Prosecution Insights
Last updated: October 04, 2026
Application No. 19/034,234

NEW GENE RESPONSIBLE FOR CYTOPLASMIC MALE STERILITY

Non-Final OA §101§102§112
Filed
Jan 22, 2025
Priority
Feb 06, 2019 — EU 19305141.4 +2 more
Examiner
RADOSAVLJEVIC, ALEKSANDAR
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
VILMORIN & CIE
OA Round
1 (Non-Final)
82%
Grant Probability
Favorable
1-2
OA Rounds
1y 1m
Est. Remaining
90%
With Interview

Examiner Intelligence

Grants 82% — above average
82%
Career Allowance Rate
98 granted / 120 resolved
+21.7% vs TC avg
Moderate +9% lift
Without
With
+8.7%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
15 currently pending
Career history
143
Total Applications
across all art units

Statute-Specific Performance

§101
8.5%
-31.5% vs TC avg
§103
20.6%
-19.4% vs TC avg
§102
14.2%
-25.8% vs TC avg
§112
44.0%
+4.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 120 resolved cases

Office Action

§101 §102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 3-8 are pending and are examined herein. Claim Objections Claim 3 is objected to because of the following informalities: claim 3 recites “orf279 DNA, orf279 RNA or Orf279 protein having an amino acid sequence with at least 95% identity to SEQ ID NO: 4”. However, DNA and RNA comprise nucleotides, not amino acids. Please amend the claims to rectify this. Appropriate correction is required. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 3-8 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon without significantly more. The claims recite a method for detecting, in a wheat plant, an orf279 DNA or RNA, or an Orf279 protein having the amino acid sequence with at least 95% sequence identity to SEQ ID NO: 4, said method comprising extracting a DNA, RNA or protein sample and detecting the orf279 DNA or RNA, or an Orf279 protein (claim 3); the method of claim 3 wherein said detecting comprises detecting sterile cytoplasm with a marker at the recombination junction between atp8 and SEQ ID NO: 3 or within SEQ ID NO: 3, or detecting variation of orf279 expression in male sterile wheat plants (claim 4); the method of claim 3, wherein the orf279 DNA or RNA, or Orf279 protein are detected by markers and primers recognizing ORF279 recombination junction or SEQ ID NO:3, or an antibody recognize Orf279. The claims further recite methods for detecting sterile plants comprising a orf279 T-CMS cytoplasm or fertile plants comprising a normal cytoplasm, the method comprising performing the method of claim 3, wherein the DNA or RNA sample is extracted from the plants and the presence or absence of orf279 DNA or RNA is detected by PCR amplification with a suitable pair of primers and the fertile or sterile status of the plants is determined (claim 6); the method of claim 6, wherein the primer pairs are SEQ ID NO: 52 and 54. Claim 8 is drawn to primers SEQ ID NO: 52, 53, and 54. SEQ ID NO: 1 is the full length nucleic acid encoding the naturally occurring orf279 DNA (the presence of which is responsible for T-type cytoplasmic male sterility in wheat); SEQ ID NO: 3 is the naturally occurring nucleic acid sequence of the unique portion of the chimeric orf279 DNA; and SEQ ID NO: 4 is the amino acid sequence of naturally occurring Orf279 protein (page 4, lines 12-17; page 7, lines 1-19; page 22, lines 9-29). Thus, the claimed sequences all read on natural products. The relationship between orf279, cytoplasmic male sterility and proteins encoded by functional restorer genes is a natural relationship/phenomenon that exists nature apart from human detection or the methods used to detect them. MPEP 2106 includes case law about 35 U.S.C. 101 that provides the following: A correlation between variations in non-coding regions of DNA and allele presence in coding regions of DNA is a natural phenomenon, Genetic Techs. Ltd. v. Merial LLC, 818 F.3d 1369, 1375, 118 USPQ2d 1541, 1545 (Fed. Cir. 2016); In the limited situation where a process claim reciting a nature-based product is drafted in such a way that there is no difference in substance from a product claim, the claim is subject to the markedly different analysis for the recited nature-based product. These types of claims are drafted in a way that focuses on the product rather than the process steps. For example, consider a claim that recites, in its entirety, "a method of providing an apple." Under the broadest reasonable interpretation, this claim is focused on the apple fruit itself, which is a nature-based product. Similarly, claims to detecting naturally occurring cell-free fetal DNA (cffDNA) in maternal blood were held to be directed to the cffDNA, because the "existence and location of cffDNA is a natural phenomenon [and thus] identifying its presence was merely claiming the natural phenomena itself." Rapid Litig. Mgmt., 827 F.3d at 1048, 119 USPQ2d at 1374, (explaining the holding in Ariosa Diagnostics, Inc. v. Sequenom, 788 F.3d 1371, 115 USPQ2d 1152 (Fed. Cir. 2015)). DNA fragments known as "primers" are products of nature, because they lacked markedly different characteristics because primers’ structural characteristics are not markedly different than the corresponding strands of DNA in nature, because the primers and their counterparts had the same genetic structure and nucleotide sequence. (University of Utah Research Foundation v. Ambry Genetics Corp., 774 F.3d 755, 113 USPQ2d 1241 (Fed. Cir. 2014)). Steps of DNA amplification and analysis are not "sufficient" to render a claim patent eligible merely because they are physical steps (Genetic Technologies Ltd. v. Merial LLC, 818 F.3d 1369, 1377, 118 USPQ2d 1541, 1547 (Fed. Cir. 2016)). Steps of amplifying and sequencing nucleic acid sequences and hybridizing a gene probe are well understood, routing and conventional activities in the life sciences when they are claimed in a merely generic manner or as insignificant extra-solution activity (University of Utah Research Foundation v. Ambry Genetics, 774 F.3d 755, 764, 113 USPQ2d 1241, 1247 (Fed. Cir. 2014)). As set forth above, the claims are drawn to a natural relationship between the presence of the naturally occurring orf279 DNA or RNA or Orf279 and cytoplasmic male sterility in the wheat plants which comprise said DNA, RNA or protein. The claims are likewise drawn to the natural products of the primers SEQ ID NO: 52, 53, and 54. These primers are natural products because they are identical to naturally occurring DNA sequences. The claims recite the additional steps of detecting and determining, but said detecting or determining reads on a mental process, which is another judicial exception. The claims recite additional limitations such as extracting DNA, using molecular markers or probes, DNA amplification via PCR, and DNA sequencing, but, as explained in the MPEP citations above, such steps do not constitute significantly more than the judicial exception or integrate it into a judicial application because they are well understood, routine, and conventional steps in the life sciences, and constitute insignificant extra-solution activity. Therefore, the claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception. This is a judicial exception that is not integrated into a practical application because the claim does not recite any further steps that make use of the discovery in a specific, nonnaturally-occuring manner. The claims do not, for example, recite an action performed after identifying a plant comprising an orf279 DNA or RNA or Orf279 protein that is not performed after identifying a plant that lacks an orf279 DNA or RNA or Orf279 protein. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 6-8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 6 and 8 are indefinite in their recitation of “normal cytoplasm”. It is not clear what is encompassed by “normal cytoplasm” as normal is a relative term. Applicant has not provided a definition of “normal” nor a baseline against which to compare a cytoplasm to determine if it is relative or not. It is not clear, if for example, “normal cytoplasm” means cytoplasm from a fertile plant, a plant lacking orf279 but perhaps comprising a different type of wheat cytoplasmic sterility, or a plant comprising some other set of traits that render it “normal”. For these reasons, the metes and bounds of claims 6 and 8 cannot be determined. Likewise, claim 7 is rejected on the same ground as it does not recite any limitations which clarify the metes and bounds of claim 6. Claim 8 is indefinite for its recitation of a “diagnostic marker for determining the presence or absence of orf279 comprising the pair of primers SEQ ID NO: 52 and 54 to amplify orf279 T-CMS sequence”. A diagnostic marker would be understood by one of ordinary skill in the art to consist of a portion of DNA sequence correlated to, linked with or present within a trait, QTL or DNA locus, for example. A primer, on the other hand, would be understood by one of ordinary skill in the art to consist of a short single stranded DNA sequence designed to be complimentary to one end of a target of DNA amplification or sequencing. A primer and a marker are not the same thing. In this case, it is not clear if applicant is claiming a region of DNA correlated with the presence of orf279 or a primer pair for amplifying and sequencing orf279. Therefor the metes and bounds of claim 8 can not be determined. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim 8 is rejected under 35 U.S.C. 102 as being anticipated by NCBI Accession number NC_022714.1 (2013; ncbi.nlm.nih.gov/nuccore/556927176?sat=54&satkey=7585337; accessed 30 May 2026) taken with the evidence of Applicant’s own disclosure. NCBI Accession Number NC_022714.1 teaches a sequence with 100% identity to instant SEQ ID 1, the nucleic acid sequence of an orf279 DNA. Sequence ID: NC_022714.1 Range 1: 112695 to 113531 Alignment statistics Identities Gaps Strand 837/837(100%) 0/837(0%) Plus/Minus Query 1 ATGCCTCAACTTGATAAATTAACTTATTTCTCACAATTCTTCTGGTTATGTCTTCTCCTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113531 ATGCCTCAACTTGATAAATTAACTTATTTCTCACAATTCTTCTGGTTATGTCTTCTCCTC 113472 Query 61 TTTACTTTTTATATTCTCTTATTTAATAATAATAATGGAATACTTGGAATTAGTAGAATT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113471 TTTACTTTTTATATTCTCTTATTTAATAATAATAATGGAATACTTGGAATTAGTAGAATT 113412 Query 121 CTCAAACTACGGAACCAACTGCTTTCGCACCGGGGGGGCGAGATCCGGAGCAAGGACCCT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113411 CTCAAACTACGGAACCAACTGCTTTCGCACCGGGGGGGCGAGATCCGGAGCAAGGACCCT 113352 Query 181 AAGAATCTGGAAGATATCTCGAGAAAAGGTTTTAGCACCGGTCTCTCATATATGTACTCC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113351 AAGAATCTGGAAGATATCTCGAGAAAAGGTTTTAGCACCGGTCTCTCATATATGTACTCC 113292 Query 241 AGTTTATCCGAAGTATCCCAATGGTGTAAGACCGTCGACTATTTGGGAAATAAGATATCT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113291 AGTTTATCCGAAGTATCCCAATGGTGTAAGACCGTCGACTATTTGGGAAATAAGATATCT 113232 Query 301 TCTTCAATCTTTCTATACTATCTTAGGGGCGTCCTTTGCCCAATTTGCCTCTTATTTTTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113231 TCTTCAATCTTTCTATACTATCTTAGGGGCGTCCTTTGCCCAATTTGCCTCTTATTTTTT 113172 Query 361 AAATTTCTTATTTCTTTCGCCTTCACCTGTGCACTTATTTATGTATTCAAGGGGGGGGGT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113171 AAATTTCTTATTTCTTTCGCCTTCACCTGTGCACTTATTTATGTATTCAAGGGGGGGGGT 113112 Query 421 TTCGTGGCTATGGCTGCTACAAACGGAGCCTCTTCTTCCTTTCTGGAGAGCTCAGGTGAA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113111 TTCGTGGCTATGGCTGCTACAAACGGAGCCTCTTCTTCCTTTCTGGAGAGCTCAGGTGAA 113052 Query 481 ATAGATGCACTGTTACAAACAACAACAACAACACGAACACCCGAAAACGCGGATTACGAA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 113051 ATAGATGCACTGTTACAAACAACAACAACAACACGAACACCCGAAAACGCGGATTACGAA 112992 Query 541 GACGATAATACTTCTGTAAATCAAGAATTCCTCGAAGACGGACAAAGGGCCCGACAGGCT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112991 GACGATAATACTTCTGTAAATCAAGAATTCCTCGAAGACGGACAAAGGGCCCGACAGGCT 112932 Query 601 AAACTACGGGAGTTAGAAAGACTCATTCTCCAGCAATATAAGGATTTCATCCGACAGAAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112931 AAACTACGGGAGTTAGAAAGACTCATTCTCCAGCAATATAAGGATTTCATCCGACAGAAA 112872 Query 661 TATCCATGGATACCTAAAGGCGACATCCTTCTCCCGAGCATGAAGGGTGGAGTTGTCGAG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112871 TATCCATGGATACCTAAAGGCGACATCCTTCTCCCGAGCATGAAGGGTGGAGTTGTCGAG 112812 Query 721 GACGTAATGGAAAAATTAGAATTGGAAACGTATTCCAGTAGCGACTTGACTGATTGGATC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112811 GACGTAATGGAAAAATTAGAATTGGAAACGTATTCCAGTAGCGACTTGACTGATTGGATC 112752 Query 781 AACCATTTGCGGGCAAATCCGAAAACATTAAATTTTATCTTCAAGGATTTTGTCGCG 837 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 112751 AACCATTTGCGGGCAAATCCGAAAACATTAAATTTTATCTTCAAGGATTTTGTCGCG 112695 Alignment of instant SEQ ID NO: 1 with instant SEQ ID NO: 52 shows 100% sequence identity: RESULT 1 US-19-034-234A-52/c Query Match 2.6%; Score 22; DB 1; Length 22; Best Local Similarity 100.0%; Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 331 GTCCTTTGCCCAATTTGCCTCT 352 |||||||||||||||||||||| Db 22 GTCCTTTGCCCAATTTGCCTCT 1 Alignment of instant SEQ ID NO: 1 with instant SEQ ID NO: 54 shows 100% sequence identity: RESULT 1 US-19-034-234A-54 Query Match 3.1%; Score 26; DB 1; Length 26; Best Local Similarity 100.0%; Matches 26; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 261 ATGGTGTAAGACCGTCGACTATTTGG 286 |||||||||||||||||||||||||| Db 1 ATGGTGTAAGACCGTCGACTATTTGG 26 As the above cited prior art anticipates SEQ ID NO: 1, it will also anticipate any sequences with 100% identity to SEQ ID NO: 1. Furthermore, by applicant’s own admission, primers comprising the sequences of SEQ ID NOs: 52 and 54 will function to amplify orf279 DNA (see specification, Example F, page 29-30)/ As the claim only requires the sequences of SEQ ID NO: 52 and 54 (SEQ ID NO: 53 is recited in the alternative), NCBI Accession Number NC_022714.1 anticipates all the limitations of claim 8. Subject Matter Free of the Prior Art Claims 3-7 appear to be free of the prior art. Varenne et al (US20200347104 A1; priority date 31 Oct 2017) teaches methods of identifying orf256 gene to determine if a plant comprises T-CMS cytoplasm (paragraph 0222). However Varenne et al does not teach orf279. Varenne et al teach that T. timopheevii derived wheat cytoplasmic male sterility is caused by orf256. NCBI Accession Number NC_022714.1, as cited in the rejection of claim 8 under 35 U.S.C. 102 above, teaches the sequence of orf279, however it does not teach that it confers cytoplasmic male sterility in wheat. There are not suggestions or motivations in the prior art to combine the teachings of Varenne et al with the sequence taught by NCBI Accession Number NC_022714.1 to arrive at the instantly claimed invention. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEKSANDAR RADOSAVLJEVIC whose telephone number is (571)272-8330. The examiner can normally be reached Monday--Friday 8-5:30. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ALEKSANDAR RADOSAVLJEVIC/ Examiner, Art Unit 1662 /BRENT T PAGE/ Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Jan 22, 2025
Application Filed
Jun 04, 2026
Non-Final Rejection mailed — §101, §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12727560
WATERMELON LINE WML-EJ16-2718
2y 4m to grant Granted Sep 08, 2026
Patent 12696870
TOMATO VARIETY NUN 09398 TOF
3y 4m to grant Granted Aug 04, 2026
Patent 12674175
POLYNUCLEOTIDES, PRIMERS, AND METHODS FOR DETECTION OF TRANSGENIC EVENT, GENETIC CONSTRUCT, KIT FOR DETECTION MATERIAL FROM A PLANT SAMPLE, EVENT CTC91087-6, INSECT-RESISTANT SUGARCANE PLANT, AND METHOD FOR PRODUCING AN INSECT-RESISTANT SUGARCANE PLANT, PLANT CELL, PLANT PART OR SEED
4y 7m to grant Granted Jul 07, 2026
Patent 12673978
INCREASING RESISTANCE AGAINST FUNGAL INFECTIONS IN PLANTS
4y 1m to grant Granted Jul 07, 2026
Patent 12672627
SOYBEAN VARIETY 01094736
3y 7m to grant Granted Jul 07, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
82%
Grant Probability
90%
With Interview (+8.7%)
2y 10m (~1y 1m remaining)
Median Time to Grant
Low
PTA Risk
Based on 120 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month