DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first-inventor-to-file provisions of the AIA .
Election/Restrictions
A restriction requirement was posted on 22 July 2026.
Applicant's election without traverse of Group I with SEQ ID NO:57; SEQ ID NO:108; and SEQ ID NO:140 in the reply filed on 22 September 2026 is acknowledged. The requirement is deemed proper and is therefore made FINAL.
Claims 1, 4-8, 10, 16-17 and, 25, and 26 are examined herein.
Claim 23 is withdrawn because it reads on a non-elected invention.
Examiner’s Notes
Citations to Applicant’s specification are abbreviated herein “Spec.”
Occasionally, “SIN:” may be used as an abbreviation “SEQ ID NO:” herein.
Copies of the cited references are available in the parent file history and thus copies are not provide herewith.
Applicant elected SEQ ID NO:57; SEQ ID NO:108; and SEQ ID NO:140. Based on Table 1 (pp. 7-9), that is a promoter, intron and terminator combination.
This Application is a continuation in a patent family with three issued patents.
U.S. Patent No. 10,344,290; SEQ ID NO: 8 and SEQ ID NO:137
U.S. Patent No. 11,242,535; and SEQ ID NO:100 and SEQ ID NO:13.
U.S. Patent No. 12,286,634. SEQ ID NO:58; SEQ ID NO:106; & SEQ ID NO:140.
When SEQ ID NO:57 and SEQ ID NO:58 are compared using NCBI’s Blast® website (30 September 2026), ‘no significant similarity is ob served.
The elected terminator, SEQ ID NO:140, was known as a fragment of a maize chromosome.
An alignment is found at the end of this Office action.
The combination of the three elements as a regulatory nucleic acid molecule for the construction of a vector to drive transgene expression was unknown in the prior art.
Improper Markush Group
Claims 1, 4-8, 10, 16-17 and, 25, and 26 are rejected on the basis that they contain an improper Markush grouping of alternatives or depend from such a claim. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a "single structural similarity" and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a "single structural similarity" and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush groupings in
claim 1: SEQ ID NOs: 4, 8, 13, 19, 52, 53, 56, 57, 58, 101, 102, 103, 104, 118, 137, 138;
claim 6: SEQ ID NOs: 4, 8, 13, 19, 52, 53, 56, 57, 58, 101, 102, 103, 104, 118, 137 138;
claim 7: SEQ ID NOs: 105, 106, 107, 108,109, 110, 111, 112, 113, 114, 115, 116, 117,119, 136, 139
claim 8: SEQ ID NOs: 140, 141, 142 or 143
are improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use under the following reasoning.
Applicant fails to teach that such a diverse group of sequences will function equivalently to drive transgenic expression in a plant even within one of the groupings above. Applicant’s specification illustrates the complexity of the issue.
To illustrate this, in the specification Applicant describes how they narrowed the choices of potential genes for further characterization. Spec., Example 1, para. 0071. Further, Example 1 describes identifying introns that “enhance transcript abundance from . . . maize genes which [had] introns near the N-terminus of the transcript.” Id., para. 0070. The beginning source of sequences were from “public B73 BAC sequences plus a proprietary EST transcript” group. Id., para. Analysis continued. Id., para. 0171. Eventually, 86 introns, then seventeen, were selected.
But see also Table 5 (p. 44), with a very large number, 1066, of untested introns.
In Example 2, the candidate introns were tested with the well-known maize ubiquitin promoter. Id., pp. 31-32.
In Example 4, they are used to transform maize. Id., pp. 34-36. Some worked, some did not. Id., para. 0193. In Example 5, two introns worked in rice. Id., p. 36.
In Example 6, Applicant describes identifying six maize promoters and then the introns including the elected SEQ ID NO:57. Id., pp. 37-38. Identified as i6 and see Table 3 on page 39.
In Example 8 (pp. 43-47, Applicant studied, in silico, the introns looking for structure.
“The exact 8-bp sequence CAGATCTG was found in 2 out of the 9 enhancing introns identified (SEQ ID NOs: 52 and 53), but was not found in any of the 10 non-enhancing introns (SEQ ID NOS: 5-79, 11, 12, 17, 18, 54, and 55). A subset of this sequence ATCTG (SEQ ID NO: 100) was also present in 8 out of 9 enhancing introns (SEQ ID NOS: 4, 8, 13, 52, 53, 56, 57 and 58)(SEQ ID NO:57 elected), and was also found to be present in the four known enhancing introns (SEQ ID NOS: 95-98). The frequency of occurrence of these motifs was normalized to the intron length (Table 6).
In Example 10, Applicant dates that “[i]t is likely that the expression enhancing introns from Examples 4, 7 and 9 perform optimally along with their endogenous promoters.” Id., para. 0238.
Some expression results are shown in Figures 3 and 4. Some work well, others, not as well. In Figure 10, the TS2 promoter / intron is featured and compared to the maize Ubi promoter and intron. In leaves, all combinations featuring an intron have similar results. In panicles, the winner is the Zm Ubi promoter with the TS2 intron. The TS2 promoter / intron is better than the Zm Ubi promoter / intron combination.
In Examples 13-16 (pp. 54-55) Applicant searches for terminators.
For example, Table 3 Spec., p. 39) shows a wide variety of activities for SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:56, SEQ ID NO:57 (the elected species) and SEQ ID NO:58 as introns.
Applicant elected SEQ ID NO:57, SEQ ID NO:108 and SEQ ID NO:140
When SEQ ID NO:57 was searched against one of the Office’s patent databases which contains the sequences in this application, none of the other sequences showed any significant similarity. Further, as described above, then SEQ ID NO:57 and SEQ ID NO:58 was compared, they were not similar.
Focusing on the elected species, SEQ ID NO:57 is referenced as the “i6” intron. Spec., p. 8. Further down, the Table identifies the non-elected SEQ ID NO:112 as the associated promoter.
The elected SEQ ID NO:108 is referenced as the TS27 gene. The intron of that gene is SEQ ID NO:19. Spec., Table 1, p. 8.
Introns were tested with the CYMV promoter and non-uniform results were obtained. (e.g. Table 3, p. 39.).
Thus Applicant’s specification confirms the complexities of the Markush groups.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claims depending on the claims reciting an improper Markush group are included in this rejection.
Amending the claims to recite only the elected species/sequences would obviate the rejection.
Claim Rejections - 35 USC § 112(a), written description
The following is a quotation of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 4-8, 10, 16-17 and, 25, and 26 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 1 is drawn to a DNA molecule comprising four elements: an intron, a promoter, a terminator and a heterologous polynucleotide. Only the intron has a defined structure and recites approximately 15 SEQ ID NOs and 95% sequence-identical genera around each one. Of those SEQ ID NOs, SEQ ID NO:58 is elected.
Dependent claim 4 adds a definition for the promoter and recites approximately 15 SEQ ID NOs and 95% sequence-identical genera around each one.
Dependent claim 5 adds the terminator structure and recites 4 SEQ ID NOs (and 95% identical genera. Dependent claims 6-8 narrow the scope.
Dependent claim 6 returns to the intron but drops the 95% sequence-identical variants. Dependent claim 7 returns to the promoter but drops the 95% sequence-identical variants. Dependent claim 8 returns to the terminator but drops the 95% sequence-identical variants.
Dependent claim 10 requires that the intron is active in enhancing expression in a plant. All claims are interpreted as if they require enhanced transcription activity.
Dependent claims 16 and 17 read on a plant and a seed.
Applicant defines “regulatory elements” broadly beginning in the lower half of page 16.
The Federal Circuit held that a written description of an invention "’requires a precise definition, such as by structure, formula [or] chemical name,’ of the claimed subject matter sufficient to distinguish it from other materials." Regents of the Univ. of Cal. v. Eli Lilly & Co., 119 F.3d 1559, 1568, 43 USPQ2d 1398, 1405 (Fed. Cir. 1997) (quoting Fiers v. Revel, 984 F.2d 1164, 1171, 25 USPQ2d 1601, 1606 (Fed. Cir. 1993)). The court also stated "naming a type of material generally known to exist, in the absence of knowledge as to what that material consists of is not a description of that material." Id., 119 F.3d at 1568, 43 USPQ2d at 1406. The court held that “[a] description of a genus of cDNAs may be achieved by means of a recitation of a representative number of cDNAs, defined by nucleotide sequence, falling within the scope of the genus or of a recitation of structural features common to members of the genus, which features constitute a substantial portion of the genus.” Id., 119 F. 3d at 1569, 43 USPQ2d at 1406.
The way the claims are structured, each component of the gene regulatory construct is claimed as a SEQ ID NO as well as variants. With three SEQ ID NOs, each clamed as a variant, the claimed genera expand in size to encompass a vast number of molecules. Plus, in the current forms of the claims, each element has several SEQ ID NOs.
Relative to the elected species, Applicant claims 95% sequence identical variants of SIN57 as an intron, SEQ ID NO:108 as a promoter and SEQ ID NO:140 as a terminator.
SEQ ID NO:58 is 604 bp long. If the first approximately 95% base pairs were held constant, and the remaining 30 (approximately 5%) were varied, that would result in 304 different variants. However, that is only a small fraction of the number claimed, because different regions could be held constant.
Regarding the promoter, SEQ ID NO:109 is 1500 bp long. If the first approximately 95% base pairs were held constant, and the remaining 75 (5%) were varied, that would result in 754 different variants. However, that is only a small fraction of the number claimed, because different regions could be held constant.
Finishing with the terminator, SEQ ID NO:140 is 629 bp long. If the first approximately 95% base pairs were held constant, and the remaining 31 (approximately 5%) were varied, that would result in 314 different variants. However, that is only a small fraction of the number claimed, because different regions could be held constant.
Collectively, of course, the genera are multiplied together.
Additionally, if additional non-elected species remain in the claim, the claim expands to include an astronomical number of variants.
Applicant’s teachings in the specification are set forth above under the ‘Improper Markush Group’ rejection and that discussion is incorporated by reference here. Applicant’s specification confirms the complexities of the claimed subject matter.
In the promoter art, several publications describe that changes to the primary structure of a promoter sequence such as SEQ ID NO:109, changes that would fall within the scope of the claimed promoter variants, might have significant effects on the variant’s ability to be active as a promoter within the instant invention. See, e.g., Donald & Cashmore (1990) EMBO J 9:1717-26, abstract; Kim et al. (1994) Plant Mol Biol 24:105-17, abstract; and Dolferus et al. (1994) Plant Physiol 105:1075-87, abstract.
A final citation regarding promoters, in an introduction to a 2007 publication of an in silico analysis of plant promoters, Saha et al. teaches that computational analysis of promoters is only a starting point for physical analysis, and experimental verification is still required. Saha et al. (2007) In Silica Biol 7(1 ):7-19, 8.
The art regarding intron structure also points to the activity dependence on the exact sequence of the intron.
The art has not devoted the same level analysis of introns in contrast to promoters. For example, Rose reviews attempts at defining required sequences within expression-enhancing introns, but concludes that few if any sequences were identified as being necessary and/or sufficient. Rose (2008) Curr Top Microbial lmmunol 326:277-90, 283-84.
Flasinski et al. also describes expression-enhancing introns, and further describes that the nucleotide sequence CAGATCTG is a motif associated with such expression-enhancing introns. Flasinski et al., US Patent Publication 2007/0204367, published 30 August 2007, see, e.g., para. 0011. However, such a short sequence obviously cannot fully describe an intron. Thus the art also fails to describe structural features of introns that are necessary and sufficient for activity.
Flasinski et al.’s motif is, of course, Applicant’s SEQ ID NO:99 and comprises SEQ ID NO:100.
Additionally, Gallegos & Rose describes that even in 2015, "[s]everal fundamental questions regarding the role of transcription and splicing, the sequences responsible for [intron-mediated enhancement], the involvement of other factors, and the relationship between introns and promoters remain unanswered. Gallegos & Rose (2015) Plant Sci 237:8-15.
As seen above, Applicant claims vast genera of sequences related to the elected SEQ ID NOs. thereof. In contrast to the breadth of the claims, Applicant only describes the sequence themselves. Furthermore, Applicant fails to describe a working example featuring a combination of the elected species.
In contrast, see Figures 3 and 10 which display a wide range of activities.
Again, in Example 10, Applicant dates that “[i]t is likely that the expression enhancing introns from Examples 4, 7 and 9 perform optimally along with their endogenous promoters.” Id., para. 0237.
Rhus an ordinary artisan would not be able to envision the full scope of the claimed sequences as routinely active in the instant invention. Applicant thus fails to describe a representative number of species in comparison to the size of the vast genera claimed.
Given the lack of written description in the specification plus the lack of knowledge in the prior art as it relates to SEQ ID NO:58/ SEQ ID NO:106 and SEQ ID NO:140, one of skill in the art would not believe that Applicant was in possession of the broad genera claimed at the time of filing the instant application.
Dependent claims are included in this rejection because none provide further limitations obviating this rejection.
Conclusion
No claim is allowed.
SEQ ID NO:140
FJ911012/c
LOCUS FJ911012 580 bp DNA linear PLN 24-APR-2009
DEFINITION Zea mays subsp. mays Mu tranposon insertion Mu1009282 flanking
sequence.
ACCESSION FJ911012
VERSION FJ911012.1
KEYWORDS .
SOURCE Zea mays subsp. mays (maize)
ORGANISM Zea mays subsp. mays
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD
clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae;
Zea.
REFERENCE 1 (bases 1 to 580)
AUTHORS McCarty,D.R., Koch,K.E., Latshaw,S., Avigne,W., Hunter,C.,
Obrien,B., Wu,S. and Suzuki,M.
CONSRTM UniformMu Group
TITLE Sequence-indexed transposon insertion in the UniformMu maize
population
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 580)
AUTHORS McCarty,D.R., Koch,K.E., Latshaw,S., Avigne,W., Hunter,C.,
Obrien,B., Wu,S. and Suzuki,M.
CONSRTM UniformMu Group
TITLE Direct Submission
JOURNAL Submitted (09-APR-2009) Plant Molecular and Cellular Biology,
University of Florida, PO 110690, Gainesville, FL 32611-0690, USA
FEATURES Location/Qualifiers
source 1..580
/organism="Zea mays subsp. mays"
/mol_type="genomic DNA"
/cultivar="UniformMu maize population"
/sub_species="mays"
/db_xref="taxon:381124"
/note="genotype: bz1-mum9, A1, C1, R1 (W22 color converted
inbred)"
misc_feature 1..580
/note="Mu tranposon insertion Mu1009282 flanking sequence;
includes both sides of the transposon insertion site where
the inferred transposon is indicated by 100 N's; gap
typically flanked by a 9-base direct duplication of host
sequence characteristic of Mu transposon; native Mu
transposon system of maize includes multiple members that
vary in size and internal sequence; Mu element responsible
for the insertion has not been determined"
gap 242..341
/estimated_length=unknown
ORIGIN
Query Match 21.2%; Score 318; Length 580;
Best Local Similarity 79.7%;
Matches 451; Conservative 0; Mismatches 5; Indels 110; Gaps 2;
Qy 1045 GAGAAGATCCCCGACTTGCGCCCAAA-GAAGATACAGGATCAAGGATTTTTAACCGCAGT 1103
||||||||||| |||||||||||| ||||||||||||||| |||||||||||||| ||
Db 578 GAGAAGATCCCGACCTTGCGCCCAAACGAAGATACAGGATCATGGATTTTTAACCGCGGT 519
Qy 1104 TTTCTATTCCACGACCTTATCCACACCAGCAGATTCGAAATTCACGGACAGGCCCATGGA 1163
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 518 TTTCTATTCCACGACCTTATCCACACCAGCAGATTCGAAATTCACGGACAGGCCCATGGA 459
Qy 1164 CCCGGCGAAAGCCAGCGGTGGTTCAGCCCCTGACGTGCGGGTCCCACTCTCCAGCCGCAC 1223
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 458 CCCGGCGAAAGCCAGCGGTGGTTCAGCCCCTGACGTGCGGGTCCCACTCTCCAGCCGCAC 399
Qy 1224 CGCCTAGAGAGGCAGAGGCATCCCTTCGCGTGGAAGCAAACGAGGCGT------------ 1271
||||||||||||||||||||||||||||||||||||||||||||||||
Db 398 CGCCTAGAGAGGCAGAGGCATCCCTTCGCGTGGAAGCAAACGAGGCGTGATAAAGTGNNN 339
Qy 1272 ------------------------------------------------------------ 1271
Db 338 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 279
Qy 1272 -------------------------------------GATAAAGTGGGGCTCCTCGGTCC 1294
|||||||||||||||||||||||
Db 278 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAAAGTGGGGCTCCTCGGTCC 219
Qy 1295 CGGCGTTGGCCGCATCGACACTCGCCGCGCACCACCACCACCGCTGCGGCTCACGGCTAC 1354
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 218 CGGCGTTGGCCGCATCGACACTCGCCGCGCACCACCACCACCGCTGCGGCTCACGGCTAC 159
Qy 1355 GCAGCCCGCTCTCCCGACCCCCCCGTGCCCTCCTCTTTTTGCTACTAGCACATAGAGTTT 1414
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 158 GCAGCCCGCTCTCCCGACCCCCCCGTGCCCTCCTCTTTTTGCTACTAGCACATAGAGTTT 99
Qy 1415 CGCCCGAATCGATCGCCGACTGACTCCGCTAGGGTTCGGCCCGATCGCCGCTTCGTCCTC 1474
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 98 CGCCCGAATCGATCGCCGACTGACTCCGCTAGGGTTCGGCCCGATCGCCGCTTCGTCCTC 39
Qy 1475 CCGGCTCCCGCGGGGACCCCGCCGAG 1500
||||||||||||||||||||||||||
Db 38 CCGGCTCCCGCGGGGACCCCGCCGAG 13
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUSSELL T BOGGS whose telephone number is (571)272-2805. The examiner can normally be reached Monday - Friday, 0800 to 1830 Mtn.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at 571-270-0708. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/RUSSELL T BOGGS/Examiner, Art Unit 1663
