Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Claims
Claims 1-8 are pending.
Claims 1-8 are examined herein.
Priority
Applicant claims the priority of Chinese Utility Model Application No. 202311537245.3, filed on November 17, 2023. Availability of a certified patent document in a digital library from WIPO was filed on 03/03/2025 for this application.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (see paragraphs 59 and 95). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
The examiner noted nucleotide sequences in the disclosure did not contain SEQ ID NOs. For example, see paragraphs 102, 104, and 105. All sequences in the disclosure must conform to CFR §§ 1.821 -1.825 (see MPEP § 2422) which requires all sequences in the disclosure to be given SEQ ID NOs.
Appropriate correction is required.
Information Disclosure Statement
The references indicated in the specification, such as in paragraphs 64, 71, 93, and throughout the disclosure, are not listed in a proper information disclosure statement. For example, 37 CFR § 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Drawings
The drawings submitted on 01/17/2025 are objected to for containing sequences without SEQ ID NOs. See figures 7A-F, 9B-C, and 10A.
Nucleotide and/or Amino Acid Sequence Disclosures
Specific deficiency - Sequences appearing in the specification (See above in objections to the drawings and specifications) are not identified by sequence identifiers (i.e., “SEQ ID NO:X” or the like) in accordance with 37 CFR 1.831(c).
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Claim Objections
Claims 1-4 and 6 are objected to for stating gene names which are not italicized.
Claims 1-2 does not need “Gene” to be capitalized.
Claim 2 does not need “Maize” to be capitalized.
Claim 4 is objected to for using the word “with” in the second line which is grammatically incorrect. It should also have “a” between “in” and “plant” in line 1.
Claim 6 is objected to for using species names “Arabidopsis”, “Arabidopsis thaliana” and “Agrobacterium” without italics.
Claim Interpretation
Claims 1-8 referencing “ZmTAS3j” are understood to be referencing a gene with the sequence outlined in SEQ ID NO:1 and disclosed in paragraph 8 of the disclosure.
Claims 3-8 use the phrase “Overexpression”. This phrase is not explicitly described in the specification. The examiner does not interpret it to mean natural variation in gene expression from any processes found in nature. The examiner does interpret the overexpression to result from a transformation event with a synthetic heterologous engineered construct with a promoter (i.e. Ubi or 35S) and terminator; as described in the specification.
The term “Homologous recombination” is recited in Claims 4-5 and 7-8 but is undefined in the specification. It is interpretated to mean “plasmid cloning by PCR” as it is a method also directed to cloning a gene into a vector using primers and restriction sites1.
Claim 6 uses the phrase “mismatch PCR amplification” which is not defined in the specification. The examiner is interpreting the homologous recombination primers in Claim 8 to be involved in this process and encodes primers that do not align to the 5’ target miR390 site. This would result in an amplicon with a mutated sequence in the miR389 site.
Claim Rejections - 35 USC § 112 (b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 6 and dependent claims 7-8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 6 is directed to a method of overexpressing ZmTAS3j, which has a sequence outlined in SEQ ID NO: 1. However, the claim later recites generating a mutated version (i.e. ZmTAS3jmut) which would not have SEQ ID NO:1 and transforming it into Arabidopsis in step 2 and 3 of claim 6. Paragraph 135 of the disclosure discusses how ZmTAS3j was mutated (i.e. has a different sequence) to make ZmTAS3jmut. It is unclear if the applicant is claiming a method of overexpressing ZmTAS3jmut or ZmTAS3jmut in Arabidopsis. It is also unclear on what exact sequence is being transformed into the Arabidopsis, making it difficult for one of ordinary skill in the art to know what sequences are encompassed in this claim.
Claims 7-8 are also rejected as being directed to homologous recombination primers used in steps 1 and 2 of Claim 6. There is lack of antecedent basis, as Claim 6 does not explicitly list homologous recombination primers or primers of any kind.
Claim Rejections - 35 USC § 112 (a)
Scope of Enablement
Claim 3 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for generating Arabidopsis and Maize plants with increased resistance to lead, it does not reasonably provide enablement for conferring increased lead resistance in all possible plant species. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
The claim is broadly drawn to a method for improving plant tolerance to lead stress, comprising overexpressing ZmTAS3j in a plant.
Applicant does demonstrate a method for overexpressing ZmTAS3j in maize which conveys increased lead resistance.
Applicant does demonstrate a method for overexpressing ZmTAS3j in Arabidopsis which conveys increased lead resistance.
Page 2 paragraph 3 of Dotto, Marcela C., et al. "Genome-wide analysis of leafbladeless1-regulated and phased small RNAs underscores the importance of the TAS3 ta-siRNA pathway to maize development." PLoS genetics 10.12 (2014): e1004826 teaches “while the TAS3 ta-siRNA pathway is evolutionarily conserved, the number and nature of phased siRNA loci vary greatly between plant species. Additionally, the teachings of Mendoza-Soto, Ana B., Federico Sánchez, and Georgina Hernández. "MicroRNAs as regulators in plant metal toxicity response." Frontiers in Plant Science 3 (2012): 105 teaches a known but uncharacterized relationship between TAS3 genes and the miR390 used to generate the Ta-SIRNAs (i.e. tasiRNA in paragraph 5 of the specification) in the response to heavy metals. This is described on page 3 paragraph 6 in “miR390” section and Table 1. Page 5 paragraph 1 also states “Further research is needed to deeply understand the role of miRNAs and their targets, mainly TFs, as main players in signaling pathways of plant responses to environmental changes. This should take into account that plant species varying in growth habits and genotypic backgrounds may have differential responses of miRNAs to metal stresses.” This passage emphasizes the relationship between miR390 and its target, TAS3 genes, and their relationship with heavy metals require further research and in different species.
These factors pertaining to how TAS3 is able to convey lead resistance to all plants do not appear to have been adequately addressed in the instant application.
Given the absence of guidance in the specification, and given the relatively high level of unpredictability in the art, one of skill in the art cannot predict the consequences of overexpressing ZmTAS3j, and their causal relationship to conferring increased lead resistance in all plant species. Accordingly, given the lack of guidance in the instant Specification, undue trial and error experimentation would have been required for one skilled in the art to use the claimed invention.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-2 are rejected under 35 U.S.C. 101 because the claimed method is directed to non-statutory subject matter. The claims do not fall within at least one of the four categories of patent eligible subject matter because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. The listed claims are
determined to be directed to subject matter that is naturally occurring, or to a law of nature/natural principle or natural phenomenon. The rationale for this determination is explained below.
The instantly pending claims are composition claims directed to a gene termed ZmTAS3j with the SEQ ID NO: 1. The application US 2017/0114356 Al has identified this polynucleotide sequence from maize transcripts and has been assigned the SEQ ID NO: 156220 (see alignment below). The sequence was identified from transcripts in maize varieties described in paragraph 187.
US-15-047-804-156220
Sequence 156220, US/15047804
Publication No. US20170114356A1
GENERAL INFORMATION
APPLICANT: EI DuPont de Nemours
APPLICANT: Thatcher, Shawn
APPLICANT: Li, Bailin
TITLE OF INVENTION: NOVEL ALTERNATIVELY SPLICED TRANSCRIPTS AND USES THEREOF FOR
TITLE OF INVENTION: IMPROVEMENT OF AGRONOMIC CHARACTERISTICS IN CROP PLANTS
FILE REFERENCE: BB2527USNP
CURRENT APPLICATION NUMBER: US/15/047,804
CURRENT FILING DATE: 2016-02-19
PRIOR APPLICATION NUMBER: 62/118,576
PRIOR FILING DATE: 2015-02-20
PRIOR APPLICATION NUMBER: 62/257,774
PRIOR FILING DATE: 2015-11-20
NUMBER OF SEQ ID NOS: 228453
SEQ ID NO 156220
LENGTH: 872
TYPE: DNA
ORGANISM: Zea Mays
Query Match 100.0%; Score 718; Length 872;
Best Local Similarity 100.0%;
Qy 1 GCGGTTTCGTTCTCCTTCCTGCCGCTGGCCGGCCGGCTGGTGGCAAGCTCGATCGAGCTA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 127 GCGGTTTCGTTCTCCTTCCTGCCGCTGGCCGGCCGGCTGGTGGCAAGCTCGATCGAGCTA 186
Qy 61 GGAGTCAGATGGAAGGCACGATGAAGCACAGCAACGTTGTGACGGAGAGGAGCTCTGTGA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 187 GGAGTCAGATGGAAGGCACGATGAAGCACAGCAACGTTGTGACGGAGAGGAGCTCTGTGA 246
Qy 121 CCAAGCCCCGTGAACAGGAGGTGTCCGCTTGGCATGATGAGGCTGGAGAGCGTCTGGTTT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 247 CCAAGCCCCGTGAACAGGAGGTGTCCGCTTGGCATGATGAGGCTGGAGAGCGTCTGGTTT 306
Qy 181 GGACGCCGAGAGCAGCAGTTCAGCTGATGCTTCATGCCTAGCATCAGCACGGCGTTATCC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 307 GGACGCCGAGAGCAGCAGTTCAGCTGATGCTTCATGCCTAGCATCAGCACGGCGTTATCC 366
Qy 241 TAATTGAGCTTTTCAGCCACCATCTTTATCCTTCCTCATATTCTCCATATCGTGATGCTT 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 367 TAATTGAGCTTTTCAGCCACCATCTTTATCCTTCCTCATATTCTCCATATCGTGATGCTT 426
Qy 301 GTGGTTTCGCAAGATCAGGTCTTCTTGACCTTGCAAGACCTTTTCTTGACCTTGTAAGAC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 427 GTGGTTTCGCAAGATCAGGTCTTCTTGACCTTGCAAGACCTTTTCTTGACCTTGTAAGAC 486
Qy 361 CCAACTCTACGATACATCTTTTCTTTGACCTAATCTTCTCTACCTCACACCTTTCTATCT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 487 CCAACTCTACGATACATCTTTTCTTTGACCTAATCTTCTCTACCTCACACCTTTCTATCT 546
Qy 421 GTTCTTACTTCTGTTCTATGTCTATCCCTTCTGAGCTGTGTTGAGCTACTTTGATAAAGC 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 547 GTTCTTACTTCTGTTCTATGTCTATCCCTTCTGAGCTGTGTTGAGCTACTTTGATAAAGC 606
Qy 481 TAGGTACTATAGATTAAGTGTTTTAGGAGGTGTTTCTCACATGTGTAATGTTGTGAGCTT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 607 TAGGTACTATAGATTAAGTGTTTTAGGAGGTGTTTCTCACATGTGTAATGTTGTGAGCTT 666
Qy 541 GCCGTGTGGGAAAAAAAAAATCCATTTTGATGGTAGCTATATAGAGTGAGGCATGAGACA 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 667 GCCGTGTGGGAAAAAAAAAATCCATTTTGATGGTAGCTATATAGAGTGAGGCATGAGACA 726
Qy 601 AACAAAAGTATGTTCCTGTTGCGCCATGAGCACATGATGCTCGGCCATGTGAAGTAGGCG 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 727 AACAAAAGTATGTTCCTGTTGCGCCATGAGCACATGATGCTCGGCCATGTGAAGTAGGCG 786
Qy 661 CCTACATGCAAGCTAAGCTAGCTAGCTCCGTATGTATCGCCTCGATGGAATAAGCTGC 718
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 787 CCTACATGCAAGCTAAGCTAGCTAGCTCCGTATGTATCGCCTCGATGGAATAAGCTGC 844
Evans, M. M. S., and J. L. Kermicle. "Teosinte crossing barrier1, a locus governing hybridization of teosinte with maize." Theoretical and Applied Genetics 103.2 (2001): 259-265 teaches that domesticated maize can cross with wild teosintes species, though it is uncommon. This is described in the first paragraph of the introduction. Because this gene is already present in the maize genome according to the disclosure and the teachings of US 2017/0114356 Al, it is possible maize and teosinte hybrids exist with this genetic sequence. These plant would also encounter lead in nature and use this gene to prevent toxicity, absent evidence to the contrary.
Claim Rejections - 35 USC § 102/103
A rejection under 35 U.S.C. § 102 or § 103 does not require the same analysis as a rejection under 35 U.S.C. § 102 or a rejection under 35 U.S.C. § 103. The rejection is made because the examiner cannot determine whether the prior art composition possesses characteristics that are not recited in the art. The examiner does not have sufficient facts to determine whether the claimed compositions, polynucleotides, polypeptides and organisms are inherently the same as the prior art compositions, polynucleotides, polypeptides and organisms. In addition, the examiner cannot conclude that the claimed subject matter would have been obvious since it cannot be determined whether the claimed and prior art compositions, polynucleotides, polypeptides and organisms differ. Where the prior art product seems to be identical, except that the prior art is silent to a characteristic or property claimed, then the burden shifts to applicants to provide evidence that the prior art would neither anticipate nor render obvious the claimed invention. In re Best, 195 USPQ 430, 433 (CCPA 1977).
Claims 1-3 are rejected as being anticipated under 35 U.S.C. § 102(a)(1), or alternatively as being unpatentable under 35 U.S.C. § 103, over the teachings of US 2017/0114356 Al.
Initially, Applicants concede that SEQ ID NO:1 is genomic DNA from Zea mays; see sequence listing.
In addition, publication US 2017/0114356 A1 has identified this polynucleotide sequence, as directed to in Claims 1-2, from maize RNA-seq libraries and has the SEQ ID NO: 156220. Claims 1-7 of US 2017/0114356 A1 are directed to recombinant DNA constructs comprising these polynucleotides (i.e. Claims 1-2) and transgenic plants (i.e. Arabidopsis and maize) as well as a method for producing transgenic plants with improved agronomic traits (i.e. resistance to heavy metals see paragraph 33) which was directed to in Applicant’s claim 3. Paragraph 151 teaches polynucleotides (i.e. SEQ ID NO:1) constructs may be stably integrated into the genome of a plant using genome editing while paragraph 152 teaches the recombinant DNA construct may comprise at least a promoter functional in a plant as a regulatory sequence (i.e., overexpressing).
Accordingly, US 2017/0114356 A1 anticipated the claimed invention.
In the alternative, it is possible that US 2017/0114356 Al does not explicitly teach every single limitation of the instant claims, and perhaps this could result in a method that is not identical to the instantly claimed method(s). However, a method for improving resistance to heavy metals that encompasses SEQ ID NO:1 and the use of regulatory elements for overexpression was previously taught and claimed in US 2017/0114356 Al (i.e. claims 7-8). This reads on applicant’s claim 3, because a plant overexpressing this sequence would inherently have increased lead resistance, because the plants taught in the art share the same structure (and therefore functions) as those that are instantly claimed.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim 3 is rejected under 35 U.S.C. 103 based on the teachings of Marin, Elena, et al. "miR390, Arabidopsis TAS3 tasiRNAs, and their AUXIN RESPONSE FACTOR targets define an autoregulatory network quantitatively regulating lateral root growth." The Plant Cell 22.4 (2010): 1104-1117 in view of Luo, Linlin, et al. "TRANS-ACTING SIRNA3-derived short interfering RNAs confer cleavage of mRNAs in rice." Plant physiology 188.1 (2022): 347-362 (Luo et al 2022).
Claims 3 is directed to a method for improving plant tolerance to lead (Pb) by overexpressing ZmTAS3j.
Marin et al 2010 teaches the overexpression of a TAS3 gene in Arabidopsis. This is described in the paragraph bridging pages 2 and 3. A picture showing the plants can be seen in Figure 1B and a description of how the mutant was made is described on page 12 paragraph 3.
Marin et al 2010 et al does not teach the overexpression of a maize TAS3 gene called ZmTAS3j or overexpression for increased lead tolerance.
Luo et al 2022 teaches monocots (i.e. maize) contain TAS3 family genes and are used to generate 21-nt phasiRNAs upon cleavage by miR390. The TAS3 siRNAs (tasiRNAs) can be used to regulate gene expression and is outlined in the passage “The miR390/tasiR-ARFs module regulates many developmental processes, such as lateral root growth, leaf patterning, and developmental timing in Arabidopsis, rice, maize, and even moss.” More importantly, page 11 paragraph 2, explicitly teaches TAS3-derived siRNAs have non-ARF targets and are conserved in grasses. Some of these targets are genes involved in heavy metal responses.
One having ordinary skill in the art would have been motivated to identify lead resistance genes as lead is a heavy metal that interferes with the physiology and metabolism of the plants when taken up. This leads to structure disruption, activity inhibition, and oxidative damage2. Additionally small RNA sequencing experiments to identify genes with differential expression in response to lead treatment is known in the art3. It would have been prima facie obvious to one of ordinary skill in the art overexpress ZmTAS3j because RNA seq is commonly performed to identify genes of interest in response to stress, protocols for identifying phase loci as TAS sites are known4, and TAS3 genes are known to be involved in heavy metal response.
Subject Matter Free of Art
Claims 4-8 appear to recite subject matter free of art.
Claims 4 and 5, further limit the overexpression of ZmTAS3j in a plant (i.e. claim 3). They are directed to a maize plant and the method comprises a Ubi promoter, nos terminator, and bar as the selective marker gene. Amplification primers can be generated according to the ZmTAS3j sequences to amplify the gene and used to construct an overexpression vector by homologous recombination using a BamHI restriction site. Primer sequences used for the homologous recombination are SEQ ID NOs:6-7.
The closest prior art appears to be “Plasmid cloning by PCR” by Addgene and was available on the web since 22-Feb-2018. This protocol teaches a method for designing primers that amplify a sequence of interest with overhanging restriction sites. Transformation into maize, a plasmid with a Ubi promoter, nos terminator, bar as the selective marker gene, and the specific primers sequences of SEQ ID NOs:6-7 are not discussed.
Claims 6-8 are directed to a method of overexpressing ZmTAS3j in Arabidopsis comprising the steps of (1) extracting total RNA from B73 inbred lines and reverse-transcribing the RNA into cDNA then amplifying the sequences of ZmTAS3j, and constructing the sequences of ZmTAS3j into pRIl01-AN expression vector with EcoRI as the restriction site; (2) mutating 5' target of miR390 in the sequence of ZmTAS3j by mismatch PCR amplification, and destroying the 5' target of miR390, constructing the mutant sequence of ZmTAS3j into pRIl01-AN expression vector with EcoRI as the restriction site; (3) transforming plasmids into Agrobacterium GV3101 and obtaining Arabidopsis transgenic plants by inflorescence soaking. The homologous recombination primer used in the step (1) comprise SEQ ID NOs: 2-3. The homologous recombination primers used in the step (2) comprise SEQ ID NOs: 4-5.
The closest prior art appears to be Montgomery, Taiowa A., et al. "Specificity of ARGONAUTE7-miR390 interaction and dual functionality in TAS3 trans-acting siRNA formation." Cell 133.1 (2008): 128-141. It teaches how the TAS3a gene’s 5’ proximal miR390 can be made non-functional by mutating it. This was taught in Supplementary Figures 1-2 and page 2 paragraphs 5-6 in the “Distinct Roles for miR390 at the TAS3a 5’ and 3’ Target Sites” section. It does not discuss mutations in the ZmTAS3j gene or its ability to convey resistance to lead or maize TAS3 genes.
Conclusion
Claims 1-3 and 6-8 are rejected.
Claims 4-5 are objected to as being dependent upon a rejected base claim. However, they would be allowable if rewritten in independent form, to include all of the limitations of the base claim and any intervening claim(s).
Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to GEORGE W MEYER whose telephone number is (571)272-3733. The examiner can normally be reached Monday - Friday 8:00 am- 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/GEORGE W MEYER/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Unit s 1661 &1662
1 See Addgene Plasmid Cloning by PCR 2018
2 See page 2 paragraph of Wang, Yan, et al. "Identification of radish (Raphanus sativus L.) miRNAs and their target genes to explore miRNA-mediated regulatory networks in lead (Pb) stress responses by high-throughput sequencing and degradome analysis." Plant Molecular Biology Reporter 33.3 (2015): 358-376.
3 See Materials and Methods “Transcriptome, sRNA and Degradome Library Construction
and High-Throughput Sequencing” and Bioinformatics Analyses of Wang et al 2015.
4 See Luo et al 2022 in the materials and methods section Homologous gene identification section on page 13
Prosecution Insights