes a hydrogenase;(b) a gene that encodes a p-type ATPase;(c) a gene that encodes phosphoenol pyruvate carboxylase;(d) a gene that encodes phosphoenol pyruvate carboxykinase;(e) a gene that encodes tonB;(f) a gene that encodes a heat shock protein; and (g) a gene that encodes RuBisCO large subunit 1. Claim interpretation: Claims are interpreted to be a DNA construct comprising 7 different genes in any orientation with or without any regulatory sequence. Further, no expression or functional effect is required by DNA construct. With respect to claim 1-3, 6-10, Rengifo teaches a DNA construct comprising the following genetic components: (a) a gene that expresses a heat shock protein, (b) a gene that expresses RuBisCO large subunit 1, (c) a gene that expresses tonB, (d) a gene that expresses hydrogenase, and (e) a gene that expresses p-type ATPase (see para. 39-44 and claims in ‘301), wherein the DNA construct is contained within pYES2 plasmid (see para. 109-110). With respect to claim 2, Rengifo teaches gene that encodes the hydrogenase has SEQ ID NO: 4 that has 100% sequence homology to SEQ ID NOL 6 (see sequence search results , see below). Query Match 100.0%; Score 1557; Length 1580; Best Local Similarity 100.0%; Matches 1557; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGACTGAACTTGGTTCTGATACTTTGCCCTCTGTGGGCCAGTGGCAACAAATTCTGACT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 13 ATGACTGAACTTGGTTCTGATACTTTGCCCTCTGTGGGCCAGTGGCAACAAATTCTGACT 72 Qy 61 GCGCCACCCGTCTGGCAGGTCAAGGTGCAGACTGCATCCTGGACAAGTGCCGCGCTGGCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 73 GCGCCACCCGTCTGGCAGGTCAAGGTGCAGACTGCATCCTGGACAAGTGCCGCGCTGGCG 132 Qy 121 CTGCGCGATCAGGGCGGGCGTTTGCTGGGATTGTGGGGAGAGGCGGGCCATGAAAATGCA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 133 CTGCGCGATCAGGGCGGGCGTTTGCTGGGATTGTGGGGAGAGGCGGGCCATGAAAATGCA 192 Qy 181 TTTTTTTACATACATGCGCTGGGCCTTGGTTCAACCGGATATTTGTGGATCACTCTGACG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 193 TTTTTTTACATACATGCGCTGGGCCTTGGTTCAACCGGATATTTGTGGATCACTCTGACG 252 Qy 241 GTGCAATCCAGCGAGGGACAATTTCCCTCGCTGGCCGACATTTTTCCCGCTGCCTCGCGG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 253 GTGCAATCCAGCGAGGGACAATTTCCCTCGCTGGCCGACATTTTTCCCGCTGCCTCGCGG 312 Qy 301 ATGGAGCGGGCCCTGTACGATCTTACGGGAATCAGGGCGGCGGGGAATGCCGATACCCGG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 313 ATGGAGCGGGCCCTGTACGATCTTACGGGAATCAGGGCGGCGGGGAATGCCGATACCCGG 372 Qy 361 CCATGGCTCCGCCATCAGTGCTGGCCAGCGGGGATTTTTCCACTGCGGGAGGGACAACTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 373 CCATGGCTCCGCCATCAGTGCTGGCCAGCGGGGATTTTTCCACTGCGGGAGGGACAACTG 432 Qy 421 GATGGCAGTTCCTTCGGCGTGGATGGTGATGCCGATTATCCTTTTCAATTAATCGATAGC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 433 GATGGCAGTTCCTTCGGCGTGGATGGTGATGCCGATTATCCTTTTCAATTAATCGATAGC 492 Qy 481 GTGGATGTCCACCAGATTCCAGTGGGACCGGTACACGCGGGCACCATTGAGCCCGGACAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 493 GTGGATGTCCACCAGATTCCAGTGGGACCGGTACACGCGGGCACCATTGAGCCCGGACAC 552 Qy 541 TTTCGTTTTTCGTGTGTCGGTGAACAAATTCTGCGTCTGGAAGAACGATTGGGATACACC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 553 TTTCGTTTTTCGTGTGTCGGTGAACAAATTCTGCGTCTGGAAGAACGATTGGGATACACC 612 Qy 601 CACAAGGGCGTCGAACGCCTTTTCCAAGATCGGGATGTGTTTGCGGGTGCGCGTCTGGCA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 613 CACAAGGGCGTCGAACGCCTTTTCCAAGATCGGGATGTGTTTGCGGGTGCGCGTCTGGCA 672 Qy 661 GGACGCATCAGTGGTGACACTACAGCGGGTTATGCCTGGGCCTACAGCATGGCGGTGGAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 673 GGACGCATCAGTGGTGACACTACAGCGGGTTATGCCTGGGCCTACAGCATGGCGGTGGAA 732 Qy 721 TCCATTGCCCGATGCGAAATCCCGCCTCGTGCAGCCGCTTTGCGTGCTGTTTGCCTGGAA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 733 TCCATTGCCCGATGCGAAATCCCGCCTCGTGCAGCCGCTTTGCGTGCTGTTTGCCTGGAA 792 Qy 781 CGGGAGCGCATGGCCAACCATCTGGGTGATCTTGCCGCTCTGGGGAATGACGCTGGCTTC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 793 CGGGAGCGCATGGCCAACCATCTGGGTGATCTTGCCGCTCTGGGGAATGACGCTGGCTTC 852 Qy 841 GCCTTCTGTCAGTCACAATTCCTGTTCATCAAGGAAAGCCTGCTGCGCGAAAACCAGGAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 853 GCCTTCTGTCAGTCACAATTCCTGTTCATCAAGGAAAGCCTGCTGCGCGAAAACCAGGAA 912 Qy 901 ATTTTCGGACACCGCTATTTGATGGACTGCATTATTCCCGGTGGTGTAGCTTTTGATCTG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 913 ATTTTCGGACACCGCTATTTGATGGACTGCATTATTCCCGGTGGTGTAGCTTTTGATCTG 972 Qy 961 AACTCCGCGCAAACAGCCGCGATTCAGCGTAACAGTGAATCCTGGCAGCGCACCGTGCAG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 973 AACTCCGCGCAAACAGCCGCGATTCAGCGTAACAGTGAATCCTGGCAGCGCACCGTGCAG 1032 Qy 1021 CGTTTGGACCTCCTCTTGCAGGAGCACTCCGGTCTGCGGGATCGTCTGGTGGGTACAGGA 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1033 CGTTTGGACCTCCTCTTGCAGGAGCACTCCGGTCTGCGGGATCGTCTGGTGGGTACAGGA 1092 Qy 1081 AAAATTGTGCCACCCCGTGCTGCAGCACTCGGTATGGCGGGGCTTGCCGGCCGCGCCAGT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1093 AAAATTGTGCCACCCCGTGCTGCAGCACTCGGTATGGCGGGGCTTGCCGGCCGCGCCAGT 1152 Qy 1141 GGTCAGGCCTGGGATTTGCGGGTCCAGTTTCCCCATGCACCTTATCAGAATCTGGATGTT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1153 GGTCAGGCCTGGGATTTGCGGGTCCAGTTTCCCCATGCACCTTATCAGAATCTGGATGTT 1212 Qy 1201 TCCATGCAGCTTTCCCCGGAAGGTGACGTGGCCGCACGCTGGCAATTGCGCTTTCGGGAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1213 TCCATGCAGCTTTCCCCGGAAGGTGACGTGGCCGCACGCTGGCAATTGCGCTTTCGGGAA 1272 Qy 1261 TTCTATGAGTCTCTGCGTCTGCAGACCCAGTTGCTGTTGGATCTACCCAGTGGAGATGTC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1273 TTCTATGAGTCTCTGCGTCTGCAGACCCAGTTGCTGTTGGATCTACCCAGTGGAGATGTC 1332 Qy 1321 AGCGCAACCATTCCGGAAAGCATCCCCGATGGCGAAGGCTTGGGCATTGTCGAAGCATGG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1333 AGCGCAACCATTCCGGAAAGCATCCCCGATGGCGAAGGCTTGGGCATTGTCGAAGCATGG 1392 Qy 1381 CGCGGCGAGGTCTTTGTCGCCCTATCTGTGGAAAACGCCCGTATTAAACGCTGCCATCCC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1393 CGCGGCGAGGTCTTTGTCGCCCTATCTGTGGAAAACGCCCGTATTAAACGCTGCCATCCC 1452 Qy 1441 CACGATCCCTCGTGGACCCTCTGGCCGGTCCTTGAGGAGGCCGTGCTGAACGATATTGTT 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1453 CACGATCCCTCGTGGACCCTCTGGCCGGTCCTTGAGGAGGCCGTGCTGAACGATATTGTT 1512 Qy 1501 GCCGACTTTCCGCTGATCAATAAATCGTTCAATTTGAGTTACAGCGGACATGATTTA 1557 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1513 GCCGACTTTCCGCTGATCAATAAATCGTTCAATTTGAGTTACAGCGGACATGATTTA 1569 Regarding claim 3, Rengifo teaches gene that encodes the p-type ATPase has SEQ ID NO: 5 that has 100% sequence homology to SEQ ID NOL 7 (see sequence search result and below). Query Match 100.0%; Score 2199; Length 2219; Best Local Similarity 100.0%; Matches 2199; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGTCGACTCCTGACAATCACGGCAAGAAAGCCCCTCAATTTGCTGCGTTCAAACCGCTA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 12 ATGTCGACTCCTGACAATCACGGCAAGAAAGCCCCTCAATTTGCTGCGTTCAAACCGCTA 71 Qy 61 ACCACGGTACAGAACGCCAACGACTGTTGCTGCGACGGCGCATGTTCCAGCACGCCAACT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 72 ACCACGGTACAGAACGCCAACGACTGTTGCTGCGACGGCGCATGTTCCAGCACGCCAACT 131 Qy 121 CTCTCTGAAAACGTCTCCGGCACCCGCTATAGCTGGAAAGTCAGCGGCATGGACTGCGCC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 132 CTCTCTGAAAACGTCTCCGGCACCCGCTATAGCTGGAAAGTCAGCGGCATGGACTGCGCC 191 Qy 181 GCCTGTGCGCGCAAGGTAGAAAATGCCGTGCGCCAGCTTGCAGGCGTGAATCAGGTGCAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 192 GCCTGTGCGCGCAAGGTAGAAAATGCCGTGCGCCAGCTTGCAGGCGTGAATCAGGTGCAG 251 Qy 241 GTGTTGTTCGCCACCGAAAAACTGGTGGTCGATGCCGACAATGACATTCGTGCACAAGTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 252 GTGTTGTTCGCCACCGAAAAACTGGTGGTCGATGCCGACAATGACATTCGTGCACAAGTT 311 Qy 301 GAATCTGCGCTGCAAAAAGCAGGCTATTCCCTGCGCGATGAACAGGCCGCCGAAGAACCG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 312 GAATCTGCGCTGCAAAAAGCAGGCTATTCCCTGCGCGATGAACAGGCCGCCGAAGAACCG 371 Qy 361 CAAGCATCACGCCTGAAAGAGAATCTGCCGCTGATTACGCTAATCGTGATGATGGCAATC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 372 CAAGCATCACGCCTGAAAGAGAATCTGCCGCTGATTACGCTAATCGTGATGATGGCAATC 431 Qy 421 AGCTGGGGTCTGGAGCAGTTCAATCATCCGTTCGGGCAACTGGCGTTTATCGCGACCACG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 432 AGCTGGGGTCTGGAGCAGTTCAATCATCCGTTCGGGCAACTGGCGTTTATCGCGACCACG 491 Qy 481 CTGGTTGGGCTGTACCCGATTGCTCGTCAGGCATTACGGTTGATCAAATCCGGCAGCTAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 492 CTGGTTGGGCTGTACCCGATTGCTCGTCAGGCATTACGGTTGATCAAATCCGGCAGCTAC 551 Qy 541 TTCGCCATTGAAACCTTAATGAGCGTAGCCGCTATTGGTGCACTGTTTATTGGCGCAACG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 552 TTCGCCATTGAAACCTTAATGAGCGTAGCCGCTATTGGTGCACTGTTTATTGGCGCAACG 611 Qy 601 GCTGAAGCTGCGATGGTGTTGCTGCTGTTTTTGATTGGTGAACGACTGGAAGGCTGGGCC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 612 GCTGAAGCTGCGATGGTGTTGCTGCTGTTTTTGATTGGTGAACGACTGGAAGGCTGGGCC 671 Qy 661 GCCAGCCGCGCGCGTCAGGGCGTTAGCGCGTTAATGGCGCTGAAACCAGAAACCGCCACG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 672 GCCAGCCGCGCGCGTCAGGGCGTTAGCGCGTTAATGGCGCTGAAACCAGAAACCGCCACG 731 Qy 721 CGCCTGCGTAAGGGTGAGCGGGAAGAGGTGGCGATTAACAGCCTGCGCCCTGGCGATGTG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 732 CGCCTGCGTAAGGGTGAGCGGGAAGAGGTGGCGATTAACAGCCTGCGCCCTGGCGATGTG 791 Qy 781 ATTGAAGTCGCCGCAGGTGGGCGTTTGCCTGCCGACGGTAAACTGCTCTCACCGTTTGCC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 792 ATTGAAGTCGCCGCAGGTGGGCGTTTGCCTGCCGACGGTAAACTGCTCTCACCGTTTGCC 851 Qy 841 AGTTTTGATGAAAGCGCCCTGACCGGCGAATCCATTCCGGTGGAGCGCGCAACGGGCGAT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 852 AGTTTTGATGAAAGCGCCCTGACCGGCGAATCCATTCCGGTGGAGCGCGCAACGGGCGAT 911 Qy 901 AAAGTCCCTGCTGGTGCCACCAGCGTAGACCGTCTGGTGACGTTGGAAGTGCTGTCAGAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 912 AAAGTCCCTGCTGGTGCCACCAGCGTAGACCGTCTGGTGACGTTGGAAGTGCTGTCAGAA 971 Qy 961 CCGGGAGCCAGCGCCATTGACCGGATTCTGAAACTGATCGAAGAAGCCGAAGAGCGTCGC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 972 CCGGGAGCCAGCGCCATTGACCGGATTCTGAAACTGATCGAAGAAGCCGAAGAGCGTCGC 1031 Qy 1021 GCTCCCATTGAGCGGTTTATCGACCGTTTCAGCCGTATCTATACGCCCGCGATTATGGCC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1032 GCTCCCATTGAGCGGTTTATCGACCGTTTCAGCCGTATCTATACGCCCGCGATTATGGCC 1091 Qy 1081 GTCGCTCTGCTGGTGACGCTGGTGCCACCGCTGCTGTTTGCCGCCAGCTGGCAGGAGTGG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1092 GTCGCTCTGCTGGTGACGCTGGTGCCACCGCTGCTGTTTGCCGCCAGCTGGCAGGAGTGG 1151 Qy 1141 ATTTATAAAGGGCTGACGCTGCTGCTGATTGGCTGCCCGTGTGCGTTAGTTATCTCAACG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1152 ATTTATAAAGGGCTGACGCTGCTGCTGATTGGCTGCCCGTGTGCGTTAGTTATCTCAACG 1211 Qy 1201 CCTGCGGCGATTACCTCCGGGCTGGCGGCGGCAGCGCGTCGTGGGGCGTTGATTAAAGGC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1212 CCTGCGGCGATTACCTCCGGGCTGGCGGCGGCAGCGCGTCGTGGGGCGTTGATTAAAGGC 1271 Qy 1261 GGAGCGGCGCTGGAACAGCTGGGTCGTGTTACTCAGGTGGCGTTTGATAAAACCGGTACG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1272 GGAGCGGCGCTGGAACAGCTGGGTCGTGTTACTCAGGTGGCGTTTGATAAAACCGGTACG 1331 Qy 1321 CTGACCGTCGGTAAACCGCGCGTTACCGCGATTCATCCGGCAACGGGTATTAGTGAATCT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1332 CTGACCGTCGGTAAACCGCGCGTTACCGCGATTCATCCGGCAACGGGTATTAGTGAATCT 1391 Qy 1381 GAACTGCTGACACTGGCGGCGGCGGTCGAGCAAGGCGCGACGCATCCACTGGCGCAAGCC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1392 GAACTGCTGACACTGGCGGCGGCGGTCGAGCAAGGCGCGACGCATCCACTGGCGCAAGCC 1451 Qy 1441 ATCGTACGCGAAGCACAGGTTGCTGAACTCGCCATTCCCACCGCCGAATCACAGCGGGCG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1452 ATCGTACGCGAAGCACAGGTTGCTGAACTCGCCATTCCCACCGCCGAATCACAGCGGGCG 1511 Qy 1501 CTGGTCGGGTCTGGCATTGAAGCGCAGGTTAACGGTGAGCGCGTATTGATTTGCGCTGCC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1512 CTGGTCGGGTCTGGCATTGAAGCGCAGGTTAACGGTGAGCGCGTATTGATTTGCGCTGCC 1571 Qy 1561 GGGAAACATCCCGCTGATGCATTTACTGGTTTAATTAACGAACTGGAAAGCGCCGGGCAA 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1572 GGGAAACATCCCGCTGATGCATTTACTGGTTTAATTAACGAACTGGAAAGCGCCGGGCAA 1631 Qy 1621 ACGGTAGTGCTGGTAGTACGTAACGATGACGTGCTTGGTGTCATTGCGTTACAGGATACC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1632 ACGGTAGTGCTGGTAGTACGTAACGATGACGTGCTTGGTGTCATTGCGTTACAGGATACC 1691 Qy 1681 CTGCGCGCCGATGCTGCAACTGCCATCAGTGAACTGAACGCGCTGGGCGTCAAAGGGGTG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1692 CTGCGCGCCGATGCTGCAACTGCCATCAGTGAACTGAACGCGCTGGGCGTCAAAGGGGTG 1751 Qy 1741 ATCCTCACCGGCGATAATCCACGCGCAGCGGCGGCAATTGCCGGGGAGCTGGGGCTGGAG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1752 ATCCTCACCGGCGATAATCCACGCGCAGCGGCGGCAATTGCCGGGGAGCTGGGGCTGGAG 1811 Qy 1801 TTTAAAGCGGGCCTGTTGCCGGAAGATAAAGTCAAAGCGGTGACCGAGCTGAATCAACAT 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1812 TTTAAAGCGGGCCTGTTGCCGGAAGATAAAGTCAAAGCGGTGACCGAGCTGAATCAACAT 1871 Qy 1861 GCGCCGCTGGCGATGGTCGGTGACGGTATTAACGACGCGCCAGCGATGAAAGCTGCCGCC 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1872 GCGCCGCTGGCGATGGTCGGTGACGGTATTAACGACGCGCCAGCGATGAAAGCTGCCGCC 1931 Qy 1921 ATCGGGATTGCAATGGGTAGCGGCACAGACGTGGCGCTGGAAACCGCCGACGCAGCATTA 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1932 ATCGGGATTGCAATGGGTAGCGGCACAGACGTGGCGCTGGAAACCGCCGACGCAGCATTA 1991 Qy 1981 ACCCATAACCACCTGCGCGGCCTGGTGCAAATGATTGAACTGGCACGCGCCACTCACGCC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1992 ACCCATAACCACCTGCGCGGCCTGGTGCAAATGATTGAACTGGCACGCGCCACTCACGCC 2051 Qy 2041 AATATCCGCCAGAACATCACTATTGCGCTGGGGCTGAAAGGGATCTTCCTCGTCACCACG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2052 AATATCCGCCAGAACATCACTATTGCGCTGGGGCTGAAAGGGATCTTCCTCGTCACCACG 2111 Qy 2101 CTGTTAGGGATGACCGGGTTGTGGCTGGCAGTGCTGGCAGATACGGGGGCGACGGTGCTG 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2112 CTGTTAGGGATGACCGGGTTGTGGCTGGCAGTGCTGGCAGATACGGGGGCGACGGTGCTG 2171 Qy 2161 GTGACAGCGAATGCGTTAAGATTGTTGCGCAGGAGATAA 2199 ||||||||||||||||||||||||||||||||||||||| Db 2172 GTGACAGCGAATGCGTTAAGATTGTTGCGCAGGAGATAA 2210 With respect to claim 6, Rengifo teaches gene that encodes the tonB has SEQ ID NO: 3 that has 100% sequence homology to SEQ ID NOL 3 (see sequence search result and below). Query Match 100.0%; Score 735; Length 741; Best Local Similarity 100.0%; Matches 735; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGACGAAAACGCGCTCGAACATGGCGCGCTACGGCACCAGCCTGGCCATCGTGCTGGGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7 ATGACGAAAACGCGCTCGAACATGGCGCGCTACGGCACCAGCCTGGCCATCGTGCTGGGC 66 Qy 61 GTGCACGTGGTCGCCGTGGTGCTGACGCTCAACTGGTCGGTGCCCCAGGCCATCGAGCTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 67 GTGCACGTGGTCGCCGTGGTGCTGACGCTCAACTGGTCGGTGCCCCAGGCCATCGAGCTG 126 Qy 121 CCGCCGGCAGCGATGATGGTCGAGTTGGCGCCGTTGCCGGAGCCCGCGCCACCGCCACCG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 127 CCGCCGGCAGCGATGATGGTCGAGTTGGCGCCGTTGCCGGAGCCCGCGCCACCGCCACCG 186 Qy 181 CCCAAGGCCGCGCCCAAGCCACCGGCAGAGGTCGAGGAGCCGCCGCTGCCCAAGCTGGTG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 187 CCCAAGGCCGCGCCCAAGCCACCGGCAGAGGTCGAGGAGCCGCCGCTGCCCAAGCTGGTG 246 Qy 241 GAGGCCCCCAAGCCGAAGATCGCCATCGCCAAGCCGCCCAAGCCCAAGGCCAAGCCGCAG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 247 GAGGCCCCCAAGCCGAAGATCGCCATCGCCAAGCCGCCCAAGCCCAAGGCCAAGCCGCAG 306 Qy 301 CCGCCCAAGCCTGAGAAAAAGCCTGAGCCGCCGAAGGACGAACCACCGGCCAAGGACGAT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 307 CCGCCCAAGCCTGAGAAAAAGCCTGAGCCGCCGAAGGACGAACCACCGGCCAAGGACGAT 366 Qy 361 GTGGCGGATACCCCGCCAAGCAACGCGCAGCCGCAGAAATCGGCCGCACCGGCACCGAGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 367 GTGGCGGATACCCCGCCAAGCAACGCGCAGCCGCAGAAATCGGCCGCACCGGCACCGAGC 426 Qy 421 ATCGCCTCCAACAGCAATGCCCTGCCCAGCTGGCAGAGCGACCTGCTGCGCCACCTGGCC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 427 ATCGCCTCCAACAGCAATGCCCTGCCCAGCTGGCAGAGCGACCTGCTGCGCCACCTGGCC 486 Qy 481 AAGTACAAGAAGTACCCGGAAGACGCTCGCCGTCGCGGCCTGCAGGGCATCAACCGCCTG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 487 AAGTACAAGAAGTACCCGGAAGACGCTCGCCGTCGCGGCCTGCAGGGCATCAACCGCCTG 546 Qy 541 CGCTTCGTGGTCGACGCCGAGGGCAAGGTAGTCTCGTACTCGCTGGCCGGAGGCTCGGGC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 547 CGCTTCGTGGTCGACGCCGAGGGCAAGGTAGTCTCGTACTCGCTGGCCGGAGGCTCGGGC 606 Qy 601 AGCGCGGCGCTGGACCGGGCGACCCTGGAAATGATCCGTCGCGCAGGCTCCGTACCGAAG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 607 AGCGCGGCGCTGGACCGGGCGACCCTGGAAATGATCCGTCGCGCAGGCTCCGTACCGAAG 666 Qy 661 CCGCCAGCGGAGCTGTTGAACAATGGCACGATCGAAGTCGTGGCGCCGTTCGTCTATTCC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 667 CCGCCAGCGGAGCTGTTGAACAATGGCACGATCGAAGTCGTGGCGCCGTTCGTCTATTCC 726 Qy 721 CTGGACCGACGCTAA 735 ||||||||||||||| Db 727 CTGGACCGACGCTAA 741 With respect to claim 7, Rengifo teaches that the construct comprises a gene that encodes the heat shock protein has SEQ ID NO: 10 that has 99.8% sequence homology to SEQ ID NO: 1 (see sequence search result and below). . Regarding claim 8, Rengifo teaches that the construct comprises gene that encodes the RuBisCO large subunit 1 has SEQ ID NO. 2 that has 100% sequence homology to SEQ ID NOL 2 (see sequence search result and below). Query Match 100.0%; Score 1467; Length 1491; Best Local Similarity 100.0%; Matches 1467; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGTCTCAATCCGTAGAATCACGGACTCGAATCAAAAACGAACGTTACGAATCAGGTGTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 13 ATGTCTCAATCCGTAGAATCACGGACTCGAATCAAAAACGAACGTTACGAATCAGGTGTT 72 Qy 61 ATCCCTTACGCAAAAATGGGATACTGGGATGCTGATTACGTTATCAAAGATACTGACGTA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 73 ATCCCTTACGCAAAAATGGGATACTGGGATGCTGATTACGTTATCAAAGATACTGACGTA 132 Qy 121 CTTGCAATGTTCCGTATGACACCTCAAAAAGGTGTTGACCCAGTTGAATGTGCAGCCGCA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 133 CTTGCAATGTTCCGTATGACACCTCAAAAAGGTGTTGACCCAGTTGAATGTGCAGCCGCA 192 Qy 181 ATCGCAGGTGAATCTTCAACAGCAACTTGGACAGTTGTATGGACAGACCTTCTAACAGCA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 193 ATCGCAGGTGAATCTTCAACAGCAACTTGGACAGTTGTATGGACAGACCTTCTAACAGCA 252 Qy 241 TGTGATCTTTACCGTGCAAAAGCATACCGTGTTGACCCAGTTCCTGGTGCAACTGATCAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 253 TGTGATCTTTACCGTGCAAAAGCATACCGTGTTGACCCAGTTCCTGGTGCAACTGATCAA 312 Qy 301 TACTTTGCTTACATCGCATACGAATTAGACCTATTTGAAGAAGGTTCTTTAGCTAACTTA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 313 TACTTTGCTTACATCGCATACGAATTAGACCTATTTGAAGAAGGTTCTTTAGCTAACTTA 372 Qy 361 ACAGCATCAATTATTGGTAACGTATTCGGATTCAAAGCGGTAAATGCTTTAAGATTAGAA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 373 ACAGCATCAATTATTGGTAACGTATTCGGATTCAAAGCGGTAAATGCTTTAAGATTAGAA 432 Qy 421 GATATGCGTCTTCCAATTGCATACCTAAAAACTTTCCAAGGTCCAGCAACTGGTGTAATT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 433 GATATGCGTCTTCCAATTGCATACCTAAAAACTTTCCAAGGTCCAGCAACTGGTGTAATT 492 Qy 481 GTAGAACGTGAAAGATTAGACAAATATGGTCGTCCTTTATTAGGTGCAACAGTTAAACCA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 493 GTAGAACGTGAAAGATTAGACAAATATGGTCGTCCTTTATTAGGTGCAACAGTTAAACCA 552 Qy 541 AAATTAGGTCTATCTGGTAAAAACTATGGTCGTGTAGTTTACGAAGGTCTTAAAGGTGGT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 553 AAATTAGGTCTATCTGGTAAAAACTATGGTCGTGTAGTTTACGAAGGTCTTAAAGGTGGT 612 Qy 601 CTAGATTTCCTTAAAGATGATGAAAACATTAACTCTCAACCATTCATGAGATGGAAAGAG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 613 CTAGATTTCCTTAAAGATGATGAAAACATTAACTCTCAACCATTCATGAGATGGAAAGAG 672 Qy 661 CGTTTCTTATTCGGTATCGAAGGTGTAAACCGTGCTGCTGCTGCTGCTGGTGAAGTAAAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 673 CGTTTCTTATTCGGTATCGAAGGTGTAAACCGTGCTGCTGCTGCTGCTGGTGAAGTAAAA 732 Qy 721 GGTCACTACTTCAACGTTACTGCTGGTACAATGGAAGATATGTATGAACGTGCTGAATTC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 733 GGTCACTACTTCAACGTTACTGCTGGTACAATGGAAGATATGTATGAACGTGCTGAATTC 792 Qy 781 TGTAAAGAAATCGGTAGTGTAATCTGTATGATCGACCTTGTAATCGGATATACTGCTATT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 793 TGTAAAGAAATCGGTAGTGTAATCTGTATGATCGACCTTGTAATCGGATATACTGCTATT 852 Qy 841 CAAAGTATGGCGATCTGGGCACGTAAAAACAGTATGATTCTTCACTTACACCGTGCTGGT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 853 CAAAGTATGGCGATCTGGGCACGTAAAAACAGTATGATTCTTCACTTACACCGTGCTGGT 912 Qy 901 AACTCTACATACTCACGTCAAAAAACACATGGTATGAACTTCCGTGTAATTTGTAAGTGG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 913 AACTCTACATACTCACGTCAAAAAACACATGGTATGAACTTCCGTGTAATTTGTAAGTGG 972 Qy 961 ATGCGTATGGCAGGTGTTGACCACATACACGCAGGTACAGTTGTAGGTAAACTAGAAGGG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 973 ATGCGTATGGCAGGTGTTGACCACATACACGCAGGTACAGTTGTAGGTAAACTAGAAGGG 1032 Qy 1021 GATCCTTTAATGGTTAAAGGTTTCTATAACACATTATTAGAAACACAAACAGATGTAAAT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1033 GATCCTTTAATGGTTAAAGGTTTCTATAACACATTATTAGAAACACAAACAGATGTAAAT 1092 Qy 1081 CTTGTACAAGGTCTTTTCTTTGCTCAAGATTGGGCAGCACTTAACAAATGTATGCCAGTT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1093 CTTGTACAAGGTCTTTTCTTTGCTCAAGATTGGGCAGCACTTAACAAATGTATGCCAGTT 1152 Qy 1141 GCTTCAGGTGGTATTCACTGTGGTCAAATGCACCAACTTATTAACTACTTAGGTGACGAC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1153 GCTTCAGGTGGTATTCACTGTGGTCAAATGCACCAACTTATTAACTACTTAGGTGACGAC 1212 Qy 1201 GTAGTATTACAATTTGGTGGTGGTACTATTGGTCACCCAGATGGTATCCAAGCTGGTGCT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1213 GTAGTATTACAATTTGGTGGTGGTACTATTGGTCACCCAGATGGTATCCAAGCTGGTGCT 1272 Qy 1261 ACTGCAAACCGTGTAGCACTTGAATGTATGGTTGTAGCACGTAACGAAGGTCGTGACTAT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1273 ACTGCAAACCGTGTAGCACTTGAATGTATGGTTGTAGCACGTAACGAAGGTCGTGACTAT 1332 Qy 1321 GTAACAGAGGGTCCTCAAATTCTTCGTAATGCAGCTAAGAGCTGTGGACCTCTTCAAACA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1333 GTAACAGAGGGTCCTCAAATTCTTCGTAATGCAGCTAAGAGCTGTGGACCTCTTCAAACA 1392 Qy 1381 GCATTAGATTTATGGAAAGACATTACTTTCAACTATGCTTCTACTGATACAGCTGACTTC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1393 GCATTAGATTTATGGAAAGACATTACTTTCAACTATGCTTCTACTGATACAGCTGACTTC 1452 Qy 1441 GTAGAAACTGCAACAGCTAACAAGTAA 1467 ||||||||||||||||||||||||||| Db 1453 GTAGAAACTGCAACAGCTAACAAGTAA 1479 With respect to claims 9-10, Rengifo teaches that the DNA construct further comprises a promoter., wherein the promoter comprises a GAL1 promoter (see para. 223). Regarding claim 11, Rengifo teaches that the DNA construct, wherein a GAL1 promoter is positioned before (a) the gene that expresses a heat shock protein, (b) the gene that expresses RuBisCO large subunit 1, (c) the gene that expresses tonB, (d) the gene that expresses hydrogenase, (e) the gene that expresses p-type ATPase, or any combination thereof (see para. 223, aspect 12). With respect to claims 12-13, Rengifo teaches that the DNA construct further comprises a fluorescent reporter protein (see para. 70), wherein the fluorescent reporter protein is a green fluorescent protein having SEQ ID NO. 6 (see para. 89) that has 100% sequence identity to SEQ ID NO: 8. Regarding claim 14, Rengifo teaches that the DNA construct, wherein the construct comprises from 5' to 3' the following genetic components in the following order: (1) a gene that expresses hydrogenase, (2) a gene that expresses p-type ATPase, (3) a gene that expresses tonB, (4) a gene that expresses a heat shock protein, and (5) a gene that expresses RuBisCO large subunit 1 (see para. 223, aspect 126). With respect to claim 15, Rengifo teaches that the DNA construct, wherein the construct comprises from 5' to 3' the following genetic components in the following order: (1) a gene that expresses hydrogenase having SEQ ID NO. 4 that has 100% sequence identity to SEQ ID NO: 6, (2) a gene that expresses p-type ATPase having SEQ ID NO. 5 that has 100% sequence identity to SEQ ID NO: 7 , (3) a gene that expresses tonB having SEQ ID NO. 3 that has 100% sequence identity to SEQ ID NO: 3 , (4) a gene that expresses a heat shock protein having SEQ ID NO. 5 that has 100% sequence identity to, and (5) a gene that expresses RuBisCO large subunit 1 having SEQ ID NO. 2 that has 100% sequence identity to SEQ ID NO: 2 (see para. 223, aspect 127). Regarding claims 16-17, Rengifo teaches that the DNA construct is a pYES2 plasmid having from 5′ to 3′ the following genetic components in the following order: (1) a gene that expresses hydrogenase having SEQ ID NO. 4 that has 100% sequence identity to SEQ ID NO: 6,, (2) a CYC1 terminator, (3) a GAL1 promoter, (4) a gene that expresses P-type ATPase having SEQ ID NO. 5, (5) a CYC1 terminator, (6) a GAL1 promoter, (7) a gene that expresses tonB having SEQ ID NO. 3, (8) a CYC1 terminator, (9) a GAL1 promoter, (10) a gene that expresses a heat shock protein having SEQ ID NO. 1, (11) a CYC1 terminator, (12) a GAL1 promoter, (13) a gene that expresses RuBisCO large subunit 1 having SEQ ID NO. 2 (see para. 109-110). With respect to claim 19-22, Rengifo teaches a vector comprising the DNA construct as discussed above, wherein the vector is a pYES2 plasmid (see para. 109-110). Rengifo differs from claimed invention by not disclosing including (i) a gene that encodes phosphoenol pyruvate carboxylase; and (ii) a gene that encodes phosphoenol pyruvate carboxykinase in the construct. Tan provides motivation to investigate expression of phosphoenolpyruvate carboxykinase (PPC) and PEP carboxykinase (PCK) to improve succinate production in a microorganism. It is shown that PPC and PCK overexpression results in a synergistic effect in improving succinate production (see abstract, page 4843, col. 2, para. 2 and 3). Suzuki cure the deficiency by disclosing use of DNA construct comprising a gene that encodes phosphoenol pyruvate carboxylase; and (ii) a gene that encodes phosphoenol pyruvate carboxykinase (see fig. 1) to study carbon flow (abstract). It is disclosed that cells expressing phosphoenol pyruvate carboxykinase in chloroplast shows C4-type photosynthetic carbon flow (see page 1011, col. 1, para. 1), while expressing C4-specific PEPC at high levels in their levees show reduced sensitivity to inhibition of photosynthesis by oxygen (see page 1010, col. 2, para. 1). Therefore, it would have been prima facie obvious for a person of ordinary skill in the art to combine the teachings of prior art to modify the DNA construct of Rengifo by further incorporating gene encoding phosphoenol pyruvate carboxylase and gene encoding phosphoenol pyruvate carboxykinase as suggested in Tan and Suzuki, to study carbon flux in an organism, with a reasonable expectation of success, before the effective filing date of instant application. Said modification amounting to combining prior art elements according to known methods to yield predictable results. One of ordinary skill in the art would be motivated to do so to recruit advantage of incorporating each of these two enzymes to optimize carbon flux and improve succinate production in the microorganism. Other limitations of gene under the control of Gal1 promoter and CYC1 terminator would be an obvious modification of known method to transfect or transform bacterial cell or that could be used in a plant cell as disclosed in Rengifo. One of skill in the art would have been expected to have a reasonable expectation of success in studying activation of carbon flux and succinate production by including both gene in the construct of Rengifo because prior art successfully reported using nucleic acid encoding PPC and PCK (phosphoenol pyruvate carboxylase and nucleic acid encoding phosphoenol pyruvate carboxykinase) in the construct. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith, --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf). Claims 1, 4-5, 15 and 17 remain rejected under 35 U.S.C. 103 as being unpatentable over Rengifo (US20220183301, 6/16/2022), Suzuki et al (Plant Science, 2006, 170, 5, 1010-1019) as evidenced by Tan et al (Appl Environ Microbiol 2013;79(16):4838–4844) as applied above and further in view of NCBI accession no NM_002591.4, dated 06/12/2022) and NCBI accession no AJ223496.1, 04/15/2005) . The teachings of Rengifo, Suzuki and Tan have been described above and relied in same manner here. The combination of reference differs from claimed invention by not disclosing (i) a gene that encodes phosphoenol pyruvate carboxylase having SEQ ID NO. 5 or at least 70% homology thereto; (ii) a gene that encodes phosphoenol pyruvate carboxykinase having SEQ ID NO. 4 or at least 70% homology thereto. NCBI accession no NM_002591.4 teaches phosphoenol pyruvate carboxykinase gene that has about 80% sequence identity to SEQ ID NO: 4, while NCBI accession no AJ223496.1 teaches phosphoenolpyruvate carboxylase gene sequence that has about 77% sequence identity to SEQ ID NO: 5 (see attached sequence alignments). Therefore, it would have been prima facie obvious for a person of ordinary skill in the art to combine the teachings of prior art to modify the pYES2 plasmid construct of Rengifo by further incorporating gene encoding phosphoenol pyruvate carboxylase; and gene encoding phosphoenol pyruvate carboxykinase as suggested in Tan and Suzuki using sequences disclosed in NCBI accession number, to study carbon flux, with a reasonable expectation of success, before the effective filing date of instant application. Said modification amounting to combining prior art elements according to known methods to yield predictable results. One of ordinary skill in the art would be motivated to do so to recruit advantage of incorporating each of two enzymes to optimize carbon flux and improve succinate production. Other limitations of gene under the control of Gal1 promoter and CYC1 terminator would be an obvious modification of known method to transform bacterial cell or use in plant cells as disclosed in Rengifo. One of skill in the art would have been expected to have a reasonable expectation of success in studying activation of carbon flux and succinate production by including both gene sequences that are known in prior art in the construct of Rengifo because prior art successfully reported using nucleic acid encoding phosphoenol pyruvate carboxylase and nucleic acid encoding phosphoenol pyruvate carboxykinase in a construct to study carbon flux and succinate expression. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith, --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf). Response to arguments Applicants disagree with the rejection in part arguing DNA construct is part of a pYES2 plasmid vector. Applicant argues that pYES2 is vector for use in or use in S. cerevisiae. an organism that does not include chloroplasts and that cannot conduct photosynthesis. Applicants continue to argue Tan is directed to expression of succinate metabolism genes anaerobically in E. coli in order to maximize succinate production and thus uses phosphoenol pyruvate carboxylase and phosphoenol pyruvate carboxykinase for different purposes from Suzuki, who is interested in introducing C4-like photosynthesis into C3 plants such as rice (see "Introduction"). It is noted that Suzuki concludes "The results suggest that the overexpression of PEPC enhances the anaplerotic pathway rather than the initial carbon fixation of the C4-like photosynthetic pathway, and that elevated PEPC activity in combination with PCK activity contributes little to C4-like carbon flow. Applicant further assert that Tan and Suzuki use PEPCK and PEP Carboxylate for different purposes in different organisms with unpredictable degrees of success. Applicant argus that Rengifo is silent with respect to succinate or succinate production. Thus, an ordinarily-skilled artisan would not look to Rengifo when interested in studying succinate production or when wanting to produce succinate. In response, it is noted that independent claim is broad and embrace a DNA construct comprising the following genetic components in any orientation:(a) a gene that encodes any hydrogenase;(b) a gene that encodes any p-type ATPase;(c) a gene that encodes any phosphoenol pyruvate carboxylase (PEPC);(d) a gene that encodes any phosphoenol pyruvate carboxykinase (PEPCK); (e) a gene that encodes any tonB;(f) a gene that encodes any heat shock protein; and (g) a gene that encodes any RuBisCO large subunit 1 with or without any regulatory sequence and/or terminator sequence. Further, as amended no expression or any functional effect is required by the DNA construct. The claim as such read on a DNA construct comprising a set of seven genes that may derived from same or different species and may or may not be optimized for expression in yeast (S. cerevisiae). In claim 1, none of the genes require its own promoter/inducible promoter and/or terminator to improve product yield that could be applied to multienzyme system in yeast or any other organism. In view of foregoing, it is apparent that claims are broad and not limited to any specific use or expression in any species including S. cerevisiae as extensively argued by applicants. While pYES2 is a high-copy, galactose-inducible yeast expression plasmid intended for expression in S. cerevisiae, however, the pYES2 could also be used for propagating in E. coli for cloning and other manipulation. In absence of any specificity in the claimed DNA construct, applicants’ argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., expression in in S. cerevisiae) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Applicants have further engaged in selective reading of the teachings of Tan and Suzuki. to formulate the grounds for teaching away. It should be noted that the goal of the claimed DNA construct is built from genes that are tied to stress response, carbon handling, transport, hydrogen metabolism, and ATP-driven transport, and may be arranged in a plasmid for yeast, bacteria or another organism (see para. 73-85 of the specification). The construct is introduced into microbial host cells by transformation to form a “biological device” (see para. 111-118 of the instant specification). These transformed cells are cultured under suitable conditions, and the cells or culture are used as an extract or lysate (see para. 120-133 and 360). As previously indicated, Tan et al. (2013) systematically demonstrated that PEPC and PEPCK have complementary catalytic behaviors when converting phosphoenolpyruvate (PEP) to oxaloacetate. Further, Tan reported co-expression of these two enzymes can be beneficial when balanced for the activity. Tan teaches over expression of PEPC reduces cell growth, while sole expression of PEPCK yields suboptimal carbon flux (see 4843, col. 2, para. 2). These observations provide motivation to one of ordinary skill in the to combine the PEPC and PEPCK expression that could similarly redirect carbon metabolism in yeast, with reasonable expectation of success. In response to applicants’ argument that Tan and Suzuki use PEPCK and PEP Carboxylate for different purposes in different organisms with unpredictable degrees of success, it should be noted that simultaneous expression of PEPCK and PEPC does not mean simultaneous higher activity. In the instant case, the carbon flux would depend on substrate concentration, cofactors, and carbon source. It should be noted that obviousness does not require absolute predictability, only a reasonable expectation of success, See, e.g., In re O’Farrell, 853 F.2d 894, 903, 7 USPQ2d 1673, 1681 (Fed. Cir. 1988). In the instant case, expression of PEPCK could convert oxaloacetate back to PEP, thereby facilitating metabolic balancing. In view of foregoing, it is apparent that different biological systems (bacteria or rice) have shown that manipulation of PEPC and PELKC could alter carbon flux at the PEP-oxaloacetate. Suzuki reported altered carbon metabolism following expression of PEPC and PEPCK in rice (page 1011, col. 1, para. 2), while Tan reported coordinated activation of these enzymes could improve carbon flux towards succinate (page 4838, col. 1, para. 1, 4843, col. 2, para. 2) leading to growth. Thus, combining PPC and PCK influences PPC’s high flux and PCK’s ATP conversion improving overall yield and same principle could be applied to yeast that is amenable to overexpression and same concept could be applied to redirect and optimize the PEP flux and ATP yield that is relevant to yeast’s metabolism, with reasonable expectation of success. Absent any specific functional requirement, it would have been prima facie obvious for a person of ordinary skill in the art to combine the teaching of Tan and Suzuki to incorporate both gene in the plasmid comprising other metabolic gene as disclosed in Rengifo in order to maintain metabolic balance levels yielding a synergistic and/or additive improvement in succinate titers and yielding by combining PCK's energy conservation with PPC's catalytic rate, with reasonable expectation of success. Therefore, in view of the fact patterns of the instant case, and the ground of rejection outlined by the examiner, applicants' arguments are not compelling and do not overcome the rejection of record. Conclusion No claims allowed. Bailey et al (Plant Physiology, 2007, 144, 479-486) teaches a tight, reciprocal regulation between the phosphorylation states of two critical enzymes: Phosphoenolpyruvate Carboxylase (PEPC) and Phosphoenolpyruvate Carboxykinase (PEPCK). THIS ACTION IS MADE FINAL. Applicants are reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANOOP K. SINGH whose telephone number is (571)272-3306. The examiner can normally be reached Monday-Friday, 8AM-5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571)272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ANOOP K SINGH/Primary Examiner, Art Unit 1632