DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application is being examined under the pre-AIA first to invent provisions.
Claim Status
Claims 1-16 are pending and being examined.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
The specification contains an embedded hyperlink at page 20, para 0088. It is suggested to delete the embedded hyperlink.
Claim Objections
Claims 5 and 12 are objected to under 37 CFR 1.75 as being a substantial duplicate of claims 2 and 11, respectively. When two claims in an application are duplicates or else are so close in content that they both cover the same thing, despite a slight difference in wording, it is proper after allowing one claim to object to the other as being a substantial duplicate of the allowed claim. See MPEP § 608.01(m).
Claim 5 depends from claim 1 and is recites “…. said SP gene is selected from the group consisting of Peanut SP gene comprising a sequence having at least 75% identity to a sequence selected from SEQ ID NO:1025, SEQ ID NO:1098, SEQ ID NO:1180, SEQ ID NO:1290, SEQ ID NO:1409, SEQ ID NO:1529, SEQ ID NO:1640, SEQ ID NO:1749 and SEQ ID NO:1928, or a functional variant thereof and any combination thereof”. Claim 2 also depends from claim 1 and is drawn to “…SP gene is selected from AhSP1- AhSP9 comprising a nucleic acid sequence with at least 75% sequence identity to a sequence selected from SEQ ID NO:1025, SEQ ID NO:1098, SEQ ID NO:1180, SEQ ID NO:1290, SEQ ID NO:1409, SEQ ID NO:1529, SEQ ID NO:1640, SEQ ID NO:1749 and SEQ ID NO:1928, or a functional variant thereof and any combination thereof”.
Claims 11 and 12 both depends from claim 1 and are drawn to the mutation generated via introduction of a construct comprising (a) Cas DNA and gRNA sequence selected from the group consisting of SEQ ID NO:1027-1097, SEQ ID NO: 1100-1179, SEQ ID NO:1182-1289, SEQ ID NO: :1292-1408, SEQ ID NO: 1411-1528, SEQ ID NO: 1531-1639, SEQ ID NO:1642-1748, SEQ ID NO:1751-1927 and SEQ ID NO: 1930-2051, for said at least one Peanut SP gene, and any combination thereof, or (b) a ribonucleoprotein (RNP) complex comprising Cas protein and gRNA sequence selected from the group consisting of SEQ ID NO:1027-1097, SEQ ID NO: 1100-1179, SEQ ID NO:1182-1289, SEQ ID NO:1292-1408, SEQ ID NO:1411-1528, SEQ ID NO:1531-1639, SEQ ID NO:1642-1748, SEQ ID NO: 1751-1927 and SEQ ID NO:1930-2051, for said at least one Peanut SP gene, and any combination thereof. The recited Cas DNA and gRNA sequences would target these genes, and therefore the scope of claims 11 and 12 are the same.
In claims 14 and 16, “Agrobacterium” should be italicized.
In claims 1-8, 11-12, 14 and 16, the names of all the genes should also be italicized.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 9-10 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999).
Claim 9 and 10 depend from claim 1. Claim 1 recites “… introducing by targeted genome editing a loss of function mutation…” (line 4, emphasis added). However, dependent claim 9 recites “… or duplication...” (line3). The Applicant defines a loss of function mutation as “a type of mutation in which the altered gene product lacks the function of the wild-type gene. A synonym of the term included within the scope of the present invention is null mutation (spec, p. 30, para 0143). The recitation of “duplication” in claim 9 renders the claim indefinite, as gene duplications do not result in a loss of function of a gene.
Claim 10 recites “silencing mutation” or “a knockdown mutation”. The Applicant describes gene silencing and gene knockdown as, "When genes are silenced, their expression is reduced…. Gene silencing may be considered a gene knockdown mechanism since the methods used to silence genes, such as RNAi, CRISPR, or siRNA, generally reduce the expression of a gene by at least 70% but do not completely eliminate it”. The is contrasted with a gene knockout, in which a gene is completely not expressed (spec, p. 30, para 0142). The recitations of “silencing mutation” and “knockdown mutation” in claim 10 render the claim indefinite, as such mutations result in a reduction of gene expression that is not complete, which is inconsistent with the definition in the specification for “loss of function”, which requires a lack of function of a wild-type gene.
Claims 14 and 16 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 14 and 16, the phrase "such as" renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention or used as an example. See MPEP § 2173.05(d).
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 9-10 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claims 9 and 10 depend from claim 1. Claim 1 recites “… introducing by targeted genome editing a loss of function mutation…” (line 4). However, dependent claim 9 recites “… or duplication…” (line3) and claim 10 recites “silencing mutation” or “a knockdown mutation”. Claims 9-10 does not further restrict claim 1 but actually broaden the scope of the invention as recited in claim 1, as these types of mutations do not result in loss of function, as defined in the specification (paragraph [0143]).
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Description
Claims 1-16 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 1-16 encompass a method for producing a modified peanut plant exhibiting at least one improved domestication trait by introducing a loss-of-function trait in a SP gene among AhSP1-AhSP9 in a Peanut plant comprising a sequence having at least 75% identity to a sequence selected from SEQ ID NO:1025, SEQ ID NO:1098, SEQ ID NO:1180, SEQ ID NO:1290, SEQ ID NO:1409, SEQ ID NO:1529, SEQ ID NO:1640, SEQ ID NO:1749 and SEQ ID NO:1928, or a functional variant thereof and any combination thereof (as recited in claim 2 and 5).
The describes AhSP1-AhSP9 genes comprising a sequence having 100% sequence identity to SEQ ID NO:1025, SEQ ID NO:1098, SEQ ID NO:1180, SEQ ID NO:1290, SEQ ID NO:1409, SEQ ID NO:1529, SEQ ID NO:1640, SEQ ID NO:1749 and SEQ ID NO:1928 encoding polypeptides having 100% sequence identity to instant SEQ ID NO: 1026, SEQ ID NO: 1097, SEQ ID NO: 1181, SEQ ID NO: 1291, SEQ ID NO: 1410, SEQ ID NO: 1530, SEQ ID NO: 1641, SEQ ID NO: 1750 and SEQ ID NO: 1929, respectively (spec, p.65, para 0302, table 1).
The Applicant does not describe any AhSP gene comprising less than 100% sequence identity to any of the specific sequence(s) recited in the claims while claiming the broad genus of at least 75% sequence identity to polynucleotide sequences of 1239 to 3658 nucleotide long. Mutating up to 25% of the nucleotide sequence allows mutating up to 309 (for SEQ ID NO: 1025) to 914 (for SEQ ID NO: 1749) nucleotides anywhere in the genomic sequences including intron, UTR, terminator and other regulatory sequences (as applicable) in the AhSP1-AhSP9 genes. Mutating including deleting nucleotides in the non-coding region are less likely to develop any loss-of-function mutation. On the other hand, randomly mutating any amino acid coding nucleotide sequence in domains not related to domestication trait also does not develop any loss-of-function mutation.
Claims 2 and 5 also recite “a functional variant thereof”. The Applicant defines the term “functional variant” as “a sequence or part of a sequence which retains the biological function of the full non-variant allele (e.g. Peanut SP genes) and hence has the activity of SP expressed gene or protein” (spec, p.35, para 0163). However, neither the claims nor the specification defines any specific function(s), especially traits which are not related to domestication (if any), of the peanut the SELF PRUNING (SP) gene(s). The specification does not correlate SP gene function with any sequence other than those set forth in SEQ ID NOs: 1025, 1098, 1190, 1290, 1409, 1529, 1640, 1749, and 1928. The Applicant also does not define/describe any domain or motif of the AhSP genes and/or polypeptides related to improved domestication trait.
Current status of the art also does not describe any structure-function relationship of the SP gene(s) with any domestication trait to allow a skilled artisan to mutate up to 75% of any or all of the AhSP gene(s) to get improved domestication trait.
Considering the breadth of the claims, lack of representative species of the broad genus claimed, lack of structure function relationship of the broad genus claimed, and unpredictability of the art, the Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-16 are rejected under 35 U.S.C. 103 as being unpatentable over Jin et al. (Molecular and transcriptional characterization of phosphatidyl ethanolamine-binding proteins in wild peanuts Arachis duranensis and Arachis ipaensis, 2019, BMC Plant Biology, 19:484) in view of Yuan et al. (Mutagenesis of FAD2 genes in peanut with CRISPR/Cas9 based gene editing, 2019, BMC Biotechnology, 19:24) and in evidence of Pnueli et al. (The SELF-PRUNING gene of tomato regulates vegetative to reproductive switching of sympodial meristems and is the ortholog of CEN and TFL1, 1998, Development 125:1979-1989), Chen et al. (CRISPR/Cas Genome Editing and Precision Plant Breeding in Agriculture, 2019, Annu. Rev. Plant Biol., 70:667–97), Krylova et al. (Determinate growth habit of grain legumes: role in domestication and selection, genetic control, 2020, Ecological Genetics,18:43-58) and Singh, A. L. (Growth and physiology of groundnut in Groundnut research in India 6, 2004: 178-212).
Claim 1 is drawn to a method for producing a modified peanut plant ((Arachis hypogaea) with at least one improved domestication trait by introducing targeted genome editing to produce a loss of function mutation in a SELF PRUNING (SP) gene.
The Applicant describes that the invention relates to producing legume plants with improved traits by manipulating genes controlling plant architecture (abstract), which is a major domestication trait.
Jin et al. teaches that plant architecture and/or flowering time (which is also part of plant architecture and a known domestication trait) in wild type peanut species Arachis duranensis and Arachis ipaensis, the diploid ancestors of cultivated (allotetraploid) peanuts (A. hypogaea) (abstract), are determined by specific members of the PEBP family of genes which are classified into three groups: TERMINAL FLOWER1 (TFL1)-like, FLOWERING LOCUS T (FT)-like, and MOTHER OF FT AND TFL1 (MFT)-like sub-families (p. 2, left column, para 3, line 1-4). TFL1 is involved in the regulation of plant architecture and flowering time (p. 2, left column, para 3, line 18-20).
All these genes of the PEBP family can be interpreted as “functional variant” of a AhSP gene.
Jin et al. describes that AraduF950M/AraduWY2NX in A. duranensis, and Araip344D4/ Araip4V81G in A. ipaensis regulate plant architecture (abstract). AraduF950M, AraduWY2NX, Araip344D4 and Araip4V81G are the members of the TFL1 family in wild peanut species (p. 4, Table 1). Genes homologous to TFL1 have been shown to be involved in plant architecture regulation in many plants including in legumes, such as soybean (GmDt1), common bean (PvTFL1y), and mungbean (VrDet1), and these genes are syntelogs (p.13, right column, para 3, line 13-16). Synteny between AraduF950M/AraduWY2NX, Araip344D4 /Araip4V81G, GmDt1, and PvTFL1y are described by Jin et al. while suggesting that they function in plant architecture regulation (p.13, right column, para 3, line 17-21).
It is known in the art that SELF PRUNING (SP) genes in a plant (e.g. in tomato) are also referred to as TERMINAL FLOWER 1 (TFL1) genes (Pnueli et al., abstract) which are also known as TERMINAL FLOWER 1 (TFL1)-like genes.
Searching published (before the effective filing date of the invention) cultivated peanut (A. hypogaea) genome databases using the TFL1 protein AraduWY2NX, as present in wild peanut species A. duranensis, identifies a polypeptide (Phytozome Gene ID: Ahline8.06G141300; Peanut genome database published in 2019) having 100% sequence identity to instant SEQ ID NO: 1181 encoded by instant SEQ ID NO: 1180 (spec, p. 65, Table 1) (as recited in claims 2 and 5) (data not shown). The genomic sequence of Gene ID: Ahline8.06G141300 comprises 100% sequence identity to instant SEQ ID NO: 1180 (as shown below), as recited in claims 2 and 5.
Title: US-19-025-222-1180
Perfect score: 1525
Sequence: 1 aagctaagctagtaattgta..........aattactactttaggatttg 1525
Searched: 1 seqs, 1185 residues
Database : NASEQ2_06092026_122929.fasta:*
RESULT 1
NASEQ2_06092026_122929
Best Local Similarity 100.0%; Query Match 77.7%; Score 1185; DB 1; Length 1185;
Matches 1185; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 99 ATGGCAAGAATAATGTCATCAGAGCCTTTAATTGTAGGGAGAGTGGTAGGAGATGTTCTT 158
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGGCAAGAATAATGTCATCAGAGCCTTTAATTGTAGGGAGAGTGGTAGGAGATGTTCTT 60
Qy 159 GATCCATTCAATGCAAGCATAAGGATGAGTGTTAGTTATGGGAACAGGCAAGTGTACAAT 218
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 GATCCATTCAATGCAAGCATAAGGATGAGTGTTAGTTATGGGAACAGGCAAGTGTACAAT 120
Qy 219 GGCCATGAGTTCTTCCCCTCCACAGTCACCTTCAAGCCCAAGGTTGAGATTGGTGGAACT 278
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 GGCCATGAGTTCTTCCCCTCCACAGTCACCTTCAAGCCCAAGGTTGAGATTGGTGGAACT 180
Qy 279 GAATTGAGGCCCTTCTTTACACTGGTTGGTACCTCTATATATATATATACTCCTCTCATC 338
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 GAATTGAGGCCCTTCTTTACACTGGTTGGTACCTCTATATATATATATACTCCTCTCATC 240
Qy 339 TCTTCTTCTTTTGTTCCTTTTTCTCTTTATAGGTTTAAAAATGGGAAAATCTTTGGCAGT 398
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 TCTTCTTCTTTTGTTCCTTTTTCTCTTTATAGGTTTAAAAATGGGAAAATCTTTGGCAGT 300
Qy 399 TTGGCTGTTGTTATTATCTTTATATAATAATAGTAATAGTAGCTGGCTCTATTATAATAG 458
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 TTGGCTGTTGTTATTATCTTTATATAATAATAGTAATAGTAGCTGGCTCTATTATAATAG 360
Qy 459 CTGGTGGCTACTTCTACGAGAATGTCTTCGTGTAAAGACAATATATGAATTATTAGATGA 518
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 CTGGTGGCTACTTCTACGAGAATGTCTTCGTGTAAAGACAATATATGAATTATTAGATGA 420
Qy 519 TGCAGTTAAACAGTTCATAATATCATCTACGTTTTCATAGAAGTAGCCAACACTAATACG 578
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 TGCAGTTAAACAGTTCATAATATCATCTACGTTTTCATAGAAGTAGCCAACACTAATACG 480
Qy 579 GTCAGTAGTATTATGATACATATATATACGTAGAATGTAAATGTCTCTCTTTTGGGTTGC 638
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 GTCAGTAGTATTATGATACATATATATACGTAGAATGTAAATGTCTCTCTTTTGGGTTGC 540
Qy 639 AGGTCATGACTGATCCGGATGTTCCTGGCCCTAGTGATCCTTATCTCAGAGAGCACTTGC 698
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 AGGTCATGACTGATCCGGATGTTCCTGGCCCTAGTGATCCTTATCTCAGAGAGCACTTGC 600
Qy 699 ATTGGTAAAACTTAATTAAATTTTTACTACATGAAAATTAATTAGGGTAACAACTAAAAC 758
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 ATTGGTAAAACTTAATTAAATTTTTACTACATGAAAATTAATTAGGGTAACAACTAAAAC 660
Qy 759 CAAAATAAAACAGCTGTTTATTACAAACACATAATGCATCATTTGGTCATATGAAAGAGA 818
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 CAAAATAAAACAGCTGTTTATTACAAACACATAATGCATCATTTGGTCATATGAAAGAGA 720
Qy 819 CACACATATTATCACGATTCATAGGCATGCATTAATTTCACATAGCTAGAGGTGTATCTA 878
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 721 CACACATATTATCACGATTCATAGGCATGCATTAATTTCACATAGCTAGAGGTGTATCTA 780
Qy 879 GATCTCTAAGAGTCAAGCATATTAAAAAAATTGAAATATATATCTGCAGGATAGTTACAG 938
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 781 GATCTCTAAGAGTCAAGCATATTAAAAAAATTGAAATATATATCTGCAGGATAGTTACAG 840
Qy 939 ACATTCCAGGCACAACAGATGCCACATTTGGTAGGTCTCTCATTCCTCTTTTGATATCTA 998
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 841 ACATTCCAGGCACAACAGATGCCACATTTGGTAGGTCTCTCATTCCTCTTTTGATATCTA 900
Qy 999 TGGACACTACAAGACTGAGAAATAATAATAATGATGTTGATGTATGTTTAATTATTTGTT 1058
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 901 TGGACACTACAAGACTGAGAAATAATAATAATGATGTTGATGTATGTTTAATTATTTGTT 960
Qy 1059 TTAGGGAAAGAGTTGGTGAGCTACGAGATGCCAAAGCCTAACATTGGGATCCATAGGTAT 1118
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 961 TTAGGGAAAGAGTTGGTGAGCTACGAGATGCCAAAGCCTAACATTGGGATCCATAGGTAT 1020
Qy 1119 GTTTTTGTGCTCTTCAAGCAAAAACGAAGGCAGTGTGTTAGCACCATTCCTTCTTGCAGG 1178
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1021 GTTTTTGTGCTCTTCAAGCAAAAACGAAGGCAGTGTGTTAGCACCATTCCTTCTTGCAGG 1080
Qy 1179 GATCACTTCAACACCCGCACTTTCGCCGCCGATAACGACCTCGGCCTCCCCGTCGCTGCC 1238
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1081 GATCACTTCAACACCCGCACTTTCGCCGCCGATAACGACCTCGGCCTCCCCGTCGCTGCC 1140
Qy 1239 GTCTACTTCAATGCTCAGAGGGAAACCGCTGCCAGGAGGCGTTAA 1283
|||||||||||||||||||||||||||||||||||||||||||||
Db 1141 GTCTACTTCAATGCTCAGAGGGAAACCGCTGCCAGGAGGCGTTAA 1185
The coding region (cDNA sequence) of the peanut gene (Gene ID: Ahline8.06G141300) comprises a sequence having 100% sequence identity to instant SEQ ID NO: 1184, as recited in claims 11-12, as shown below.
Title: US-19-025-222-1184
Perfect score: 20
Sequence: 1 atgacattattcttgccatt 20
Searched: 1 seqs, 327 residues
Database : NASEQ2_05202026_124309.fasta:*
RESULT 1
Best Local Similarity 100.0%; Query Match 95.0%; Score 19; DB 1; Length 327;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGACATTATTCTTGCCAT 19
|||||||||||||||||||
Db 19 ATGACATTATTCTTGCCAT 1
However, Jin et al. does not explicitly describe any method to develop a peanut plant with improved domestication trait by using targeted genome editing and producing a loss of function mutation in any SELF PRUNING (SP) or TFL1 gene.
Developing targeted loss-of-function mutant(s) of specific gene(s) in a plant using CRISPR-Cas mediated targeted genome editing technique is well known and a standard practice in the art (Chen et al.; p. 678, para 4 and entire section 5.1). Yuan et al. explicitly describes CRISPR-Cas9 based targeted genome editing in peanut using appropriate sgRNA (also known as gRNA) and Cas9 endonuclease (title and abstract), as recited in claim 3. Yuan et al. also describes transforming peanut plant cells using the p201B-Cas9 binary vector (Addgene #59177) that comprises the nucleotide sequence encoding Cas9 endonuclease (as recited in claims 6-7) and the gRNAs (p. 5, right column, para 2, line 1-2). Yuan et al. also describes a gRNA comprising the PAM motif of GGG, which reads on to NGG, as recited in claims 13 and 15.
Yuan et al. describes several methods including particle bombardment (reads on “gene gun biolistic”) and Agrobacterium based transformation (p.2, right column, para 2, line 7-8; p.4, left column, para 1, line 21-23), as recited in claims 14 and 16, to transform peanut cells. Screening the genome of transformed cells by isolating genomic DNA and using methods like nucleic acid amplification or PCR (Yuan et al., p. 7, left column, last para, line 1-4), regenerating plants having the target mutation and screening regenerated plants with improved trait(s) (Yuan et al., p.4, left column, last para, line 33-35), as recited in claims 3-4, are routine and standard methods in the art.
Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to mutate/delete the ortholog of AraduWY2NX, as described by Jin et al., in a cultivated peanut plant. Preponderance of evidence including the synteny between AraduWY2NX, soybean Dt1 (GmDt1) and common bean (PvTFL1y) (Jin et al., supplemental file 5) shows that ortholog(s) of AraduWY2NX in cultivated peanut (A. hypogea) is involved in determining plant architecture and/or flowering time, as described by Jin et al.
It is prudent to mention here that (loss-of-function) mutations of GmDt1 and PvTFL1y are known to transform soybean and common bean legume plants, respectively, with indeterminate type architecture (with late flowering) into determinate type with early flowering trait (Krylova et al., p.52, table 1).
Before the effective filing date, an ordinarily skilled artisan would have been motivated to mutate/delete the ortholog of AraduWY2NX in a cultivated peanut plant, for producing loss-of-function deletion/knockout mutant(s) (as recited in claims 9-10), with a realistic goal to modify the architecture and/or flowering time of the cultivated peanut plant. Singh A.L. describes that peanut (also known as groundnut) plants are mostly indeterminate (perennial) although peanut plants with determinate (annual) type do occur (p.2, right column, para 5, line 2-4). Singh A.L. teaches that developing determinate type peanut plants would be beneficial as the distribution of available photosynthate to reproductive components would have been improved by selecting for more determinate type plants (p. 14, left column, last para, last 3 lines).
Regarding claim 8, It is known in the art that genomic change(s) resulting in mutated allele(s) due to CRISPR-Cas mediated genome editing is/are heritable.
Regarding claims 11-12, designing suitable gRNA(s) based on the nucleotide sequence (mainly in the coding region) using a software (Yuan et al., p. 4, right column, last para, line 31-32; p.5, left column, last para, line 6- 11) to delete/edit any specific target gene is well known and a standard practice in the art. It would have been an experimental design choice of an ordinarily skilled artisan to use any specific sequence including instant SEQ ID NO: 1184 (preferably) having 100% sequence identity to a target site within the coding region of the AraduWY2NX ortholog in cultivated peanut (A. hypogaea), as discussed above.
Conclusion
No claim is allowed.
Communication
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
J.C.
/Jay Chatterjee/ Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/ Supervisory Patent Examiner, Art Units 1661 & 1662
Prosecution Insights