Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This application claims priority from a Chinese Patent Application NO. 202410593737.2 filed on May 14, 2024. Examiner notes that applicant has filed a Verification of Translation of the 202410593737.2 application certifying the translation on 01/16/2025.
Status of Claims
Claims 1-9 are pending.
Claims 1-9 are examined herein.
Claim Interpretation
Regarding claim 2, the phrase “engineered strain” is taken to mean a strain of E.coli , Agrobacterium, or lemon tree (Citrus limon) transformed and harboring the vector of claim 1. These species were used in the disclosure in paragraphs 21,49, 60, 74, and table 4. These are also the species the disclosure encompasses and was directed to.
Applicant’s claims 1-9 are directed to vectors, strains, and methods for inhibiting expression of a mature miRNA termed csi-miRn0008 (SEQ ID NO: 1). This sequence is also identified as “csi-miR0008” in the literature1. Because the names are remarkably identical and are used to identify the same RNA sequence, the examiner interprets csi-miRn0008 and csi-miR0008 to identify the same composition.
The “synthesized csi-miRn0008 mimic target tandem sequence” of claim 5 is interpreted to be SEQ ID NO: 4 referenced in claim 1.
Claims 3-5 and 8-9 which recite “lemon” is interpretated to mean a plant from the species with the scientific name “Citrus limon”.
Information Disclosure Statement
The disclosure lacks a proper Information Disclosure Statement. For example, 37 CFR § 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Specification
The specification filed on 01/16/2025 is rejected because it does not define “Fv/Fm” seen in Figures 3C and 4C.
Drawings
The drawing are rejected to because Figure 1 uses the term “csi-miR0008” while the rest of the disclosure uses the term “csi-miRn0008” in paragraph 22.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 3 and 4 are rejected under 35 U.S.C. 101 because the claimed method is directed to non-statutory subject matter. The claims do not fall within at least one of the four categories of patent eligible subject matter because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. The listed claims are
determined to be directed to subject matter that is naturally occurring, or to a law of nature/natural principle or natural phenomenon. The rationale for this determination is explained below.
The instantly pending claims are method claims. The judicial exception is the correlation between inhibiting miRNA, csi-miRn0008, and increasing wax content for drought and salt resistance in lemon.
The Applicant’s claims are drawn to a method for improving drought and salt tolerance through increasing cuticular wax biosynthesis by inhibiting expression of csi-miRn0008. The mature sequence of the csi-miRn0008 is set forth in SEQ ID NO: 1 and a precursor sequence of the csi-miRn0008 is set forth in SEQ ID NO: 2. The DNA molecule encoding the precursor sequence of the csi-miRn0008 is set forth in SEQ ID NO: 3. The claims are thus drawn to methods that apply the natural principle of a correlation between inhibition of csi-miRn0008 expression for increased wax production, and a drought and salt resistance phenotype. These claims read on thought processes, i.e., visually observing the “salt and drought resistance” (interpreted as naturally occurring growth) of citrus (i.e., lemon, orange) plants, and a naturally occurring phenomena (a citrus plant that has naturally germinated and is growing will regulate the csi-miRn0008 expression using the CsMYB44 transcription factor)2. The breadth of a method that encompasses inhibiting expression of csi-miRn0008, coupled with prior knowledge of the correlation of said phenotype(s). This breadth does not impose a meaningful limit on the claim scope, such that all others are not precluded from using the natural principle.
A method for improving drought tolerance through increasing cuticular wax biosynthesis by inhibiting expression of miRN0008 is already present in citrus plants. This is seen in Figure 12 (see below) of Xie et al 2025 and discussed in paragraph 3 of page 20 in the passage “CsMYB44 can suppress the transcription of csi-miR0008, which is, in turn, an inhibitor of the expression of CsCER1, thereby leading to an increase in the accumulation of n-alkanes and other cuticular wax components, imparting citrus plants with superior drought resistance”. While Xie et al 2025 does not disclose the method increases salt resistance, based on the Applicant’s disclosure, a plant reducing the expression of csi-miRn0008 (i.e. with a transcription factor) would have increased epicuticular wax and would inherently show increase salt resistance. Additionally, the sequence of SEQ ID NO: 1 is disclosed in the supplementary figure S2 (See snapshot below) and uses the term “csi-miR0008”. Because the mature csi-miRn0008 RNA sequence was identified in citrus, it can be assumed the precursor sequence (SEQ ID NO:2) and encoding DNA (SEQ ID NO: 3) was also present in the plant, absent evidence to the contrary. Additionally, a BLAST of SEQ ID NOs:2-3 in NCBI yields a “pre-miRNA” from Newhall oranges (i.e. citrus) and was likely the source of the mature csi-miRn0008 in the applicant’s disclosure, absent evidence to the contrary (See NCBI blast result and alignment below). For this reason, claims 3 and 4, directed to a methods of increasing wax content for improved salt and drought resistance through inhibiting the expression of csi-miRn0008 in lemon plants are rejected.
PNG
media_image1.png
473
1009
media_image1.png
Greyscale
[AltContent: textbox (SEQ ID NO: 1)]
PNG
media_image2.png
163
442
media_image2.png
Greyscale
PNG
media_image4.png
691
756
media_image4.png
Greyscale
Score Expect Identities Gaps Strand
558 bits(302) 1e-157 302/302(100%) 0/302(0%) Plus/Plus
Query 1 ACACATTGGGGCCAGGACGCTGTCCTTCCACAACTTGAATATCATAGTTATGAATTACGC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 ACACATTGGGGCCAGGACGCTGTCCTTCCACAACTTGAATATCATAGTTATGAATTACGC 60
Query 61 CGGCAGCCACAGCTTTCATTTGAGTGAAAGCGACCTCTTTGCCTAAACAAGTCCTTGGTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 CGGCAGCCACAGCTTTCATTTGAGTGAAAGCGACCTCTTTGCCTAAACAAGTCCTTGGTC 120
Query 121 CTGCATTAAATGAGAAGAACTTGTACGACGGCTCCCATTTGATCCCTCCACTTTCAGAAA 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 CTGCATTAAATGAGAAGAACTTGTACGACGGCTCCCATTTGATCCCTCCACTTTCAGAAA 180
Query 181 TCCATCTTTCAGGCCTAAATTCCAAGCAATCTTCTCCCCATATTGACTTCATTCTCCCCA 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 TCCATCTTTCAGGCCTAAATTCCAAGCAATCTTCTCCCCATATTGACTTCATTCTCCCCA 240
Query 241 TTGCATACAGAGAAAACAAGATCTTTGTTCTCGGAACGGCGCGGTGTCCGCTTGGAAGAG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 TTGCATACAGAGAAAACAAGATCTTTGTTCTCGGAACGGCGCGGTGTCCGCTTGGAAGAG 300
Query 301 TG 302
||
Sbjct 301 TG 302
The instant method claims do not require any transformation event or any additional elements to show a practical application or integration of the natural principle sufficient to confer patent eligibility. For a claim that is directed to a judicial exception to be patent-eligible, it must include additional features to ensure that the claim describes a process or product that applies the exception in a meaningful way, such that it is more than a drafting effort designed to monopolize the exception. For examples of claims that recite meaningful limitations, see MPEP § 2106; see also Classen Immunotherapies Inc. v. Biogen IDEC, 659 F.3d 1057, 100 USPQ2d 1492 (Fed. Cir. 2011). A claim that focuses on use of a natural principle must also include additional elements or steps to show that the inventor has practically applied, or added something significant to, the natural principle itself. Mayo Collaborative Services v. Prometheus Laboratories, Inc., 566 U.S. __, 132 S.Ct. 1289,101 USPQ2d 1961 (2012), at 1966. To show integration, the additional elements or steps must relate to the natural principle in a significant way to impose a meaningful limit on the claim scope.
The claimed methods are not patent-eligible pursuant to the Supreme Court decision in Ass'n. for Molecular Pathology v. Myriad Genetics (formerly v. USPTO), 653 F.3d 1329, 99 USPQ2d 1398 (Fed. Cir. 2011), cert. granted, judgment vacated and remanded to the Court of Appeals for the Federal Circuit, No. 11-725, 80 U.S.L.W. 3380, 2012 BL 72224 (U.S. Mar. 26, 2012), reversed, ---- S.Ct. ----, 106 USPQ2d 1972, 1974-75 (2013). The claimed invention does not rise to a level that is markedly different in structure from what exists in nature. See “October 2019 Update: Subject Matter Eligibility”, issued October 17, 2019, available from the USPTO website at https://www.uspto.gov/patent/laws-and-regulations/examination-policy/subject-matter-eligibility.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 2-9 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 2 is rejected because the term “engineered strain” is indefinite and not explicitly defined in the disclosure. As such, the metes and bounds of the claim are unclear. Is the term “strain” limited or intended to encompass all possible bacteria, citrus plants, all possible plants, all possible animals, etc.? And if so, what would be their utility?
Claims 3-4 and dependent claims 5-7 use the term “improve” when describing the outcome of their method in regards to epicuticular wax. The specification (paragraphs 15 and 116) and claims 8 and 9 uses the term “increases”. “Improving” can mean quantitative and/or qualitative changing of the composition in epicuticular wax in a variety of ways and combinations thereof, depending on the context.
Claims 8 and 9 are directed to a “method for improving a resistant variety of a lemon”. This wording is indefinite and could be interpreted to mean this method requires a variety of lemon that is already somehow relatively resistant; and which then improved? There is lack of antecedent basis, as the resistance is not defined and not in a preceding independent claim that this claim draws dependence from.
Subject Matter Free of Art
Claims 1-9 are deemed free of prior art.
Claims 1-2 are directed to an expression vector containing the synthesized csi-miRn0008 mimic target tandem sequence (i.e. SEQ ID NO:4) and an engineered strain containing the vector. The closest prior art is Tang, Guiliang, et al. "Construction of short tandem target mimic (STTM) to block the functions of plant and animal microRNAs." Methods 58.2 (2012): 118-125. This document is directed to generating a construct containing STTM sequences that block miRNA functions in plants and animals (see abstract). Expression vectors using STTM technology (i.e. claim 1) were transformed into Agrobacterium strains and then into Arabidopsis (i.e. claim 2). This is taught on page 6 paragraph 9 in the “Plant transformation by Agrobacterium” section. The expression of the STTM vector likely led to miR165/166 (i.e. miRNA) degradation and the expression of most miR165/166 target genes such as PHB, PHV, REV were largely up-regulated (see page 7 paragraph 1).
Claims 3-9 are directed to a method where the expression vector can be used (i.e. transformed) into a lemon plant, and its expression results in the inhibition of csi-miRn0008 expression. The mature sequence of the csi-miRn0008 is set forth in SEQ ID NO: 1 and a precursor sequence of the csi-miRn0008 is set forth in SEQ ID NO: 2. The DNA molecule encoding the precursor sequence of the csi-miRn0008 is set forth in SEQ ID NO: 3. The reduction of csi-miRn0008 expression results in increased production of epicuticular wax, which improves the plants resistance to drought and salt stress. The synthesized csi-miRn0008 mimic target tandem sequence (i.e. SEQ ID NO:4) can be ligated to the linear D35S-pBI121 vector with a 2X35S promoter. An engineered Agrobacterium strain GV3101 is used to transform the lemon strain.
The closes prior art is Tang et al 2012, Wang, Rong, et al. "The miR399-CsUBC24 module regulates reproductive development and male fertility in citrus." Plant Physiology 183.4 (2020): 1681-1695, and Li, Rong-Jun, et al. "Diurnal regulation of plant epidermal wax synthesis through antagonistic roles of the transcription factors SPL9 and DEWAX." The Plant Cell 31.11 (2019): 2711-2733, Dominguez, Michelle M., Carmen S. Padilla, and Kranthi K. Mandadi. "A versatile Agrobacterium-based plant transformation system for genetic engineering of diverse citrus cultivars." Frontiers in Plant Science 13 (2022): 878335.
Tang et al 2012 teaches a method for creating and using expression vectors in plants using STTM technology to inhibit expression of miRNAs, as was drawn to in claims 5 and 8 . It also discloses the use of a 2X35S (i.e. d35S) promoter to drive the expression of the expression cassette containing the STTM construct as was drawn to in claim 6. The 2X35S promoter can be seen on Figure 1 and in the first sentence of paragraph 2 on page 3.
Wang et al 2020 teaches the use of STTM constructs to reduce the expression of the miRNA (miR399) in citrus plants, as was drawn to in claims 3-4. This is taught in the abstract in the passage “Down-regulation of CsmiR399a.1 using a short tandem target mimic (STTM) led to abnormal floral development, inhibition of anther dehiscence, and decreased pollen fertility”. It also teaches the use of an Agrobacterium-mediated method to cultivate transgenic citrus plants (i.e. claim 5) using a GV3101 strain (i.e. claims 7 and 9). It also teaches the use of a pBI121 vector (i.e. claim 6). This can be seen on page 11 in paragraphs 5-6.
The teachings of Li et al 2019 demonstrate that CER1, a protein involved in wax synthesis and involved in biotic and abiotic (i.e. drought and salt) stress responses3 and is regulated by a miRNA in Arabidopsis4. Mutants, called Pro35S:MIM156, have reduced miRNA activity (i.e. expression) and was taught on page 2 paragraph 5. The decrease in the miRNA activity led to an increase of epicuticular waxes (see page 3 paragraph 3 and Figure 1C) as was drawn to in claims 3-9.
Dominguez et al 2022 teaches an Agrobacterium-based plant transformation system for lemons and other citrus plants. This is described throughout the document, but specifically mentions lemon on page 9 paragraph 4 and tables 2 and 3. Claims 5-9 are drawn to this method in lemons.
The teachings of Tang et al 2012 teaches, Wang et al 2020 teaches, Li et al 2019, and Dominguez et al 2022 do not teach the expression cassette containing the csi-miRn0008 mimic target tandem sequence (SEQ ID NO:4) or miRNA directed to in claims 3 and 4.
Citation of Relevant Prior Art
The prior art made of record and not relied upon but is considered pertinent to the Applicant’s disclosure.
CN 112322623 A published on 05-Feb-202; and
US 20190161766 A1 published 30-May-2019.
Conclusion
Claim 1 is allowable.
Claims 2-9 are rejected.
Contact
Any inquiry concerning this communication or earlier communications from the examiner should be directed to GEORGE W MEYER whose telephone number is (571)272-3733. The examiner can normally be reached Monday - Friday 8:00 am- 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571)-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/GEORGE W MEYER/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
1 Supplementary Figure 2A in Xie, Jingheng, et al. "The CsMYB44‐csi‐miR0008‐CsCER1 module regulates cuticular wax biosynthesis and drought tolerance in citrus." New Phytologist 246.4 (2025): 1757-1779
2 See the third bullet point in the summary of Xie et al 2025.
3 Page 2 paragraph 3 and page 15 paragraph 2 of Li et al 2019
4 Page 16 paragraph 1