DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 21-28 and 33-40 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Humphrey et al. U.S. Patent Application Publication No. 2020/0291413, published Sep. 17, 2020.
Claim 21 is drawn to a modified tobacco plant, or part thereof, comprising a non-natural mutation in a polynucleotide, the polynucleotide encoding a polypeptide comprising at least 95% identity to amino acid sequence of SEQ ID NO: 83; wherein said modified tobacco plant comprises nicotine at a level below 60% of the nicotine level of a control plant when grown in similar growth conditions, wherein said non-natural mutation introduces a stop codon; wherein said control plant shares an essentially identical genetic background with said modified tobacco plant except said non-natural mutation; and wherein said non-natural mutation results in a reduced level of expression of said polynucleotide as compared to said control tobacco plant.
Claim 22 is drawn to the modified tobacco plant, or part thereof, of claim 21, wherein said polynucleotide encodes a polypeptide comprising at least 99% identity to SEQ ID NO: 83.
Claim 23 is drawn to the modified tobacco plant, or part thereof, of claim 21, wherein said polynucleotide encodes a polypeptide comprising SEQ ID NO: 83.
Claim 24 is drawn to the modified tobacco plant, or part thereof, of claim 21, wherein said polynucleotide comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO: 13.
Claim 25 is drawn to the modified tobacco plant, or part thereof, of claim 21, wherein said polynucleotide comprises a nucleic acid sequence having at least 99% identity to SEQ ID NO: 13.
Claim 26 is drawn to the modified tobacco plant, or part thereof, of claim 21, wherein said polynucleotide comprises SEQ ID NO: 13.
Claim 27 is drawn to the modified tobacco plant, or part thereof, of claim 21, wherein said modified tobacco plant further comprises a reduced level of at least one alkaloid selected from the group consisting of anabasine, anatabine, and nornicotine as compared to said control tobacco plant.
Claim 28 is drawn to the modified tobacco plant, or part thereof, of claim 21, wherein said modified tobacco plant comprises a nicotine level less than 2.0%.
Claim 33 is drawn to the modified tobacco plant, or part thereof, of claim 21, wherein said modified tobacco plant is a modified Nicotiana tabacum plant.
Claim 34 is drawn to a method of producing a modified tobacco plant, the method comprising the steps of:
(a) inducing a non-natural mutation in at least one tobacco cell in an endogenous nucleic acid sequence encoding a polypeptide comprising an amino acid sequence at least 95% identical to SEQ ID NO: 83;
(b) selecting at least one tobacco cell comprising said non-natural mutation from step (a); and (c) regenerating at least one modified tobacco plant from said at least one tobacco cell selected in step (b); wherein said at least one modified tobacco plant comprises a reduced amount of at least one alkaloid as compared to a control tobacco plant lacking said non-natural mutation.
Claim 35 is drawn to the method of claim 34, wherein said endogenous nucleic acid sequence is at least 95% identical to SEQ ID NO: 13.
Claim 36 is drawn to the method of claim 34, wherein said at least one alkaloid is selected from the group consisting of anabasine, anatabine, nicotine, and nornicotine.
Claim 37 is drawn to the method of claim 34, wherein said at least one modified tobacco plant comprises a nicotine level less than 2.0%.
Claim 38 is drawn to the method of claim 34, wherein said at least one modified tobacco plant is a modified Nicotiana tabacum plant.
Claim 39 is drawn to the method of claim 34, wherein said method further comprises:
(d) growing said at least one modified tobacco plant regenerated in step (c).
Claim 40 is drawn to the method of claim 39, wherein said method further comprises:
(e) crossing said at least one modified tobacco plant grown in step (d) with a second tobacco plant; and
(f) obtaining at least one seed from said crossing in step (e).
Humphrey et al. teach a modified Nicotiana tabacum plant comprising a non-natural mutation that introduces a stop codon in a polynucleotide and results in a reduced level of expression of said polynucleotide as compared to control tobacco plant, the polynucleotide comprising the nucleotide sequence of SEQ ID NO:13 and encoding a polypeptide having the amino acid sequence of SEQ ID NO: 83 (Example 14 paragraphs [0653]-[0659]; Figures 14, 15, 16; see sequence alignments below between SEQ ID NO: 13 and SEQ ID NOS: 5-7 of Humphrey et al.; see sequence alignments below between SEQ ID NO: 83 and the amino acid sequence encoded by SEQ ID NOS: 5-7 of Humphrey et al.). The modified tobacco plant of Humphrey et al. comprises nicotine at a level below 60%, and less than 2.0%, of the nicotine level of a control plant, and further comprises a reduced level of at least one alkaloid selected from the group consisting of anabasine, anatabine, and nornicotine as compared to a control tobacco plant (Example 14 paragraphs [0653]-[0659]; Figure 86). Humphrey et al. also teach methods of making their tobacco plant, including methods wherein a tobacco plant is regenerated, and methods that require the crossing of tobacco plants and collection of seed (paragraph [0642]; Example 14 paragraphs [0653]-[0659]). Accordingly, Humphrey et al. anticipate claims 21-28 and 33-40.
Sequence alignment between SEQ ID NO: 13 and SEQ ID NOS: 5-7 of Humphrey et al:
Qy 1 ATGGCAATGGAAATGAATCCAGCTGACGAAACCTTGTTTTTCTCCGACTCTCATCTCCTT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGGCAATGGAAATGAATCCAGCTGACGAAACCTTGTTTTTCTCCGACTCTCATCTCCTT 60
Qy 61 GAATCGATAAAGCAACATCTTCTTGACGATTCAGATTTTTCTGAAATTTTTTCGTCGATG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 GAATCGATAAAGCAACATCTTCTTGACGATTCAGATTTTTCTGAAATTTTTTCGTCGATG 120
Qy 121 AATTCTAGCAACGAAATATTGCCTAACAGTCCTAGCTCAAGTTTTAGCAGCTTCGACTTC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 AATTCTAGCAACGAAATATTGCCTAACAGTCCTAGCTCAAGTTTTAGCAGCTTCGACTTC 180
Qy 181 GACTGCAGCTTCCTTAATTGGGATGAAAACTCTGAGGAAACATTAATACCAACTGATCAG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 GACTGCAGCTTCCTTAATTGGGATGAAAACTCTGAGGAAACATTAATACCAACTGATCAG 240
Qy 241 AATCCTTCACATGAATCCCATGAAAAGTACTCCGAGTCCGAGGAGAAAACCCAGGGCCCT 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 AATCCTTCACATGAATCCCATGAAAAGTACTCCGAGTCCGAGGAGAAAACCCAGGGCCCT 300
Qy 301 GGGGTGGCGCGTGAGAAAAACGCGCCGCGAGATTGGACGCGGTACATAGGAGTGAAACGG 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 GGGGTGGCGCGTGAGAAAAACGCGCCGCGAGATTGGACGCGGTACATAGGAGTGAAACGG 360
Qy 361 CGACCGTGGGGGACGTTTTCGGCGGAGACAAGAGACCCAAGTAGGAAAGGTGAAGGTGCA 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 CGACCGTGGGGGACGTTTTCGGCGGAGACAAGAGACCCAAGTAGGAAAGGTGAAGGTGCA 420
Qy 421 AGGCTGTGGTTAGGAACTTACGAGACCGCAGAGGATGCAGCGTTAGCTTACGATCAAGCC 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 AGGCTGTGGTTAGGAACTTACGAGACCGCAGAGGATGCAGCGTTAGCTTACGATCAAGCC 480
Qy 481 GCTTTCAAAATCCGCGGCTCGAGAGCTCGGCTCAATTTTCCTCACTTAATCGGCTCAAAC 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 GCTTTCAAAATCCGCGGCTCGAGAGCTCGGCTCAATTTTCCTCACTTAATCGGCTCAAAC 540
Qy 541 ATGCCTAAGCCGGCTAGAGTTACAGCGAGGCGTAGTCGTACGCGCTCACCCGAGCCATCG 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 ATGCCTAAGCCGGCTAGAGTTACAGCGAGGCGTAGTCGTACGCGCTCACCCGAGCCATCG 600
Qy 601 TCTTCTTCATCCACCTCATCATCAGAAAATGTACCAAGGAAAAGGAATATAGATGTGATA 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 TCTTCTTCATCCACCTCATCATCAGAAAATGTACCAAGGAAAAGGAATATAGATGTGATA 660
Qy 661 AATTCCATAGCCAAAGCCAAATTCCTTTGTCATAGCTTGAATTTACAGAGATTAGCTTAA 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 AATTCCATAGCCAAAGCCAAATTCCTTTGTCATAGCTTGAATTTACAGAGATTAGCTTAA 720
Sequence alignment between SEQ ID NO: 83 and the amino acid sequence encoded by SEQ ID NOS: 5-7 of Humphrey et al:
Qy 1 MetAlaMetGluMetAsnProAlaAspGluThrLeuPhePheSerAspSerHisLeuLeu 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGGCAATGGAAATGAATCCAGCTGACGAAACCTTGTTTTTCTCCGACTCTCATCTCCTT 60
Qy 21 GluSerIleLysGlnHisLeuLeuAspAspSerAspPheSerGluIlePheSerSerMet 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 GAATCGATAAAGCAACATCTTCTTGACGATTCAGATTTTTCTGAAATTTTTTCGTCGATG 120
Qy 41 AsnSerSerAsnGluIleLeuProAsnSerProSerSerSerPheSerSerPheAspPhe 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 AATTCTAGCAACGAAATATTGCCTAACAGTCCTAGCTCAAGTTTTAGCAGCTTCGACTTC 180
Qy 61 AspCysSerPheLeuAsnTrpAspGluAsnSerGluGluThrLeuIleProThrAspGln 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 GACTGCAGCTTCCTTAATTGGGATGAAAACTCTGAGGAAACATTAATACCAACTGATCAG 240
Qy 81 AsnProSerHisGluSerHisGluLysTyrSerGluSerGluGluLysThrGlnGlyPro 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 AATCCTTCACATGAATCCCATGAAAAGTACTCCGAGTCCGAGGAGAAAACCCAGGGCCCT 300
Qy 101 GlyValAlaArgGluLysAsnAlaProArgAspTrpThrArgTyrIleGlyValLysArg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 GGGGTGGCGCGTGAGAAAAACGCGCCGCGAGATTGGACGCGGTACATAGGAGTGAAACGG 360
Qy 121 ArgProTrpGlyThrPheSerAlaGluThrArgAspProSerArgLysGlyGluGlyAla 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 CGACCGTGGGGGACGTTTTCGGCGGAGACAAGAGACCCAAGTAGGAAAGGTGAAGGTGCA 420
Qy 141 ArgLeuTrpLeuGlyThrTyrGluThrAlaGluAspAlaAlaLeuAlaTyrAspGlnAla 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 AGGCTGTGGTTAGGAACTTACGAGACCGCAGAGGATGCAGCGTTAGCTTACGATCAAGCC 480
Qy 161 AlaPheLysIleArgGlySerArgAlaArgLeuAsnPheProHisLeuIleGlySerAsn 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 GCTTTCAAAATCCGCGGCTCGAGAGCTCGGCTCAATTTTCCTCACTTAATCGGCTCAAAC 540
Qy 181 MetProLysProAlaArgValThrAlaArgArgSerArgThrArgSerProGluProSer 200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 ATGCCTAAGCCGGCTAGAGTTACAGCGAGGCGTAGTCGTACGCGCTCACCCGAGCCATCG 600
Qy 201 SerSerSerSerThrSerSerSerGluAsnValProArgLysArgAsnIleAspValIle 220
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 TCTTCTTCATCCACCTCATCATCAGAAAATGTACCAAGGAAAAGGAATATAGATGTGATA 660
Qy 221 AsnSerIleAlaLysAlaLysPheLeuCysHisSerLeuAsnLeuGlnArgLeuAla 239
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 AATTCCATAGCCAAAGCCAAATTCCTTTGTCATAGCTTGAATTTACAGAGATTAGCT 717
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 29-32 is/are rejected under 35 U.S.C. 103 as being unpatentable over Humphrey et al. U.S. Patent Application Publication No. 2020/0291413, published Sep. 17, 2020.
Claim 29 is drawn to cured tobacco material from the modified tobacco plant, or part thereof, of claim 21.
Claim 30 is drawn to a tobacco product comprising the cured tobacco material of claim 29.
Claim 31 is drawn to the tobacco product of claim 30, wherein said tobacco product is a selected from the group consisting of a cigarette, a cigarillo, a non-ventilated recess filter cigarette, a vented recess filter cigarette, a cigar, snuff, pipe tobacco, cigar tobacco, cigarette tobacco, chewing tobacco, leaf tobacco, shredded tobacco, cut tobacco, loose leaf chewing tobacco, plug chewing tobacco, moist snuff, snus, and nasal snuff.
Claim 32 is drawn to the tobacco product of claim 30, wherein said tobacco product is a smokeless tobacco product.
Humphrey et al. teach a modified tobacco plant comprising a non-natural mutation that introduces a stop codon in a polynucleotide and results in a reduced level of expression of said polynucleotide as compared to control tobacco plant, the polynucleotide comprising the nucleotide sequence of SEQ ID NO:13 and encoding a polypeptide having the amino acid sequence of SEQ ID NO: 83 (Example 14 paragraphs [0653]-[0659]; Figures 14, 15, 16; see sequence alignments above between SEQ ID NO: 13 and SEQ ID NOS: 5-7 of Humphrey et al.; see sequence alignments above between SEQ ID NO: 83 and the amino acid sequence encoded by SEQ ID NOS: 5-7 of Humphrey et al.). The modified tobacco plant of Humphrey et al. comprises nicotine at a level below 60% (Example 14 paragraphs [0653]-[0659]; Figure 86).
Humphrey et al. do not explicitly exemplify cured tobacco material from their modified tobacco plant, or a tobacco product comprising cured tobacco material.
Humphrey et al. further teach that material from their tobacco plants can be cured, and that the cured material can be used to produce tobacco products such as cigarettes and smokeless tobacco products (paragraphs [0503]-[0507] [0514][0522]-[0524]).
Given that Humphrey et al. specifically teach a modified tobacco plant that comprises nicotine at a level below 60%, the polynucleotide and that comprises a non-natural mutation that introduces a stop codon in a polynucleotide comprising the nucleotide sequence of SEQ ID NO:13 and encoding a polypeptide having the amino acid sequence of SEQ ID NO: 83 wherein the mutation results in a reduced level of expression of said polynucleotide, and given that Humphrey et al. generally teach that material from their tobacco plants can be cured, and that the cured material can be used to produce tobacco products such as cigarettes and smokeless tobacco products, cured tobacco material from their modified tobacco plant, and tobacco products made therefrom, would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention. One skilled in the art could readily apply prior art methods for the production of cured tobacco material and tobacco products to the modified tobacco plant of Humphrey et al. to yield these predictable results, since the methods were already known in the art to be useful for this purpose. Thus, the claimed invention would have been prima facie obvious as a whole to a person having ordinary skill in the art before the effective filing date of the claimed invention.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 21-40 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 36-57 of copending Application No. 18/780938 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other
Claims 21-40 of the instant application are drawn to a modified tobacco plant, or part thereof, comprising a non-natural mutation in a polynucleotide, the polynucleotide encoding a polypeptide comprising at least 95% identity to amino acid sequence of SEQ ID NO: 83, including a modified tobacco plant, or part thereof wherein said polynucleotide comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO: 13, wherein said non-natural mutation introduces a stop codon, wherein the non-natural mutation results in a reduced level of expression of the polynucleotide and wherein said modified tobacco plant comprises nicotine at a level below 60% of the nicotine level of a control plant when grown in similar growth conditions, cured tobacco material from the modified tobacco plant, or part thereof, a tobacco product, and a method of making the modified tobacco plant.
Claims 36-57 of the reference application are drawn to a tobacco plant, or part thereof, comprising a non-transgenic and non-natural mutation that introduces a stop codon in a nucleic acid molecule comprising SEQ ID NO:13, wherein said non-transgenic and non-natural mutation reduces the nicotine level of said tobacco plant to below 60% of the nicotine level of a control plant and wherein the tobacco leaf produces a leaf that when cured has a USDA grade index value comparable to a control plant, cured tobacco material from the tobacco plant, or part thereof, and a tobacco product.
Because SEQ ID NO:13 of the instant application, and SEQ ID NO:13 of the reference application are identical sequences that encode the same polypeptide,
The tobacco plant of the reference application is an obvious species (a tobacco plant comprising a non-natural mutation in a polynucleotide that introduces a stop codon in the polynucleotide that comprises a sequence having at least 95% identity to SEQ ID NO:13 wherein said non-natural mutation results in a reduced level of expression of said polynucleotide and comprises nicotine at a level below 60% of the nicotine level of a control plant) within the genus of tobacco plants claimed in the reference application, i.e. a tobacco plant comprising a non-transgenic and non-natural mutation that introduces a stop codon in a nucleic acid molecule comprising SEQ ID NO:13, wherein said non-transgenic and non-natural mutation reduces the nicotine level of said tobacco plant to below 60% of the nicotine level of a control plant and wherein the tobacco leaf produces a leaf that when cured has a USDA grade index value comparable to a control plant.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 21-40 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 31, 33, 36-38, 40, 43, 44-45, 47 and 50-51 of copending Application No. 19/541623 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other
Claims 21-40 of the instant application are drawn to a modified tobacco plant, or part thereof, comprising a non-natural mutation in a polynucleotide, the polynucleotide encoding a polypeptide comprising at least 95% identity to amino acid sequence of SEQ ID NO: 83, wherein said non-natural mutation introduces a stop codon, and wherein said modified tobacco plant comprises nicotine at a level below 60% of the nicotine level of a control plant when grown in similar growth conditions, cured tobacco material from the modified tobacco plant, or part thereof, a tobacco product, and a method of making the modified tobacco plant.
Claims 31, 33, 36-38, 40, 43, 44-45, 47 and 50-51 of the reference application are drawn to a tobacco plant, or part thereof, comprising a non-natural mutation in an endogenous polynucleotide sequence encoding a polypeptide of SEQ ID NO: 83, wherein the non-natural mutation reduces at least one alkaloid in the tobacco plant to below 60% of the at least one alkaloid in an unmodified control tobacco plant when grown in similar growth conditions, cured tobacco material from the tobacco plant, or part thereof, and a tobacco product.
Because SEQ ID NO:83 of the instant application, and SEQ ID NO:83 of the reference application are identical amino acid sequences, the modified tobacco plant claimed in the instant application is an obvious species (a tobacco plant comprising a non-natural mutation in a polynucleotide that introduces a stop codon in the polynucleotide that comprises a sequence having at least 95% identity to SEQ ID NO:13 wherein said modified tobacco plant comprises nicotine at a level below 60% of the nicotine level of a control plant) within the genus of tobacco plants claimed in the reference application, i.e. a tobacco plant comprising any type of non-natural mutation in an endogenous polynucleotide sequence encoding a polypeptide of SEQ ID NO: 83 wherein the non-natural mutation reduces at least one alkaloid in the tobacco plant to below 60% of the at least one alkaloid in an unmodified control tobacco plant.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 21-40 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-18 of U.S. Patent No. 11,950,563. Although the claims at issue are not identical, they are not patentably distinct from each other.
Claims 21-40 of the instant application are drawn to a modified tobacco plant, or part thereof, comprising a non-natural mutation in a polynucleotide, the polynucleotide encoding a polypeptide comprising at least 95% identity to amino acid sequence of SEQ ID NO: 83, wherein said non-natural mutation introduces a stop codon, and wherein said non-natural mutation results in a reduced level of expression of said polynucleotide as compared to said control tobacco plant, including a modified tobacco plant, or part thereof wherein said polynucleotide comprises a nucleic acid sequence having at least 95% identity to SEQ ID NO: 13, cured tobacco material from the modified tobacco plant, or part thereof, a tobacco product, and a method of making the modified tobacco plant.
Claims 1-18 of U.S. Patent No. 11,950,563 are drawn to a tobacco plant, or part thereof, comprising a non-natural mutation in an ethylene responsive factor (ERF) gene, wherein said non-natural mutation down-regulates the expression or function of said ERF gene, wherein said non-natural mutation is located within an ERF gene that comprises an endogenous sequence having 100% identity to SEQ ID NO:13, cured tobacco material from the tobacco plant, or part thereof, and a tobacco product.
Because SEQ ID NO:13 of the instant application, and SEQ ID NO:13 of U.S. Patent No. 11,950,563 are identical sequences that encode the same polypeptide, the modified tobacco plant claimed in the instant application is an obvious species (a tobacco plant comprising a non-natural mutation in a polynucleotide that introduces a stop codon in the polynucleotide that comprises a sequence having at least 95% identity to SEQ ID NO:13 wherein said non-natural mutation results in a reduced level of expression of said polynucleotide) within the genus of tobacco plants claimed in U.S. Patent No. 11,950,563, i.e. a tobacco plant comprising any type of non-natural mutation in an ERF gene that comprises an endogenous sequence having 100% identity to SEQ ID NO:13 wherein said non-natural mutation down-regulates the expression or function of said ERF gene.
Remarks
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CYNTHIA E COLLINS whose telephone number is (571)272-0794. The examiner can normally be reached M-F 8:30 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CYNTHIA E COLLINS/Primary Examiner, Art Unit 1662
Prosecution Insights