DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 02/26/2026 has been entered.
Applicant’s amendments to the claims and arguments filed on February 26, 2026 have been received and entered. Claims 1-50, 56 have been canceled, while claim 51, 61-64 have been amended. Claims 80-81 are newly added. Claims 51-55, 57-70, 73-80 and 81 are pending in the instant application.
Election/Restrictions
Applicant’s election without traverse of claims 51-61 in the reply filed on July 8, 2025 was acknowledged.
Claims 62-70 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention there being no allowable generic or linking claim. Election was made without traverse in the reply filed on July 8, 2025.
Claims 51-55, 57-61, 73-80 and 81 are under consideration.
Priority
This application is a Divisional of US application no 18/134,095 filed on 04/13/2023, which is a continuation of PCT/US21/61205 filed on 11/30/2021, which claims priority from US provisional 63/152,832 filed on 02/23/2021 and 63/120,189 filed on 12/01/2020
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 02/26/2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement has been considered by the examiner.
Withdrawn-Claim Rejections - 35 USC § 103
Claims 51-55, 57-61 remain rejected and claim 73-78 are also rejected under 35 U.S.C. 103 as being unpatentable Vandenberghe (WO/2015/054653, 4/15/2015, IDS), as evidenced by Suzuki (Scientific Reports, 2017, 7: 45524, 1-10, IDS), and Simons (WO2019126329, dated 6/27/2019, IDS). Upon further consideration previous rejection is hereby withdrawn in view of new combination of prior art rejection set forth below.
Claims 51-52, 61 and 79 are rejected under 35 U.S.C. 103 as being unpatentable Vandenberghe (WO/2015/054653, 4/15/2015, IDS), as evidenced by Suzuki (Scientific Reports, 2017, 7: 45524, 1-10, IDS), Simons (WO2019126329, dated 6/27/2019, IDS) and further in view of Zinn (Cell Reports 12, 1056–1068)/ Landegger (Nature Biotech, 2017, 280-284)/Gu (ANC-80: Spotlight, 2018, 753-769). The rejection is withdrawn for the reasons discussed above.
Claims 51, 61, 71,72 are rejected under 35 U.S.C. 103 as being unpatentable Vandenberghe (WO/2015/054653, 4/15/2015, IDS), as evidenced by Suzuki (Scientific Reports, 2017, 7: 45524, 1-10, IDS), Simons (WO2019126329, dated 6/27/2019, IDS) and further in view of Zinn (Cell Reports 12, 1056–1068)/ Landegger (Nature Biotech, 2017, 280-284)/Gu (ANC-80: Spotlight, 2018, 753-769) in view of Natsoulis et al (WO9709442, dated 3/13/1997). The rejection is withdrawn for the reasons discussed above.
New-Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 51-55, 57-61, 73-78, 81 and 82 are also rejected under 35 U.S.C. 103 as being unpatentable Vandenberghe (WO/2015/054653, 4/15/2015, IDS), as evidenced by Suzuki (Scientific Reports, 2017, 7: 45524, 1-10, IDS), and Simons (WO2019126329, dated 6/27/2019, IDS) and Colosi (WO2015038625, dated 03/19/2015).
Claim interpretation: The transitional phrase “comprising” which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004) (se MPEP 2111.03).
Regarding claims 80-8, recitation of a sequence according to SEQ ID NO is interpreted as any sequence including a contiguous that is according to SEQ ID NO.
Regarding claims 51-55, 57, 59-61, 77-78 Vandenberghe teaches a composition comprising (i) an Anc80L65 capsid and (ii) a nucleic acid construct comprising a gene of interest (reported gene) under the control of CMV promoter (see example 3 and page 29, lines 19-24, example 2-3, 7, page 28, lines 23-24, fig. 10-11). It is noted that Vandenberghe teaches producing viral particle by co- transfecting HEK293 cells with (a) the plasmid encoding the luciferase transgene (expressed by the CMV promoter) flanked by AAV2 ITRs, (b) the AAV packaging plasmid encoding AAV2 rep and the synthesized capsid proteins (see example 1 that includes ancestral AA V sequences Anc80L65),) (c) AAV2-AAP expressing capsid, and (d) adenoviral helper genes needed for AAV packaging and assembly (see example 3). Vandenberghe contemplate using VEGF binding agent that is ranibizumab encoded by DNA that produced in cells transduced with vector containing said transgene (see example 10). Given that Vandenberghe reported using the composition AAV particle comprising a AAVanc80capsid and transgene for treating hearing loss (see page 20, lines line 17 and page 21, lines 11-28). therefore, it is interpreted as a pharmaceutical composition (limitation of claims 59 77). Vandenberghe teaches the amount of AAV in the composition is about 1x101 to I x 1012 genome copies (GCs) in about 0.1 ml to about 10 ml of a solution meeting the limitation of 51-55 (see page 21, lines 29-31) (limitation of claims 53-54, 73). The teaching of Vandenberghe is further supported by disclosure of Suzuki who reported use of 3.84 × 1012 genome copy/mL of AAV2/Anc80L65 comprising AAV2 ITR flanked genome encoding CMV driven EGFP is capable of transducing all inner hair cells and the majority of outer hair cells in an adult cochlea via virus injection into the posterior semicircular canal (abstract), wherein AAV2/Anc80L65 is produced by co-transfection of three constructs (dF6 adenoviral helper, pAAV2/Anc80L65 encoding AAV2 rep and Anc80L65 cap genes, and the ITR flanked transgene plasmid) in HEK293 cells (see page 8, para. 3).
With respect to claims 57-58, 75-76 Vandenberghe teaches that AAV Anc80 capsid is an AAVAnc80L65 capsid comprising the amino acid sequence as set forth in SEQ IDNO: 23 that has 100% sequence identity to the amino acid sequence according to SEQ ID NO: 114 (see claim 11, sequence search result).
Vandenberghe differs from claimed invention by not disclosing that the construct comprising coding sequence includes a first nucleic acid sequence that encodes a first polypeptide of the VEGF binding agent and a second nucleic acid sequence that encodes a second polypeptide of the VEGF binding agent, wherein (a) the first polypeptide comprises the amino acid sequence of SEQ ID NO: 16, (b) the second polypeptide comprises the amino acid sequence of SEQ ID NO: 20 (limitation of claim 51 and 61).
PNG
media_image1.png
200
400
media_image1.png
Greyscale
Simons cure the deficiency by teaching a nucleic acid construct comprising a coding sequence encoding an antibody Fab directed against VEGF such as ranibizumab (see page 30). It is further disclosed that the construct includes a promoter that is operably linked to the sequence encoding the antibody or the antigen-binding antibody fragment (see page 58, lines 28-34, page 59, line 1-3, line 32-34 to page 60, line 1), wherein said construct is packaged in any AAV capsid to target cochlear hair cells (see page 43, line 16). Simons teaches SEQ ID NO: 54 of heavy chain ranibizumab that has 100% sequence identity to VEGF binding agent comprising the amino sequence of SEQ ID NO: 16 (example 1, also see sequence search report) (limitation of claims 51, 58 and 61) and SEQ ID NO: 7 of light chain ranibizumab that has 100% sequence identity to SEQ ID NO: 20 (limitation of claim 51). It is further disclosed that between the nucleic acid sequence encoding for VH and VL, a self-cleaving peptide T2A sequence is introduced (see page 69, lines 20-25, page 72, lines 15-18, page 75, lines 33 to page 76, line 1-4, fig, 1 C). Simons teaches a composition comprising the AAV as discussed above for claim 1 (see page 20, lines 1-2). Simons teach a composition comprising the AAV vector and a pharmaceutical carrier (see page 63, lines 1-20).
Regarding , claims 81-82, Simons teaches SEQ ID NO: 51 that has a 100% contiguous sequence according to SEQ ID NO: 91 and 92 (see sequence search results).
The combination of references differs from claimed invention by not disclosing wherein the coding sequence is flanked by a 5’ ITR comprising the nucleic acid sequence of SEQ ID NO: 45, and a 3’ ITR comprising the nucleic acid sequence of SEQ ID NO: 46.
Colosi provides evidence that nucleotide sequence of AAV2 ITRs are well known in prior art. Colosi teaches AAV2 ITR comprise a 5' ITR comprising a nucleic acid sequence as set forth in bases 1-15 of SEQ ID NO: 9 that has 100% sequence identity to SEQ ID NO: 45, and a 3' ITR comprising a nucleic acid sequence as set forth in bases 53367-5511 of SEQ ID NO: 9 that has 100% sequence identity to SEQ ID NO: 46 (see below).
US-19-095-986-45
Query Match 2.6%; Score 145; DB 1; Length 145;
Best Local Similarity 100.0%;
Matches 145; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 TTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGG 60
Qy 61 CGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTG 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 CGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTG 120
Qy 121 GCCAACTCCATCACTAGGGGTTCCT 145
|||||||||||||||||||||||||
Db 121 GCCAACTCCATCACTAGGGGTTCCT 145
Query Match 2.6%; Score 145; DB 1; Length 145;
Best Local Similarity 100.0%;
Matches 145; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 5367 AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGG 5426 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGG 60
Qy 5427 CCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGC 5486 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 CCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGC 120
Qy 5487 GAGCGCGCAGAGAGGGAGTGGCCAA 5511
|||||||||||||||||||||||||
Db 121 GAGCGCGCAGAGAGGGAGTGGCCAA 145
Accordingly, it would have been prima facie obvious for one of ordinary skill in the art seeking to produce a composition comprising AAV particle suitable for gene therapy for ocular or inner ear disorder would combine the teaching of prior art to modify the composition of Vandenberghe by substituting the VEGF binding agent with the nucleic acid encoding an antibody Fab directed against VEGF such as ranibizumab as disclosed in Simons, for successful delivery and transduction of virus particle in inner ear cells, with reasonable expectation of success, before the effective filing date of instant application. A person of ordinary skill in the art seeking to express the coding sequence in hair cells of inner ear would be motivated to modify the AAV particle by using Anc80L65 that is flanked by AAV2 ITRs as disclosed in Vandenberghe using the known sequence of AAV ITR as in Colosi, with reasonable expectation of success. Said modification amounting to combining prior art elements according to known methods to yield predictable results. Regarding limitation of claims 51-55 and 61 pertaining to the concentration of AAV particle in claimed volume is explicitly taught in prior art which falls within the claimed concentration and volume. It is noted that the courts have stated where the claimed ranges “overlap or lie inside the ranges disclosed by the prior art” and even when the claimed ranges and prior art ranges do not overlap but are close enough that one skilled in the art would have expected them to have similar properties, a prima facie case of obviousness exists (see In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990); Titanium Metals Corp. of America v. Banner, 778 F2d 775. 227 USPQ 773 (Fed. Cir. 1985) (see MPEP 2144.05.01). Further limitation of claims 55 and 74 would also be obvious in view of teaching of Vandenberghe as MPEP 2144.05 states “ a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are merely close. Titanium Metals Corp. of America v. Banner, 778 F.2d 775, 783, 227 USPQ 773, 779 (Fed. Cir. 1985)”. One of ordinary skill in the art would be motivated to do so as prior art recognized usefulness to deliver ranibizumab encoded by DNA using AAV2/Anc80L65 that is known to transduces hair cells with high efficiency and overcomes the low transduction rates that have limited development of cochlear gene therapy using conventional AAV serotypes (see above Vandenberghe and Suzuki, page 7, para. 3). One who would have practiced the invention would have had reasonable expectation of success because it would have only required routine experimentation to substitute the construct of Vandenberghe /Suzuki with constrict encoding antibody Fab such as ranibizumab as disclosed in Simons and as suggested by Vandenberghe. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (www.uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf).
Thus, the claimed invention, as a whole, is clearly prima facie obvious in the absence of evidence to the contrary.
Claims 51-52, 61 and 79 are rejected under 35 U.S.C. 103 as being unpatentable Vandenberghe (WO/2015/054653, 4/15/2015, IDS), as evidenced by Suzuki (Scientific Reports, 2017, 7: 45524, 1-10, IDS), and Simons (WO2019126329, dated 6/27/2019, IDS) and Colosi (WO2015038625, dated 03/19/2015) as applied above and further in view of Zinn (Cell Reports 12, 1056–1068)/ Landegger (Nature Biotech, 2017, 280-284)/Gu (ANC-80: Spotlight, 2018, 753-769).
The teaching of Vandenberghe, as evidenced by Suzuki and Simons, Colosi have been described above and relied in same manner here. The combination of references differs from claimed invention by not disclosing AAV particle in composition to about 1.3x1012 vg/ml or about 4.5x1011vg.
Zinn teaches administering high dose of 5 X 1011 GCs to show distribution of Anc80L65 in liver, heart , spleen, kidney, and lung (See table S1). It is further disclosed that Anc80L65 leads consistently to higher expression levels per cell. A limited number of cells in the inner retina are also observed to be GFP positive Anc80L65 transduction (Figure 4A). Likewise, Landegger teaches prior reports, transduction of OHCs is minimal ( <5%) for all conventional AAV serotypes tested. In contrast, Anc80L65 transduced nearly 100% of IHCs and ~90% of OHCs (Fig. 2a-c) at a lower dose of 1.36 x 1012 GC (see 281, col. 2, last para.). Landegger teaches cochlea exposed to two different Anc80L65-eGFP titers (1.80 x 1012 versus 1.36 x 1012 GC) exhibit hair cells transduction (see fig. 3). This is further supported by Gu who teaches making stick of clinical grade AAV/Anc80 having titer ranging from 1.26x1011 or 2.7x1012 vg/ml to 1.01x1013 vg/ml (table 3).
Accordingly, it would have been prima facie obvious for one of ordinary skill in the art seeking to produce a composition comprising AAV particle suitable for gene therapy for ocular or inner ear disorder would combine the teaching of prior art to modify the composition of Vandenberghe by substituting the VEGF binding agent with the nucleic acid encoding an antibody Fab directed against VEGF such as ranibizumab as disclosed in Simons, for successful delivery and transduction of virus particle in inner ear cells, with reasonable expectation of success, before the effective filing date of instant application. Said modification amounting to combining prior art elements according to known methods to yield predictable results. Regarding limitation of claims 52, 79 pertaining to the concentration of AAV particle in claimed volume is explicitly taught in prior art which falls within the claimed concentration and volume. It would have been obvious to optimize the concentration from a stock concentration disclosed in Suzuki to dilute to an effective dose disclosed in Zinn/ Landegger/Gu to formulate in requisite volume depending upon the subject in need thereof. It is noted that the courts have stated where the claimed ranges “overlap or lie inside the ranges disclosed by the prior art” and even when the claimed ranges and prior art ranges do not overlap but are close enough that one skilled in the art would have expected them to have similar properties, a prima facie case of obviousness exists (see In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990); Titanium Metals Corp. of America v. Banner, 778 F2d 775. 227 USPQ 773 (Fed. Cir. 1985) (see MPEP 2144.05.01).
One of ordinary skill in the art would be motivated to do so as prior art recognized usefulness to deliver ranibizumab encoded by DNA using AAV2/Anc80L65 that is known to transduces hair cells with high efficiency and overcomes the low transduction rates that have limited development of cochlear gene therapy using conventional AAV serotypes (see above Vandenberghe and Suzuki/Zinn ( page 7, para. 3). One who would have practiced the invention would have had reasonable expectation of success because it would have only required routine experimentation to substitute the construct of Vandenberghe /Suzuki with constrict encoding antibody Fab such as ranibizumab as disclosed in Simons and as suggested by Vandenberghe. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (www.uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf).
Thus, the claimed invention, as a whole, is clearly prima facie obvious in the absence of evidence to the contrary.
Response to arguments
Applicants disagree with the rejection arguing claims 71 and 72 (the features of which are now recited in pending claims 51 and 61) ae not disclosed by combination of prior art rejection. Applicant extensively rebut the teaching of Natsoulis to assert that the specific pair of ITRs are not disclosed by any of the prior art of record. There is also no explanation as to why a POSA would have had a reasonable expectation of success to use the single ITR disclosed in Natsoulis with any particular 3' ITR to arrive at the presently claimed subject matter. Regarding Natsoulis, which is the only cited reference that discloses even one of the claimed ITRs, Applicant respectfully notes that this reference clearly teaches away from using an AAV particle comprising a pair of ITRs as presently claimed at least because Natsoulis focuses on using a single disclosed AAV ITR in a "nucleotide sequence integration system that is capable of providing the site-specific integration characteristics of AAV" which "can be produced without the concomitant production of contaminating wild-type virions," i.e. in a context other than an AAV. Natsoulis at pp.6-7. Moreover, Natsoulis fails to disclose the 3' ITR. Applicants’ arguments have been fully considered, but are not found persuasive.
In response to applicant's argument that prior art only discloses two ITR that are not identical as presently claimed symmetrical ITR, the test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981). In the instant case, it is Vandenberghe who teaches AAV2/Anc80 L65 comprising (i) an Anc80L65 capsid and (ii) a nucleic acid construct comprising a reported gene under the control of CMV promoter that is flanked by AAV2 ITR (see example 2-3, 7, page 28, lines 23- 24, fig. 10-11). In the instant case, Natsoulis was cited to show that the relevant sequence of a wild type 5' AAV2 ITR was known in art, while Simon is merely cited to show ITR from any AAV serotype could have been used before the effective filing date of instant application. Further, it is also known in art that 5' ITR often initiates the packaging and replication, whereas 3'ITR is complementary sequence that interacts with the 5'ITR during replication and packaging. It would be obvious to one of ordinary skill in the art to determine reverse complement of the wild type ITR sequence disclosed in Natsoulis. This routine understating in the art is further evident from Colosi (now rejection of record) and applicant's own specification that states:
“[o]ne of skill in the art will appreciate that a 5' or "left" orientation ITR can also be depicted as a 3' or "right" ITR when converting from sense to antisense direction. Further, it is well within the ability of one of skill in the art to transform a given sense ITR sequence (a 5'/left AAV ITR) into an antisense sequence (e.g., 3'/right ITR sequence). One of ordinary skill in the art would understand how to modify a given ITR sequence for use as either a 5'/left or 3'/right ITR, or an antisense version thereof (see para. 365 of the instant application).
In view of forgoing, it is apparent that the wild type pair of AAV2 ITR were known in art and one of ordinary skill in the art would have known that a 5' or "left" orientation ITR can also be depicted as a 3' or "right" ITR when converting from sense to antisense direction and therefore the sequence would be obvious to one of ordinary skill in the art.
Therefore, in view of the fact patterns of the instant case, and the ground of rejection outlined by the examiner, applicants’ arguments are not compelling and do not overcome the rejection of record.
Withdrawn- Claim Rejections - 35 USC § 112
Claims 51-55, 57-61, 71-78 and 79 were rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. Applicant’s amendments to the claims obviate the basis of the rejection. Applicants’ arguments with respect to the withdrawn rejections are thereby rendered moot.
Withdrawn-Double Patenting
Claims 51-55, 57-61, 71-78 and 79 were provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 51-62 of copending Application No. 19095919 in view of Vandenberghe (WO/2015/054653, 4/15/2015, IDS) as evidenced by Zinn (Cell Reports 12, 1056–1068)/ Landegger (Nature Biotech, 2017, 280-284). In view of Applicants’ terminal disclaimer dated February 26, 2026, the previous rejections are rendered moot and hereby withdrawn.
Claims 51-55, 57-61, 73-78 and 79, 80, 81 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 of USP 12365726 in view of Vandenberghe (WO/2015/054653, 4/15/2015, IDS) ) as evidenced by Zinn (Cell Reports 12, 1056–1068)/ Landegger (Nature Biotech, 2017, 280-284). Applicant’s argument is found persuasive; therefore, previous rejection is hereby withdrawn. Applicants’ arguments with respect to the withdrawn rejections are thereby rendered moot.
Conclusion
No claims allowed.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Earley et al (Human Gene Therapy, Vol. 31, 3-4, 151-162).
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANOOP K. SINGH whose telephone number is (571)272-3306. The examiner can normally be reached Monday-Friday, 8AM-5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571)272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ANOOP K SINGH/ Primary Examiner, Art Unit 1632