DETAILED ACTION
This Action is in response to the amendment filed on 11/13/2025.
Claims 1-3, 5-9, 11-14, 17-28, 30, 35, 39-41 are pending.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
It is noted that upon amendment of claim 28 changing the claim to “the method of claim 21”, claim 28 has been joined with the claims of Group III, as set forth in the restriction requirement, and the object to claim 28 has been withdrawn in view of the amendment.
Applicant’s election without traverse of Group I in the reply filed on 11/13/2025 is acknowledged.
Claims 17-18, 21-28, 30 and 35 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim, as acknowledged by Applicant. Election was made without traverse in the reply filed on 11/13/2025.
Claims 1-3, 5-9, 11-14, 19-20, 39-41 are under consideration.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-3, 5-9, 11-14, 19-20, 39-41 are rejected under 35 U.S.C. 103 as being unpatentable over WO2020198151 (hereinafter “JAYARAM”, of record – IDS citation) in view of SONG et al. (Cancer Lett. 2019 Feb 1:442:310-319; Epub 2018 Nov 10).
JAYARAM teaches a fusion protein ribonucleotide complex comprising a fusion protein and at least one single guide RNA (sgRNA), wherein the fusion protein comprises at least one antibody or antibody fragment and at least one RNA-guided DNA endonuclease (e.g., see abstract; page 65 lines 12-20; page 23 lines 4-5; claims 12, 26; etc. ). For instance, the abstract states, “The invention includes a targeted active gene editing (TAGE) agent that includes an extracellular cell membrane binding moiety, e.g., an antigen binding polypeptide…, that specifically binds to an extracellular cell membrane-bound molecule…, and a site-directed modifying polypeptide that recognizes a nucleic acid sequence. The extracellular cell membrane binding moiety (e.g., antigen binding polypeptide, CPP, or ligand) and the site-directed modifying polypeptide are stably associated such that the site-directed modifying polypeptide…” The specification also explicitly states, “In still other embodiments, the site-directed modifying polypeptide… further comprises a detectable label that can aid in detecting the presence of the target sequence... The detectable label may be fused to the nucleic-acid guided nuclease as a fusion protein (e.g., fluorescent protein)…” (see page 65, lines 6-15). It is noted that JAYARAM also teaches that the site-directed modifying polypeptide can be an RNA-guided endonuclease that can inhibit expression of the target nucleic acid (e.g., see page 37 lines 27-35).
JAYARAM does not teach that the gRNA targets an SRC-3 gene.
However, SONG et al. teaches, “…SRC-3 is overexpressed in PDAC and inversely correlates with patient overall survival. Knockdown of SRC-3 reduces pancreatic cancer cell proliferation, migration and invasion in vitro. Additionally, inhibition of SRC-3 using either shRNA or a small molecule inhibitor can significantly inhibit tumor growth in orthotopic pancreatic cancer mouse models.” (e.g., see abstract).
Therefore, although JAYARAM does not teach that the site-directed polypeptide is directed to an SRC-3 gene, SONG et al. provides the motivation to modify the system taught by JAYARAM so that the site-directed polypeptide is directed to an SRC-3 gene in order to inhibit expression of the SRC-3 gene. Thus, it would have been prima facie obvious to one of ordinary skill in the art, prior to the day the claimed invention was filed, to modify the system taught by JAYARAM so that the site-directed polypeptide is directed to an SRC-3 gene in order to inhibit expression of the SRC-3 gene. Based on the positive results reported by JAYARAM and SONG et al., there would have been a reasonable expectation of success for making the indicated modification.
Regarding claims 2-3, JAYARAM teaches that the TAGE agent can comprises the nucleic acid-guided DNA endonuclease Cas9 (e.g., see page 43, lines 3-5).
Regarding claim 5, JAYARAM teaches that a linker can be used to attach the extracellular cell membrane binding moiety (i.e., the antibody) to the site-directed modifying polypeptide to form the TAGE (targeted active gene editing) agent (see page 46, lines 5-7).
Regarding claim 6-7, JAYARAM teaches that the fusion protein can comprise a purification tag that can be glutathione S-transferase (e.g., see page 66, lines 30-35).
Regarding claims 8-9, JAYARAM teaches that the fusion protein can comprise a protease wherein the protease can be a 3C protease (e.g., see page 47, lines 5-7; ; page 103, lines 1-10).
Regarding claims 11-14, JAYARAM teaches that the antibody can be an antibody fragment that is an scFv that targets the cell surface protein cancer antigen HER2 (e.g., see claims 22, 40, 57; page 5, lines 11-13; page 6, lines 9-12; etc.).
Regarding claims 19-20, JAYARAM teaches that the TAGE agent can be formulated into a pharmaceutical composition with a pharmaceutically acceptable carrier (e.g., see page 126, lines 29-30).
Regarding claims 39-41, JAYARAM teaches that the TAGE agent comprises a cell penetrating peptide (CPP) (e.g., see page 12, lines 27-30), wherein the CPP can be MAP ( (e.g., see page 66, lines 20-29). Although JAYARAM does not explicitly teach the MAP amino acid sequence, official notice is taken that the MAP amino acid sequence comprises SEQ ID NO: 2 (KLALKLALKALKAALK) which is the amine acid sequence encoded by SEQ ID NO: 13 (AAGCTGGCCCTGAAGCTGGCCCTGAAGGCCCTGAAGGCCGCCCTGAAG).
Therefore, the claims are unpatentable over JAYARAM in view of SONG et al.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to J. E. Angell whose telephone number is (571)272-0756. The examiner can normally be reached Monday-Friday (8:30-5:00).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
J. E. Angell
Primary Examiner
Art Unit 1637
/J. E. ANGELL/Primary Examiner, Art Unit 1637