DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 02/26/2026 has been entered.
Applicant’s amendments to the claims and arguments filed on February 26, 2026 have been received and entered. Claims 1-50, 52-53, 56-57, 59 and 71 have been canceled, while claims 51, 63 have been amended. Claim 72 is newly added. Claims 51, 54-55, 58, 60-70 and 72 are pending in the instant application.
Election/Restrictions
Applicant’s election without traverse of claims 51-62 in the reply filed on July 15, 2025 is acknowledged.
Claims 63-70 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention there being no allowable generic or linking claim. Election was made without traverse in the reply filed on July 15, 2025.
Priority
This application is a Divisional of US application no 18/134,095 filed on 04/13/2023, which is a continuation of PCT/US21/61205 filed on 11/30/2021, which claims priority from US provisional 63/152,832 filed on 02/23/2021 and 63/120,189 filed on 12/01/2020
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 10/29/2025 in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement has been considered by the examiner.
Claims 51, 54-55, 58, 60-62 and 72 are under consideration.
Withdrawn-Claim Rejections - 35 USC § 103
Claims 51, 54-55, 58, 60-62 are rejected under 35 U.S.C. 103 as being unpatentable Vandenberghe (WO/2015/054653, 4/15/2015, IDS), as evidenced by Ambion Catalogue (PBS, Catalog #: AM9624-AM9625, 2006, page 1), Suzuki (Scientific Reports, 2017, 7: 45524, 1-10, IDS), and Simons (WO2019126329, dated 6/27/2019, IDS) as applied above for claim 51 and further in view of Bennicelli et al (Molecular Therapy, 2008, 16 (3), 458-465, art of record). In view of Applicants’ amendment to the base claim 51, and further introducing the limitation of dependent claim 71, the previous rejections of claims are hereby withdrawn. Applicants’ arguments with respect to the withdrawn rejections are thereby rendered moot. The claims are however subject to new rejections over the prior art of record, as set forth below:
Claims 51 and 71 are rejected under 35 U.S.C. 103 as being unpatentable Vandenberghe (WO/2015/054653, 4/15/2015, IDS), as evidenced by Ambion Catalogue (PBS, Catalog #: AM9624-AM9625, 2006, page 1). Suzuki (Scientific Reports, 2017, 7: 45524, 1-10, IDS), and Simons (WO2019126329, dated 6/27/2019, IDS), Bennicelli et al (Molecular Therapy, 2008, 16 (3), 458-465) and further in view of Natsoulis et al (WO9709442, dated 3/13/1997). In view of Applicants’ amendment of base claim 51 and arguments, the previous rejections of claims 51 and 71 are hereby withdrawn. Applicants’ arguments with respect to the withdrawn rejections are thereby rendered moot. The claims are however subject to new rejections over the prior art of record, as set forth below.
New-Claim Rejections - 35 USC § 103- necessitated by amendments
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 51, 54-55, 58, 60-62 and 72 are rejected under 35 U.S.C. 103 as being unpatentable Vandenberghe (WO/2015/054653, 4/15/2015, IDS), as evidenced by Ambion Catalogue (PBS, Catalog #: AM9624-AM9625, 2006, page 1), Suzuki (Scientific Reports, 2017, 7: 45524, 1-10, IDS), Simons (WO2019126329, dated 6/27/2019, IDS), Bennicelli et al (Molecular Therapy, 2008, 16 (3), 458-465, art of record)/Mathur (US 20230242939, EFD, 01/29/2020) and Colosi (WO2015038625, dated 03/19/2015).
Claim interpretation: Th transitional phrase “comprising” which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004) (se MPEP 2111.03).
Regarding claim 72, recitation of construct comprises “a sequence” according to SEQ ID NO is interpreted as any sequence including a contiguous sequence that is according to SEQ ID NO.
Regarding claims 51, 54-56, 58-62, Vandenberghe teaches a composition comprising (i) an Anc80L65 capsid and (ii) a nucleic acid construct comprising a gene of interest (reporter) under the control of CMV promoter (see example 3 and page 29, lines 19-24, example 2-3, 7, page 28, lines 23-24, fig. 10-11). Vandenberghe contemplate gene of interest being VEGF binding agent that is ranibizumab encoded by DNA (see example 10). It is further disclosed that the composition comprising the virus is suspended in a physiologically compatible carrier that include saline (0.9% NaCl~154mM NaCl) , which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline), and water (see page 21, lines 14-17). The PBS is known to comprises 137 mM of NaCl, 2.7mM of KCl, 8 mM of Na2HPO4 and 2 mM of K2HPO4 as evidenced by Ambion Catalogue. Further, given that Vandenberghe reported using the composition comprising a AAVanc80capsid and transgene is intended for treating hearing loss carrier (see page 20, lines line 17 and page 21, lines 11-28). therefore, the composition disclosed in Vandenberghe is a pharmaceutical composition. The teaching of Vandenberghe is further supported by disclosure of Suzuki who reported use of AAV2/Anc80L65 comprising AAV2 ITR flanked genome encoding CMV driven EGFP is capable of transducing all inner hair cells and the majority of outer hair cells in an adult cochlea via virus injection into the posterior semicircular canal (abstract), wherein AAV2/Anc80L65 (see page 8, para. 3).
With respect to claim 60-61, Vandenberghe teaches that AAV Anc80 capsid is an AAVAnc80L65 capsid comprises the amino acid sequence as set forth in SEQ IDNO: 23 that has 100% sequence identity to the amino acid sequence according to SEQ ID NO: 114 (see claim 11, sequence search result).
PNG
media_image1.png
200
400
media_image1.png
Greyscale
With respect to claim 62, Vandenberghe teaches the amount of AAV in the composition is about 1x101 to I x 1012 genome copies (GCs) in about 0.1 ml to about 10 ml of a solution meeting the limitation of 51-55 (see page 21, lines 29-31).
Vandenberghe differs from claimed invention by not disclosing that the (i) construct comprising coding sequence includes a first nucleic acid sequence that encodes a first polypeptide of the VEGF binding agent and a second nucleic acid sequence that encodes a second polypeptide of the VEGF binding agent, wherein (a) the first polypeptide comprises the amino acid sequence of SEQ ID NO: 16, and (b) the second polypeptide comprises the amino acid sequence of SEQ ID NO: 20 (limitation of claim 51) and (ii) composition comprising 8.1 mM of Na2HPO4, 1.8 mM of K2HPO4, 172mM NaCl and 0.001% PF-68 (poloxamer-188)..
Simons cure the deficiency by teaching a nucleic acid construct comprising a coding sequence encoding an antibody Fab directed against VEGF such as ranibizumab (see page 30). It is further disclosed that the construct includes a promoter that is operably linked to the sequence encoding the antibody or the antigen-binding antibody fragment (see page 58, lines 28-34, page 59, line 1-3, line 32-34 to page 60, line 1), wherein said construct is packaged in any AAV capsid to target cochlear hair cells (see page 43, line 16). Simons teaches SEQ ID NO: 54 that has 100% sequence identity to VEGF binding agent comprising the amino sequence of SEQ ID NO: 16 (example 1, also see sequence search report) (limitation of claims 51). Simons teaches a composition comprising the AAV as discussed above for claim 1 (see page 20, lines 1-2). Simons teach a composition comprising the AAV and a pharmaceutical carrier (see page 63, lines 1-20) and could be formulated in neutral-buffered saline, phosphate-buffered saline (see page 63, line 5) or perilymph solution includes 20-200 mM, NaCl; 1-5 mM KCl having a pH of between about 6 and about 9 (page 64, lines 19-21,).
Regarding , claim 72, Simons teaches SEQ ID NO: 51 comprises a sequence that is 100% contiguous sequence according to SEQ ID NO: 91 and 92 (see sequence search results see claim interpretation).
The combination of references teaches a pharmaceutical composition comprising claimed AAV particle in phosphate buffered saline comprises 137 mM of NaCl, 2.7mM of KCl, 8 mM of Na2HPO4 and 2 mM of K2HPO4 but differs from claimed invention by not disclosing composition comprises 8.1 mM of Na2HPO4, 1.8 mM of K2HPO4, 172mM NaCl and 0.001% PF-68 (poloxamer-188).
Bennicelli cure the deficiency by disclosing AAV particle formulated in PBS180 (180mM sodium chloride) + PF68 (0.001%) enable quantitative recovery of vector genome titer and functional activity of dilute AAV solutions following handling manipulations, incubation at room temperature (see page 459, col. 2, para. 3, fig. S1). Alternatively, Mathur reported formulating AAV particle in PBS that may comprise sodium chloride, potassium chloride, disodium phosphate, monopotassium phosphate, and distilled water (see para. 572), wherein dibasic sodium phosphate may be 8.1-8.6 mM (see para. 575) and monopotassium phosphate is in a range of 1.2-1.7 mM, Sodium chloride may be in formulation ranging from 171-172mM (see para. 582), KCl ranging from 1.2-1.7 mM (see para. 587) and 0.001% poloxamer 188 (See claim 91 of ‘939). The combination of references differs from claimed invention by not disclosing wherein the coding sequence is flanked by a 5’ ITR comprising the nucleic acid sequence of SEQ ID NO: 45, and a 3’ ITR comprising the nucleic acid sequence of SEQ ID NO: 46.
Colosi provides evidence of a coding sequence flanked by a 5’ ITR and a 3’ ITR nucleotide sequence of AAV2. Colosi teaches AAV2 ITR comprise a 5' ITR comprising a nucleic acid sequence as set forth in bases 1-145 of SEQ ID NO: 9 that has 100% sequence identity to SEQ ID NO: 45, and a 3' ITR comprising a nucleic acid sequence as set forth in bases 53367-5511 of SEQ ID NO: 9 that has 100% sequence identity to SEQ ID NO: 46 (see below).
US-19-095-986-45
Query Match 2.6%; Score 145; DB 1; Length 145;
Best Local Similarity 100.0%;
Matches 145; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGG 60
Qy 61 CGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTG 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 CGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTG 120
Qy 121 GCCAACTCCATCACTAGGGGTTCCT 145
|||||||||||||||||||||||||
Db 121 GCCAACTCCATCACTAGGGGTTCCT 145
Query Match 2.6%; Score 145; DB 1; Length 145;
Best Local Similarity 100.0%;
Matches 145; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 5367 AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGG 5426 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGG 60
Qy 5427 CCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGC 5486 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 CCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGC 120
Qy 5487 GAGCGCGCAGAGAGGGAGTGGCCAA 5511
|||||||||||||||||||||||||
Db 121 GAGCGCGCAGAGAGGGAGTGGCCAA 145
Accordingly, it would have been prima facie obvious for one of ordinary skill in the art seeking to produce an AAV particle suitable for gene therapy for ocular or inner ear disorder would combine the teaching of prior art to modify the pharmaceutical composition comprising AAV particle by substituting the VEGF binding agent with the nucleic acid encoding an antibody Fab directed against VEGF such as ranibizumab as disclosed in Simons, for successful delivery and transduction of virus particle in inner ear cells in a modified phosphate buffer salien (PBS) by further incorporating (poloxamer-188) as suggested by Bennicelli/Mathur, to formulate a more stable formation containing AAV particle , with reasonable expectation of success, before the effective filing date of instant application. A person of ordinary skill in the art seeking to express the coding sequence in target cell or ear would be further motivated to modify the AAV particle by using Anc80L65 that is flanked by AAV2 ITRs as disclosed in Vandenberghe using the known sequence of AAV ITR as in Colosi, with reasonable expectation of success. Said modification amounting to combining prior art elements according to known methods to yield predictable results. It would have been customary for an artisan of ordinary skill to determine the optimal concentration of each element of PBS to achieve the desired results of treating inner ear or ocular disorder. Regarding limitation of claims 62 pertaining to the concentration of AAV particle in claimed volume is explicitly taught in prior art which falls within the claimed concentration and volume. It is noted that the courts have stated where the claimed ranges “overlap or lie inside the ranges disclosed by the prior art” and even when the claimed ranges and prior art ranges do not overlap but are close enough that one skilled in the art would have expected them to have similar properties, a prima facie case of obviousness exists (see In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990); Titanium Metals Corp. of America v. Banner, 778 F2d 775. 227 USPQ 773 (Fed. Cir. 1985) (see MPEP 2144.05.01). Thus, absent some demonstration of unexpected results from the claimed parameter, the optimization of concentration of Na2HPO4 , K2HPO4 , NaCl within PBS would have been obvious to optimize the concentration of each at the time of applicant's invention as evident from the teaching of Mathur. "Where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955). See MPEP 2144.05 One of ordinary skill in the art would be motivated to do so as prior art recognized without surfactant (PF-68) most of the AAV is lost to inert surfaces thereby reducing the dose that is delivered for therapy (see Bennicelli, page 463, col. 2, last para). Absent evidence of any unexpected and/or superior result, one who would have practiced the invention would have had reasonable expectation of success because prior art (i) recognized usefulness to deliver ranibizumab encoded by DNA using AAV2/Anc80L65 that is known to transduces hair cells with high efficiency and overcomes the low transduction rates that have limited development of cochlear gene therapy using conventional AAV serotypes and (ii) reported using PF68 to the formulation containing PBS to improve the stability of the AAV particle. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (www.uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf).
Thus, the claimed invention, as a whole, is clearly prima facie obvious in the absence of evidence to the contrary.
Response to arguments
Applicants disagree with the rejection arguing in part extensively that cited reference of Natsoulis et al do not cure the deficiency of prior art of using symmetrical ITR sequence. Applicant extensively rebut the teaching of Natsoulis to assert that the specific pair of ITRs are
not disclosed by any of the prior art of record. Applicant continue to argue that there is also no explanation as to why a POSA would have had a reasonable expectation of success to use the single ITR disclosed in Natsoulis with any particular 3' ITR to arrive at the presently claimed subject matter. Regarding Natsoulis, which is the only cited reference that discloses even one of the claimed ITRs, Applicant notes that this reference clearly teaches away from using an AAV particle comprising a pair of ITRs as presently claimed at least because Natsoulis focuses on using a single disclosed AAV ITR in a "nucleotide sequence integration system that is capable of
providing the site-specific integration characteristics of AAV" which "can be produced without
the concomitant production of contaminating wild-type virions," i.e. in a context other than an
AAV. Natsoulis at pp.6-7. Moreover, Natsoulis fails to disclose the 3' ITR. Applicant assert that there would have been no reasonable expectation of success at least because the ordinarily skilled artisan would not know which AAV2 ITRs to use in an AAV particle based on the generic "AAV2 ITR" disclosure in Vandenberghe and Suzuki, and the single ITR disclosed in Natsoulis. Applicants’ arguments have been fully considered, but are not found persuasive.
As an initial matter, applicant’s argument pertaining to the teaching of Natsoulis is moot in view of new grounds of rejection. To the extent that Applicants’ arguments are pertinent to the new rejections, they are addressed as follows:
In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). In response to applicant's argument that prior art only discloses two ITR that are not identical as presently claimed symmetrical ITR, the test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). In the instant case, it is Vandenberghe who teaches AAV2/Anc80 L65 comprising (i) an Anc80L65 capsid and (ii) a nucleic acid construct comprising a reported gene under the control of CMV promoter that is flanked by AAV2 ITR (see example 2-3, 7, page 28, lines 23-24, fig. 10-11) (emphasis added). The newly cited reference of Colosi provide the relevant sequence of a wild type 5' AAV2 ITR were known in art. Further, it is also known in art that 5' ITR often initiates the packaging and replication, whereas 3'ITR is complementary sequence that interacts with the 5'ITR during replication and packaging. This routine understating in the art is evident from Colosi (now cited as part of obviousness rejection). Further, applicant's own specification states:
“[o]ne of skill in the art will appreciate that a 5' or "left" orientation ITR can also be
depicted as a 3' or "right" ITR when converting from sense to antisense direction. Further, it is
well within the ability of one of skill in the art to transform a given sense ITR sequence (a 5'/left
AAV ITR) into an antisense sequence (e.g., 3'/right ITR sequence). One of ordinary skill in the
art would understand how to modify a given ITR sequence for use as either a 5'/left or 3'/right
ITR, or an antisense version thereof (see para. 365 of the instant application).
In view of forgoing, it is apparent that the wild type pair of AAV2 ITRs were known in art and one of ordinary skill in the art would have known that a 5' or "left" orientation ITR can also be depicted as a 3' or "right" ITR when converting from sense to antisense direction and
therefore, the sequence would be obvious to one of ordinary skill in the art as evident from the teaching of Colosi.
Therefore, in view of the fact patterns of the instant case, and the ground of rejection
outlined by the examiner, applicants’ arguments are not compelling and do not overcome the
rejection of record.
Withdrawn- Claim Rejections - 35 USC § 112
Claims 51, 54-58, 60-62 and 71 were rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. Applicant’s amendments to the claims obviate the basis of the rejection. Applicants’ arguments with respect to the withdrawn rejections are thereby rendered moot.
Withdrawn -Double Patenting
Claims 51, 54-55, 58, 60-62 and 71 were provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 51-55, 57-61, 71-78 and 79 of copending Application No. 19095986 in view of Bennicelli et al (Molecular Therapy, 2008, 16 (3), 458-465)/ Simons (WO2019126329, dated 6/27/2019, IDS). In view of Applicants’ terminal disclaimer dated February 26, 2026, the previous rejections are rendered moot and hereby withdrawn.
Claims 51, 54-55, 58, 60-62 and 71 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 of USP 12365726 in view of Bennicelli et al (Molecular Therapy, 2008, 16 (3), 458-465)/ Simons (WO2019126329, dated 6/27/2019, IDS). Applicant’s argument is found persuasive; therefore, previous rejection is hereby withdrawn. Applicants’ arguments with respect to the withdrawn rejections are thereby rendered moot.
New-Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 51, 54-55, 58, 60-62 and 72 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 27, 29-40, 51-60 of copending Application No 18254653 in view of Mathur (US 20230242939, EFD, 01/29/2020). Although the claims at issue are not identical, they are not patentably distinct from each other because the pharmaceutical composition claimed in the instant application is explicitly encompassed by the method of contacting an inner ear cell, treating hearing loss or inner ear disorder as recited in ‘653. In the instant case, claims are directed to a pharmaceutical composition comprising an adeno-associated virus (AAV) particle, wherein the AAV particle comprises:(i) a nucleic acid construct comprising a coding sequence operably linked to a promoter, wherein the coding sequence encodes a vascular endothelial growth factor (VEGF) binding agent or a portion thereof, and(ii) an AAV Anc80 capsid,wherein the coding sequence comprises a first nucleic acid sequence that encodes a first polypeptide of the VEGF binding agent and a second nucleic acid sequence that encodes a second polypeptide of the VEGF binding agent, wherein (a) the first polypeptide comprises the amino acid sequence of SEQ ID NO: 16, and (b) the second polypeptide comprises the amino acid sequence of SEQ ID NO: 20, wherein the coding sequence is flanked by a 5' ITR comprising the nucleic acid sequence of SEQ ID NO: 45, and a 3' ITR comprising the nucleic acid sequence of SEQ ID NO: 46, and wherein the composition comprises:(i) 8.1 mM sodium phosphate dibasic,(ii) 1.5 mM monopotassium phosphate,(iii) 2.7 mM potassium chloride,(iv) 172 mM sodium chloride, and(v) 0.001 % Poloxamer 188. Dependent claim limits the composition of claim 51, wherein the AAV Anc80 capsid is an AAV Anc80L65 capsid comprising the sequence of SEQ ID NO: 114. Claim 62 limits the pharmaceutical composition of claim 51, wherein the composition has a volume of 0.01 mL to 2.00 mL and wherein the nucleic acid construct comprises a nucleic acid sequence according to SEQ ID NO: 91 or 92. In contrast, claims in ‘653 use an adeno- associated virus (AAV) particle, comprising:(i) a nucleic acid construct comprising a coding sequence operably linked to a promoter, wherein the coding sequence encodes a vascular endothelial growth factor (VEGF) binding agent or a portion thereof; and(ii) AAV Anc80 capsid, wherein the coding sequence includes a first nucleic acid sequence that encodes a first polypeptide of the VEGF binding agent and a second nucleic acid sequence that encodes a second polypeptide of the VEGF binding agent, and wherein the first polypeptide comprises the amino acid sequence of SEQ ID NO: 16, and the second polypeptide comprises the amino acid sequence of SEQ ID NO: 20, and wherein the coding sequence is flanked by (a) a 5' ITR comprising the nucleic acid sequence of SEQ ID NO: 45 and (b) a 3' ITR comprising the nucleic acid sequence of SEQ ID NO:46. Dependent claims limit the AAV Anc80 capsid is an AAV Anc80L65 capsid, wherein the AAV Anc80 capsid comprises an amino acid sequence according to SEQ ID NO: 113 or SEQ ID NO: 114 (see claims 58-59), wherein the nucleic acid construct comprises a nucleic acid sequence according SEQ ID NOs: 91 or 92 (claim 60). The claims in ‘653 differs from claimed invention by not disclosing the composition comprises :(i) 8.1 mM sodium phosphate dibasic,(ii) 1.5 mM monopotassium phosphate,(iii) 2.7 mM potassium chloride,(iv) 172 mM sodium chloride, and(v) 0.001 % Poloxamer 188. Mathur cure the deficiency by disclosing reported formulating AAV particle in PBS that may comprise sodium chloride, potassium chloride, disodium phosphate, monopotassium phosphate, and distilled water (see para. 572), wherein dibasic sodium phosphate may be 8.1-8.6 mM (see para. 575) and monopotassium phosphate is in a range of 1.2-1.7 mM, Sodium chloride may be in formulation ranging from 171-172mM (see para. 582), KCl ranging from 1.2-1.7 mM (see para. 587) and 0.001% poloxamer 188 (See claim 91 of ‘939). Accordingly, it would have been prima facie obvious for one of ordinary skill in the art seeking to use an AAV particle suitable for gene therapy to modify the AAV particle composition of ‘653 by formulating in PBS with PF-68 as suggested in Mathur, for successful delivery and transduction of virus particle in inner ear cells, with reasonable expectation of success.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANOOP K. SINGH whose telephone number is (571)272-3306. The examiner can normally be reached Monday-Friday, 8AM-5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571)272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ANOOP K SINGH/ Primary Examiner, Art Unit 1632