TRANSGENIC PLANTS HAVING INCREASED BIOMASS

DETAILED ACTION Notice of Pre-AIA or AIA Status The present application is being examined under the pre-AIA first-to-invent provisions. Status Claims 2, 16, 19, and 21-24 as filed on 13 January 2025 were examined and rejected in an Office action posted 25 June 2026. Applicant responded on 7 July 2026 adding two claims. Claims 2, 16, 19, 21-24 and 43-44 are examined herein. This application is a divisional of U.S. patent application serial no. 17/459,290 (USP No. 12,516,339. This application was also a divisional, of U.S. patent application serial no. 15/676,845 (USP 11,162,108). The first action in the ‘845 application was a restriction requirement. The four siblings of the instant application were also filed as divisionals. Claim 2 is drawn to a plant with increased height compared to a control plant. A “control” is interpreted as the same plant species or line grown under the same environmental conditions. Plant height is quite dependent on environmental conditions. Applicant is reminded that upon the cancellation of claims to a non-elected invention, the inventorship must be amended in compliance with 37 CFR 1.48(b) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. Any amendment of inventorship must be accompanied by a request under 37 CFR 1.48(b) and by the fee required under 37 CFR 1.17(i). Withdrawal of Objections and Rejections The objection to claims 22 and 24 is withdrawn in view of Applicant’s amendments to the claims. The rejection of claim 22 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite is withdrawn in view of Applicant’s amendments to the claims. The rejection of claims 2, 16, 19, and 21-24 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement is withdrawn in view of Applicant’s amendments to the claims. Further, as of the priority date of the instant application it was within the reach of an ordinary artisan to create an RNAi construct to suppress expression of SEQ ID NO:1. The rejection of claims 2, 16, 19, and 21-24 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement is withdrawn in view of Applicant’s amendments to the claims. Examiner’s Notes Citations to Applicant’s specification are abbreviated herein “Spec.” Occasionally, “SIN:” may be used as an abbreviation “SEQ ID NO:” herein. First, the subject matter switched from the nucleotide sequence of SEQ ID NO:678 to the amino acid sequence of SEQ ID NO:1. When SEQ ID NO:678 is translated in the reverse frame, it is SEQ ID NO:1. That is consistent with SEQ ID NO:678 being an RNAi construct. See, for example, page 6 (top third) of the Office action. 35 USC § 103-based Claim Rejections The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: § 103. Conditions for patentability; non-obvious subject matter A patent for a claimed invention may not be obtained, . . . . if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 2, 16, 19, 21, 22, 23, 24, 43, and 44 are rejected under 35 U.S.C. 103 as being unpatentable over La Rosa et al. U.S. Patent Publication No. "2010/0269214 A2, claiming priority to provisional application no. 60/132,860, filed on 7 May 1999. Also cited below is Troukhan & Mascia, US Patent Publication No. 2009/0094717 A1 and Tittonell et al. (2005) Agric Ecosys Environ 105:213-20. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows: a. Determining the scope and contents of the prior art. b. Ascertaining the differences between the prior art and the claims at issue. c. Resolving the level of ordinary skill in the pertinent art. d. Considering objective evidence present in the application indicating obviousness or nonobviousness. As seen in the alignment below, La Rosa et al. teaches instant SEQ ID NO:678 as its SEQ ID NO:11104. As discussed above, this nucleotide sequence encodes SEQ ID NO:1 in a reverse orientation. La Rosa et al.’s first claim is drawn to a nucleic acid molecule drawn from Markush groups where the groups include SEQ ID NO:11104. In paragraph 0019 La Rosa et al. teaches using its nucleic acid molecules in an antisense orientation. See also paragraph 0030 (and 0070-72). Paragraph 0031 teaches rice. Paragraph 0050 teaches regenerating plants. In paragraph 0066, La Rosa et al. teaches an objective of improving plant yield. In paragraph 0069 La Rosa et al. teaches plants with “greater stature or thicker stalks” which is another way of saying an increase in height. Therefore it would have been prima facie obvious to one of ordinary skill in the art at the time of Applicants' invention to follow the teachings of La Rosa et al. to express SEQ ID NO:678, or its antisense transcript, in a transgenic plant. Given the level of skill in the art at the time of Applicants' invention, one of ordinary skill in the art would have had a reasonable expectation of success in creating such a plant. Applicant also added limitations regarding transcribing the transgene to create an RNA suppression agent. As Applicant teaches in paragraph 0142, Antisense technology is one well-known method. See, for example, Troukhan & Mascia, US Patent Publication No. 2009/0094717 A1, published 9 April 2009, paras 0087-90. So these limitations are obvious in view of the art. Additionally, it is well known that plant height correlates with increased yield in, at least, maize. Tittonell et al. (2005) Agric Ecosys Environ 105:213-20, abstract. Thus electing for increased height can reasonably result in a plant with increased yield. It is obvious to select a transgenic plant for increased yield. Additionally, La Rose et al., as cited above, teaches creating plants with increased stature. Thus claim 2 is obvious. Claim 16 is also obvious because it only reduces the size of the claimed genus of variants. Claim 19 is also obvious because it reads on such a plant cell. Claims 21 and 22 read on plants and include rice and thus are also obvious. Claim 23 is also obvious because it reduces the size of the claimed genus of variants. Claim 24 reads on, in one embodiment, a seed, and thus is obvious; also claim 43. La Rosa et al. does not single out its copy of instant SEQ ID NO:678 / its SEQ ID NO: 11104 in the claims, but each embodiment in the sequence listing has its unique sequence and its unique SEQ ID NO. Hence, La Rosa et al. does not teach the association of transgenic expression of instant SEQ ID NO:678 / its SEQ ID NO: 11104 with an increase in height. La Rosa et al. does single out transcription factors (para. 0004) and subsequent work demonstrated SEQ ID NO:678 with a coding sequence for a transcription factor (see Claim Interpretation section in the prior Office action). Claim 44 reads on a progeny plant of the transgenic plant of claim 21. Since it is unlimited with respect to generation and does not require the transgene, it reads on largely any plant. Therefore it is obvious. Applicant’s Argument & Response Applicant begins the argument on page 11 of the response. In the first paragraph, Applicant summarizes claim 2 and points out that a resultant plant is taller. However, in response, claim 2 is drawn to a plant cell. Regarding the number of sequences taught by La Rosa et al., the Federal Circuit in the In re Gleave decision considered the issue as to whether a claim that individually lists hundreds of sequences is prior art with regard to a subsequent patent application that singles out a particular sequence. In re Gleave, 560 F3d 1331, 90 USPQ2d 1235, 1237 (Fed. Cir. 2009). The party arguing against the validity of the reference as prior art, Gleave, presented the same argument that Appellant presents - merely listing numerous sequences somehow does not individually teach each sequence. Id. The Federal Circuit, however, held that a claim listing individually sequences still fully describes each individual sequence. Id., p. 1241. Even though the prior art listed hundreds of individual sequences, it still reads on each individual embodiment. Id., p. 1240. From the middle of page 11 to the middle of page 12 Applicant alleges that details required by the claim are not directly taught by La Rosa et al. Applicant is not persuasive. Clearly the inventors of La Rosa et al. sought improved plants. The MPEP confirms this approach: "[a] reference may be relied upon for all that it would have reasonably suggested to one having ordinary skill the art, including nonpreferred embodiments.” MPEP § 2123 (citing to Merck & Co. v. Biocraft Labs., 874 F.2d 804, 10 USPQ2d 1843 (Fed. Cir.), cert. denied, 493 U.S. 975 (1989)). Section 2123 continues that "[t]he prior art's mere disclosure of more than one alternative does not constitute a teaching away from any of these alternatives because such disclosure does not criticize, discredit, or otherwise discourage the solution claimed . . ." MPEP § 2123 (quoting In re Fulton, 391 F.3d 1195, 1201, 73 USPQ2d 1141, 1146 (Fed. Cir. 2004)). Thus creating, growing and selecting, for example, a plant where the expression of SEQ ID NO:1 was suppressed was routine in the art and presents no technical hurdles that would bar a reasonable expectation of success. Appellant’s specification presents no teachings as to any additional step that was performed or is required. Appellant’s approach merely agrees with the teachings of La Rosa et al. to create a transgenic plant suppressing SEQ ID NO:1 and then growing and selecting the plant for increased height. Creating a transgenic plant was routine in the art at the time of filing. Expressing RNA suppression agents was routine. Selecting a plant for improved characteristics was routine and obvious. Applicant cites to the values in the specification and urges that they are “unexpected results.” Without a supporting declaration by a skilled artisan, though, that is mere attorney argument. Further, although the values in the specification, those values are not in the claims. The claims would be satisfied by any increase in height. If a skilled artisan selects a plant for increased height, it will, indeed, be taller. Further, as seen above, selecting a plant of increased height is not a particularly inspired choice, it is obvious in view of the art. Thus, [A] combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results. When a work is available in one field, design incentives and other market forces can prompt variations of it, either in the same field or in another. If a person of ordinary skill in the art can implement a predictable variation, and would see the benefit of doing so, § 103 likely bars its patentability. (citing to United States v. Adams, 383 U.S. 39, 50-52, 86 S. Ct. 708, 174 Ct. Cl. 1293 (1966).) KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 405, 127 S. Ct. 1727, 1734, 82 U.S.P.Q.2D 1385, 1389 (2007). Thus Applicant’s argument fails to persuade. The rejection is maintained. US-10-438-246-11104/c (NOTE: this sequence has 4 duplicates in the database searched. See complete list at the end of this report) Sequence 11104, US/10438246 GENERAL INFORMATION APPLICANT: La Rosa, Thomas J. APPLICANT: Lutfiyya, Linda L. APPLICANT: Zhou, Yihua APPLICANT: Kovalic, David K. APPLICANT: Barbazuk, Brad APPLICANT: Li, Ping APPLICANT: Wu, Wei APPLICANT: Boukharov, Andrey A. TITLE OF INVENTION: Nucleic Acid Molecules and Other Molecules Associated with TITLE OF INVENTION: Transcription in Plants and Uses Thereof for Plant Improvement FILE REFERENCE: 38-21(53333)B CURRENT APPLICATION NUMBER: US/10/438,246 CURRENT FILING DATE: 2003-05-14 NUMBER OF SEQ ID NOS: 33516 SEQ ID NO 11104 LENGTH: 708 TYPE: DNA ORGANISM: Oryza sativa FEATURE: OTHER INFORMATION: Clone ID: TFbOSC400993j.C1.o33.fg Query Match 100.0%; Score 708; Length 708; Best Local Similarity 100.0%; Matches 708; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CTAGTTCTCTACCGGCGGCGGCCGGTTCAGATCCAGATCGAAAGCTGCCGCCTTGTTCGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 708 CTAGTTCTCTACCGGCGGCGGCCGGTTCAGATCCAGATCGAAAGCTGCCGCCTTGTTCGC 649 Qy 61 CGTAACCGCTGGAGGTGACGGCGCGAGATCAACCACCGACGAGGAGTCGGAGTCACTTTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 648 CGTAACCGCTGGAGGTGACGGCGCGAGATCAACCACCGACGAGGAGTCGGAGTCACTTTG 589 Qy 121 TGCAACCGCCGCCACGGTGACCGGCGGTGCAAGCTTCATCATACGGTATCCAGCCTCAGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 588 TGCAACCGCCGCCACGGTGACCGGCGGTGCAAGCTTCATCATACGGTATCCAGCCTCAGC 529 Qy 181 TGCGGCAGCCGCTGCAGCCTGCTCATAGAAAAAGTAAGGATGCGTTGCTGGACGTGCAAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 528 TGCGGCAGCCGCTGCAGCCTGCTCATAGAAAAAGTAAGGATGCGTTGCTGGACGTGCAAC 469 Qy 241 GGGATATCCTCTGAAAGGAAAGCGAACGCCGGTGCCGGCGACTGCAGTCACAGCAGCCGC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 468 GGGATATCCTCTGAAAGGAAAGCGAACGCCGGTGCCGGCGACTGCAGTCACAGCAGCCGC 409 Qy 301 GCGGTGGAACAAATCCAAGTCCAGAGTCGGCGGCAGAGGCATGGCCCGCATAGGCGTCTG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 408 GCGGTGGAACAAATCCAAGTCCAGAGTCGGCGGCAGAGGCATGGCCCGCATAGGCGTCTG 349 Qy 361 AACCCCGCCGCCACCGGTGTCTACCGTGCTATTGCTGCTGGGGCTGCCGCCACAGCCGAC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 348 AACCCCGCCGCCACCGGTGTCTACCGTGCTATTGCTGCTGGGGCTGCCGCCACAGCCGAC 289 Qy 421 CATCGACTGTGATGCAAACGGAAAGTTTGTTTTTGCCTTGGCACCCCGGAACTCTCGAGC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 288 CATCGACTGTGATGCAAACGGAAAGTTTGTTTTTGCCTTGGCACCCCGGAACTCTCGAGC 229 Qy 481 GGCGGCGTCGTAGGCGCGGGCGGCCTCCTCTGCCGTGTCGTAGGTACCGAGCCACACCCG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 228 GGCGGCGTCGTAGGCGCGGGCGGCCTCCTCTGCCGTGTCGTAGGTACCGAGCCACACCCG 169 Qy 541 GCTCTTCTTGGCAGGGTCACGGATCTCCGCTGCGTAACGCCCCCACGGGCGCTTGCGGAC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 168 GCTCTTCTTGGCAGGGTCACGGATCTCCGCTGCGTAACGCCCCCACGGGCGCTTGCGGAC 109 Qy 601 GCCCCTGTAGTGAGGACCCCCGGCTCCGACACCTCCGCCGACGCCAAGACCAAGCCCGGT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 108 GCCCCTGTAGTGAGGACCCCCGGCTCCGACACCTCCGCCGACGCCAAGACCAAGCCCGGT 49 Qy 661 GGGTGGCGCCACAGCAACCTTCTCCACCGTAGCTGCTCTGGGCGCCAT 708 |||||||||||||||||||||||||||||||||||||||||||||||| Db 48 GGGTGGCGCCACAGCAACCTTCTCCACCGTAGCTGCTCTGGGCGCCAT 1 Conclusion No claim is allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUSSELL T BOGGS whose telephone number is (571)272-2805. The examiner can normally be reached Monday - Friday, 0800 to 1830 Mtn. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at 571-270-0708. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /RUSSELL T BOGGS/Examiner, Art Unit 1663