DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims Status
Claims 14-17 are canceled.
Claims 3-12 are amended.
Claims 1-13 and 18-20 are pending.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 02/17/2025 is acknowledged. The submission is in compliance with the provision of 37 CFR 1.97. Accordingly, the information disclosure statement has been considered.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (see line 20, pg. 2 and line 34 pg. 31). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-13 and 18-20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 1 (and claims 2-6, 8-13, and 18-20 dependent on) and 7 are directed to all possible gene constructs wherein the nucleotide sequence encoding the polypeptide linker is selected from the group consisting of all possible “a) nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 11, 12, or 13; b) nucleotide sequences comprising a sequence that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 14, 15, or 16; c) nucleotide sequences which differs from the sequence of a nucleotide of sequence (b) due to the degeneracy of the genetic code. Claim 1 (and claims 2-10, 12-13 and 18-20 dependent on) and Claim 11 are directed to all possible gene constructs wherein the nucleotide sequence encoding an alpha subunit of a beta-hexosaminidase is selected from the group consisting of: all possible a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with he amino acid sequence of SEQ ID NOs: 1 or 2; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 3, 4, 5, 64, 66, or 68, and c) all possible nucleotide sequences with differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code and/or wherein the nucleotide sequence encoding a beta subunit of a beta-hexosaminidase is selected from the group consisting of : a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 6 or 7; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 8, 9, 10, 65, 67, or 69 and c) all possible nucleotide sequences with differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code. The specification, however, only provides the representative species of:
(claim 1 (and claims 2-6, 8-13, and 18-20 dependent on) and claim 7) a gene construct wherein the nucleotide sequence encoding the peptide linker is selected from a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that has 100% sequence identity to SEQ ID Nos. 11, 12, and 13 (b) a nucleotide sequence comprising a sequence that has 100% sequence identity to SEQ ID NO: 14, 15, or 16 c) a nucleotide sequence of b) SEQ ID NOs: 14, 15, 16;
(claim 1 (and claims 2-10, 12-13 and 18-20 dependent on) and claim 11) a gene construct wherein the nucleotide sequence encoding an alpha-subunit of beta-hexosaminidase is selected from a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that has 100% sequence identity to SEQ ID NOs: 1 or 2 b) a nucleotide sequence that has 100% identity with the nucleotide sequence of SEQ ID NOs: 3, 4, 5, 64, 66 or 68 c) a nucleotide sequence of b) SEQ ID NOs: 3, 4, 5, 64, 66, or 68, and/or a gene construct wherein the nucleotide sequence encoding an beta-subunit of beta-hexosaminidase is selected from a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that has 100% sequence identity to SEQ ID NOs: 6 or 7 or 2 b) a nucleotide sequence that has 100% identity with the nucleotide sequence of SEQ ID NOs: 8, 9,10 ,65, 67, or 69 c) a nucleotide sequence of b) SEQ ID NOs: 8, 9,10 , 65, 67, or 69. There is no disclosure of any particular structure to function/activity relationship in the disclosed species. Chen et al. (Advanced Drug Delivery Reviews, Vol. 65, pg. 1357-1369; published 2013) teaches that the successful construction of a recombinant fusion protein requires two indispensable elements: the component of proteins and the linkers. Chen teaches that the selection of a suitable linker to join the protein domains can be complicated. The selection or rational design of a linker to join fusion protein domains is an important yet underexplored area in recombinant fusion protein technology (see pg. 1358). The catalytic mechanism of beta-hexosaminidase is poorly understood at the atomic level and is generally described through the paradigmatic mechanism of the glycoside hydrolase family (see Passos et al., Theoretical Chemistry Accounts, Vol. 129, pg. 119-129; published 2011). The specification also fails to describe additional representative species of polypeptides and nucleotide sequences with beta-hexosaminidase activity by any identifying structural characteristics or properties, for which no predictability of structure is apparent.
Regarding the level of skill and knowledge of the art of amino acid mutation, the reference of Singh et al. (Curr. Protein Pept. Sci. 18:1-11, 2017, cited on the attached Form PTO-892) reviews various protein engineering methods and discloses that despite the availability of an ever-growing database of protein structures and highly sophisticated computational algorithms, protein engineering is still limited by the incomplete understanding of protein functions, folding, flexibility, and conformational changes (see column 1, top, pg. 7). Also, the unpredictability associated with amino acid mutations is exemplified by the reference of Zhang et al. (Structure 26:1474-1485, 2018, cited on the attached Form PTO-892) which discloses that even a mutation of a surface residue that was predicted to be benign caused significant structural changes and unexpected effects on the function of a polypeptide (column 1, pg. 1475). Furthermore, regarding the level of skill and knowledge in the art of peptide linkers, Li et al. (Appl. Microbiol. Biotechol., Vol. 100, pg. 215-25; published 2016) teaches that although linker flexibility has been shown to be important for functionality of various fusion proteins, there are still few quantitative studies on the extent of linker flexibility and its effect on functions of fusion proteins, mainly due to the limited linker types with controlled flexibility. Li teaches that structure function relationship of fusion proteins can be retained in newly designed proteins as long as the basic units/fragments are properly defined and assembled. However, as for the linker design, few attempts with limited success have been conducted (see pg. 222).
Given this lack of additional representative species as encompassed by the claims, Applicants have failed to sufficiently describe the claimed invention, in such full, clear, concise, and exact terms that a skilled artisan would recognize Applicants were in possession of the claimed invention.
Claims 1-13 and 18-20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for:
(claim 1 (and dependent claims 2-6, 8-13, and 18-20) and claim 7) a gene construct wherein the nucleotide sequence encoding the peptide linker is selected from a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that has 100% sequence identity to SEQ ID Nos. 11, 12, and 13 (b) a nucleotide sequence comprising a sequence that has 100% sequence identity to SEQ ID NO: 14, 15, or 16 c) a nucleotide sequence of b) SEQ ID NOs: 14, 15, 16;
(claim 1 (and dependent claims 2-10, 12-13, and 18-20) and claim 11) a gene construct wherein the nucleotide sequence encoding an alpha-subunit of beta-hexosaminidase is selected from a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that has 100% sequence identity to SEQ ID NOs: 1 or 2 b) a nucleotide sequence that has 100% identity with the nucleotide sequence of SEQ ID NOs: 3, 4, 5, 64, 66 or 68 c) a nucleotide sequence of b) SEQ ID NOs: 3, 4, 5, 64, 66, or 68, and/or a gene construct wherein the nucleotide sequence encoding an beta-subunit of beta-hexosaminidase is selected from a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that has 100% sequence identity to SEQ ID NOs: 6 or 7 or 2 b) a nucleotide sequence that has 100% identity with the nucleotide sequence of SEQ ID NOs: 8, 9,10 ,65, 67, or 69 c) a nucleotide sequence of b) SEQ ID NOs: 8, 9,10 ,65, 67, or 69 does not reasonably provide enablement for :
(Claim 1 (and dependent claims 2-6, 8-13, and 18-20) and Claim 7) all possible gene constructs wherein the nucleotide sequence encoding the polypeptide linker is selected from the group consisting of all possible “a) nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 11, 12, or 13; b) nucleotide sequences comprising a sequence that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 14, 15, or 16; c) nucleotide sequences which differs from the sequence of a nucleotide of sequence (b) due to the degeneracy of the genetic code;
(Claim 1 (and claims 2-10, 12-13, and 18-20 dependent on) and Claim 11) all possible gene constructs wherein the nucleotide sequence encoding an alpha subunit of a beta-hexosaminidase is selected from the group consisting of: all possible a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 1 or 2; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 3, 4, 5, 64, 66, or 68, and c) all possible nucleotide sequences with differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code and/or wherein the nucleotide sequence encoding a beta subunit of a beta-hexosaminidase is selected from the group consisting of : a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with he amino acid sequence of SEQ ID NOs: 6 or 7; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 8, 9,10, 65, 67, or 69 and c) all possible nucleotide sequences with differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
Factors to be considered in determining whether undue experimentation is required, are summarized in In re Wands (858 F.2d 731, 8 USPQ 2nd 1400 (Fed. Cir. 1988)) as follows: (1) the quantity of experimentation necessary, (2) the amount of direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of those in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claim(s).
Claims 1 (and claims 2-6, 8-10, 12-13, and 18-20 dependent on), 7 and 11 are so broad as to encompass ( Claim 1 (and claims 2-6, 8-13, and 18-20 dependent on) and Claim 7) all possible gene constructs wherein the nucleotide sequence encoding the polypeptide linker is selected from the group consisting of all possible “a) nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 11, 12, or 13; b) nucleotide sequences comprising a sequence that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 14, 15, or 16; c) nucleotide sequences which differs from the sequence of a nucleotide of sequence (b) due to the degeneracy of the genetic code;
(Claim 1 (and claims 2-10, 12-13, and 18-20 dependent on) and Claim 11) all possible gene constructs wherein the nucleotide sequence encoding an alpha subunit of a beta-hexosaminidase is selected from the group consisting of: all possible a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 1 or 2; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 3, 4, 5, 64, 66, or 68, and c) all possible nucleotide sequences which differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code and/or wherein the nucleotide sequence encoding a beta subunit of a beta-hexosaminidase is selected from the group consisting of : a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 6 or 7; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 8, 9,10, 65, 67, or 69 and c) all possible nucleotide sequences with differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code.
The scope of the claims is not commensurate with the enablement provided by the disclosure with regard to the extremely large number of (Claim 1 (and claims 2-6, 8-13, and 18-20 dependent on) and Claim 7) all possible gene constructs wherein the nucleotide sequence encoding the polypeptide linker is selected from the group consisting of all possible “a) nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 11, 12, or 13; b) nucleotide sequences comprising a sequence that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 14, 15, or 16; c) nucleotide sequences which differs from the sequence of a nucleotide of sequence (b) due to the degeneracy of the genetic code.
(Claim 1 (and claims 2-10, 12-13, and 18-20 dependent on) and Claim 11) all possible gene constructs wherein the nucleotide sequence encoding an alpha subunit of a beta-hexosaminidase is selected from the group consisting of: all possible a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with he amino acid sequence of SEQ ID NOs: 1 or 2; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 3, 4, 5, 64, 66, or 68, and c) all possible nucleotide sequences with differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code and/or wherein the nucleotide sequence encoding a beta subunit of a beta-hexosaminidase is selected from the group consisting of : a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 6 or 7; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 8, 9,10, 65, 67, or 69 and c) all possible nucleotide sequences with differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code.
Since the amino acid sequence and nucleotide sequence of a protein determines its structural and functional properties, predictability of which changes can be tolerated in a protein's amino acid sequence and nucleotide sequence and obtain the desired activity requires a knowledge of and guidance with regard to which amino acids in the protein's sequence, if any, are tolerant of modification and which are conserved (i.e. expectedly intolerant to modification), and detailed knowledge of the ways in which the proteins' structure relates to its function. However, in this case the disclosure is limited to that of (claim 1 (and claims 2-6, 8-13 and 18-20 dependent on) and claim 7) a gene construct wherein the nucleotide sequence encoding the peptide linker is selected from a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that has 100% sequence identity to SEQ ID Nos. 11, 12, and 13 (b) a nucleotide sequence comprising a sequence that has 100% sequence identity to SEQ ID NO: 14, 15, or 16 c) a nucleotide sequence of b) SEQ ID NOs: 14, 15, 16;
(claim 1 (and claims 2-6, 8-13, and 18-20 dependent on) and claim 11) a gene construct wherein the nucleotide sequence encoding an alpha-subunit of beta-hexosaminidase is selected from a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that has 100% sequence identity to SEQ ID NOs: 1 or 2 b) a nucleotide sequence that has 100% identity with the nucleotide sequence of SEQ ID NOs: 3, 4, 5, 64, 66 or 68 c) a nucleotide sequence of b) SEQ ID NOs: 3, 4, 5, 64, 66, or 68, and/or a gene construct wherein the nucleotide sequence encoding an beta-subunit of beta-hexosaminidase is selected from a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that has 100% sequence identity to SEQ ID NOs: 6 or 7 or 2 b) a nucleotide sequence that has 100% identity with the nucleotide sequence of SEQ ID NOs: 8, 9,10 ,65, 67, or 69 c) a nucleotide sequence of b) SEQ ID NOs: 8, 9,10 ,65, 67, or 69.
While recombinant and mutagenesis techniques are known, it is not routine in the art to screen for multiple substitutions or multiple modifications, as encompassed by the instant claims, and the positions within a protein's sequence where amino acid modifications can be made with a reasonable expectation of success in obtaining the desired activity/utility are limited in any protein and the result of such modifications is unpredictable. In addition, one skilled in the art would expect any tolerance to modification for a given protein to diminish with each further and additional modification, e.g. multiple substitutions.
The specification does not support the broad scope of the claims which encompass any possible (claim 1 (and claims 2-6, 8-13, and 18-20 dependent on) and claim 7) all possible gene constructs wherein the nucleotide sequence encoding the polypeptide linker is selected from the group consisting of all possible “a) nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 11, 12, or 13; b) nucleotide sequences comprising a sequence that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 14, 15, or 16; c) nucleotide sequences which differs from the sequence of a nucleotide of sequence (b) due to the degeneracy of the genetic code.
(claim 1 (and claims 2-10, 12-13, and 18-20 dependent on) and claim 11) all possible gene constructs wherein the nucleotide sequence encoding an alpha subunit of a beta-hexosaminidase is selected from the group consisting of: all possible a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with he amino acid sequence of SEQ ID NOs: 1 or 2; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 3, 4, 5, 64, 66, or 68, and c) all possible nucleotide sequences with differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code and/or wherein the nucleotide sequence encoding a beta subunit of a beta-hexosaminidase is selected from the group consisting of : a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 6 or 7; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 8, 9,10, 65, 67, or 69 and c) all possible nucleotide sequences with differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code because the specification does not establish: (A) regions of the polypeptide (nucleotide sequence) which may be modified effecting the beta-hexosaminidase activity; (B) the general tolerance of enzymes of the beta-hexosaminidase group to modification and extent of such tolerance; (C) a rational and predictable scheme for modifying any amino acid residue of an enzyme of the beta-hexosaminidase group with an expectation of obtaining the desired biological function; and (D) the specification provides insufficient guidance as to which of the essentially infinite possible choices is likely to be successful. Because of this lack of guidance, the extended experimentation that would be required to determine which substitutions would be acceptable to retain the required beta-hexosaminidase activities and the fact that the relationship between the sequence of a peptide and its tertiary structure (i.e. its activity) are not well understood and are not predictable (e.g., see Sheng et al, FEBS J., Vol. 24, pg. 4703-13, 2015, Ngo et al. in The Protein Folding Problem and Tertiary Structure Prediction, 1994, Merz et al. (ed.), Birkhauser, Boston, MA, pp. 433 and 492-495; Franceus et al., J. Ind. Microbiol. Biotechnol. Vol 44, pp 687-695, 2017), it would require undue experimentation for one skilled in the art to arrive at the majority of gene constructs having beta-hexosaminidase activity of the claimed genus.
Thus, applicants have not provided sufficient guidance to enable one of ordinary skill in the art to make and use the claimed invention in a manner reasonably correlated with the scope of the claims broadly including any (claim 1 (and claims 2-6, 8-13, and 18-20 dependent on) and claim 7) possible gene constructs wherein the nucleotide sequence encoding the polypeptide linker is selected from the group consisting of all possible “a) nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 11, 12, or 13; b) nucleotide sequences comprising a sequence that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 14, 15, or 16; c) nucleotide sequences which differs from the sequence of a nucleotide of sequence (b) due to the degeneracy of the genetic code;
(claim 1 (and claims 2-10, 12-13, and 18-20 dependent on) and claim 11) possible gene constructs wherein the nucleotide sequence encoding an alpha subunit of a beta-hexosaminidase is selected from the group consisting of: all possible a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 1 or 2; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 3, 4, 5, 64, 66, or 68, and c) all possible nucleotide sequences with differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code and/or wherein the nucleotide sequence encoding a beta subunit of a beta-hexosaminidase is selected from the group consisting of : a) “nucleotide sequences encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NOs: 6 or 7; b) all possible “nucleotide sequences that has at least 70% sequence identity with the nucleotide sequence of SEQ ID NOs: 8, 9,10, 65, 67, or 69 and c) all possible nucleotide sequences with differs from the sequence of a nucleotide sequence of (b) due to the degeneracy of the genetic code. The scope of the claims must bear a reasonable correlation with the scope of enablement (In re Fisher, 166 USPQ 19 24 (CCPA 1970)).
Without sufficient guidance, determination of gene constructs for expressing covalently linked alpha-beta dimer of beta-hexosaminidase comprising a) nucleotide sequence encoding an alpha-subunit of a beta-hexosaminidase; b) a nucleotide sequence encoding a peptide linker; and c) a nucleotide sequence encoding a beta subunit of beta-hexosaminidase having the desired biological characteristics is unpredictable and the experimentation left to those skilled in the art is unnecessarily, and improperly, extensive and undue. See In re Wands 858 F.2d 731, 8 USPQ2nd 1400 (Fed. Cir, 1988).
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-2, 8, 10, and 12-13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Shaimardanova et al. (Neural Regeneration Research, Vol. 17:1, pg. 122-129; published January 2022), hereinafter referred to as Shaimardanova.
With regards to claims 1-2 and 12-13, Shaimardanova discloses the development of the bicistronic vector pLX303-HEXA-HEXB (expression vector). Shaimardanova discloses a bicistronic lentiviral vector encoding cDNA of HEX a and b-subunit genes separated by the nucleotide sequence of a P2A peptide (linker). The HexA is positioned upstream from the HexB (see Abstract and Graphical Abstract, pg. 122 and figure below).
PNG
media_image1.png
224
201
media_image1.png
Greyscale
With regards to claim 8, although Shaimardanova is silent regarding the promoter of the pLX303-HEXA-HEB expression vector, the pLX303 expression vector inherently has a CMV promoter as evidenced by Addgene product information sheet (cited in the PTO-982 form).
With regards to claim 10, Shaimardanova discloses the OptimumGene algorithm was used to optimize the codon composition of cDNA of the HEXA and HEXB genes. Shaimardanova discloses that the nucleotide sequences of mRNA of the human HEXA and HEXB genes were taken as a template for codon optimization (see left panel, top paragraph, pg. 124).
Therefore, claims 1-2, 8, 10, and 12-13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Shaimardanova et al. (Neural Regeneration Research, Vol. 17:1, pg. 122-129; published January 2022).
Claims 1, 8, 9, 11, 12-13, 18-20 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Walia et al. (US Patent Application Publication No.: US 2018/0028685 A1; published February 1, 2018), hereinafter referred to as Walia.
With regards to claim 1, 12, and 18-20, Walia discloses an invention that provides nucleic acid constructs containing both HexA and HexB encoding elements in a single vector and related methods for treating GM2 gangliosidoses such as Sandhoff disease and Tay-Sach’s disease by gene therapy (see paragraph 0007). Walia discloses a composition comprising a vector, a promoter, a nucleotide sequence encoding a HEXB gene and a nucleotide sequence encoding a HEXA gene, and a nucleotide sequence encoding a self-cleaving peptide that links the HEXB gene and the HEXA gene. Walia discloses that the composition may comprise a therapeutically effective amount of at least one anti-inflammatory agent or at least one pharmaceutical chaperone agent and that the composition may be suitable for systematic administration to a subject or for intravenous administration to a subject (see paragraph 0009).
With regards to claims 8 and 13, Walia further discloses that the vector may comprise an AAV plasmid and that in one embodiment, the promoter comprises a CAG promotor (see paragraph 0008). Also, see Figure 1D, nucleotide numbering of SEQ ID NO: 1; Chicken beta actin promoter (nucleotides 442-719).
With regards to claim 9, Walia discloses that the composition comprises the construct of SEQ ID NO: 1 (see paragraph 008). According to Fig 1D in Walia, the Figure discloses the gene construct is flanked by ITR regions (nucleotides 1-188).
With regards to claim 11, Walia discloses that the sequence of HexA corresponds to nucleotides 2767-4361 of the SEQ ID NO: 1 construct (see Figure 1D). Walia discloses the entire nucleotide sequence of SEQ ID NO: 1 in Sequence listing (see Pg. 9-12). A sequence alignment of nucleotides 2767-4361 corresponding to HexA shares 99.8% sequence identity with SEQ ID NO:1 of the current instant application. (see sequence alignment below).
RESULT 1
NASEQ2_09142026_161120
Alignment Scores:
Length: 1601
Score: 2855.00 Matches: 528
Percent Similarity: 100.0% Conservative: 1
Best Local Similarity: 99.8% Mismatches: 0
Query Match: 99.9% Indels: 0
DB: 1 Gaps: 0
US-19-104-240-1 (1-529) x NASEQ2_09142026_161120 (1-1601)
Qy 1 MetThrSerSerArgLeuTrpPheSerLeuLeuLeuAlaAlaAlaPheAlaGlyArgAla 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGACAAGCTCCAGGCTTTGGTTTTCGCTGCTGCTGGCGGCAGCGTTCGCAGGACGGGCG 60
Qy 21 ThrAlaLeuTrpProTrpProGlnAsnPheGlnThrSerAspGlnArgTyrValLeuTyr 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 ACGGCCCTCTGGCCCTGGCCTCAGAACTTCCAAACCTCCGACCAGCGCTACGTCCTTTAC 120
Qy 41 ProAsnAsnPheGlnPheGlnTyrAspValSerSerAlaAlaGlnProGlyCysSerVal 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 CCGAACAACTTTCAATTCCAGTACGATGTCAGCTCGGCCGCGCAGCCCGGCTGCTCAGTC 180
Qy 61 LeuAspGluAlaPheGlnArgTyrArgAspLeuLeuPheGlySerGlySerTrpProArg 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 CTCGACGAGGCCTTCCAGCGCTATCGTGACCTGCTTTTCGGTTCCGGGTCTTGGCCCCGT 240
Qy 81 ProTyrLeuThrGlyLysArgHisThrLeuGluLysAsnValLeuValValSerValVal 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 CCTTACCTCACAGGGAAACGGCATACACTGGAGAAGAATGTGTTGGTTGTCTCTGTAGTC 300
Qy 101 ThrProGlyCysAsnGlnLeuProThrLeuGluSerValGluAsnTyrThrLeuThrIle 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 ACACCTGGATGTAACCAGCTTCCTACTTTGGAGTCAGTGGAGAATTATACCCTGACCATA 360
Qy 121 AsnAspAspGlnCysLeuLeuLeuSerGluThrValTrpGlyAlaLeuArgGlyLeuGlu 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 AATGATGACCAGTGTTTACTCCTCTCTGAGACTGTCTGGGGAGCTCTCCGAGGTCTGGAG 420
Qy 141 ThrPheSerGlnLeuValTrpLysSerAlaGluGlyThrPhePheIleAsnLysThrGlu 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 ACTTTTAGCCAGCTTGTTTGGAAATCTGCTGAGGGCACATTCTTTATCAACAAGACTGAG 480
Qy 161 IleGluAspPheProArgPheProHisArgGlyLeuLeuLeuAspThrSerArgHisTyr 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 ATTGAGGACTTTCCCCGCTTTCCTCACCGGGGCTTGCTGTTGGATACATCTCGCCATTAC 540
Qy 181 LeuProLeuSerSerIleLeuAspThrLeuAspValMetAlaTyrAsnLysLeuAsnVal 200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 CTGCCACTCTCTAGCATCCTGGACACTCTGGATGTCATGGCGTACAATAAATTGAACGTG 600
Qy 201 PheHisTrpHisLeuValAspAspProSerPheProTyrGluSerPheThrPheProGlu 220
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 TTCCACTGGCATCTGGTAGATGATCCTTCCTTCCCATATGAGAGCTTCACTTTTCCAGAG 660
Qy 221 LeuMetArgLysGlySerTyrAsnProValThrHisIleTyrThrAlaGlnAspValLys 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 CTCATGAGAAAGGGGTCCTACAACCCTGTCACCCACATCTACACAGCACAGGATGTGAAG 720
Qy 241 GluValIleGluTyrAlaArgLeuArgGlyIleArgValLeuAlaGluPheAspThrPro 260
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 721 GAGGTCATTGAATACGCACGGCTCCGGGGTATCCGTGTGCTTGCAGAGTTTGACACTCCT 780
Qy 261 GlyHisThrLeuSerTrpGlyProGlyIleProGlyLeuLeuThrProCysTyrSerGly 280
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 781 GGCCACACTTTGTCCTGGGGACCAGGTATCCCTGGATTACTGACTCCTTGCTACTCTGGG 840
Qy 281 SerGluProSerGlyThrPheGlyProValAsnProSerLeuAsnAsnThrTyrGluPhe 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 841 TCTGAGCCCTCTGGCACCTTTGGACCAGTGAATCCCAGTCTCAATAATACCTATGAGTTC 900
Qy 301 MetSerThrPhePheLeuGluValSerSerValPheProAspPheTyrLeuHisLeuGly 320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 901 ATGAGCACATTCTTCTTAGAAGTCAGCTCTGTCTTCCCAGATTTTTATCTTCATCTTGGA 960
Qy 321 GlyAspGluValAspPheThrCysTrpLysSerAsnProGluIleGlnAspPheMetArg 340
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 961 GGAGATGAGGTTGATTTCACCTGCTGGAAGTCCAACCCAGAGATCCAGGACTTTATGAGG 1020
Qy 341 LysLysGlyPheGlyGluAspPheLysGlnLeuGluSerPheTyrIleGlnThrLeuLeu 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1021 AAGAAAGGCTTCGGTGAGGACTTCAAGCAGCTGGAGTCCTTCTACATCCAGACGCTGCTG 1080
Qy 361 AspIleValSerSerTyrGlyLysGlyTyrValValTrpGlnGluValPheAspAsnLys 380
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1081 GACATCGTCTCTTCTTATGGCAAGGGCTATGTGGTGTGGCAGGAGGTGTTTGATAATAAA 1140
Qy 381 ValLysIleGlnProAspThrIleIleGlnValTrpArgGluAspIleProValAsnTyr 400
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1141 GTAAAGATTCAGCCAGACACAATCATACAGGTGTGGCGAGAGGATATTCCAGTGAACTAT 1200
Qy 401 MetLysGluLeuGluLeuValThrLysAlaGlyPheArgAlaLeuLeuSerAlaProTrp 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1201 ATGAAGGAGCTGGAACTGGTCACCAAGGCCGGCTTCCGGGCCCTTCTCTCTGCCCCCTGG 1260
Qy 421 TyrLeuAsnArgIleSerTyrGlyProAspTrpLysAspPheTyrIleValGluProLeu 440
|||||||||||||||||||||||||||||||||||||||||||||:::||||||||||||
Db 1261 TACCTGAACCGTATATCCTATGGCCCTGACTGGAAGGATTTCTACGTAGTGGAACCCCTG 1320
Qy 441 AlaPheGluGlyThrProGluGlnLysAlaLeuValIleGlyGlyGluAlaCysMetTrp 460
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1321 GCATTTGAAGGTACCCCTGAGCAGAAGGCTCTGGTGATTGGTGGAGAGGCTTGTATGTGG 1380
Qy 461 GlyGluTyrValAspAsnThrAsnLeuValProArgLeuTrpProArgAlaGlyAlaVal 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1381 GGAGAATATGTGGACAACACAAACCTGGTCCCCAGGCTCTGGCCCAGAGCAGGGGCTGTT 1440
Qy 481 AlaGluArgLeuTrpSerAsnLysLeuThrSerAspLeuThrPheAlaTyrGluArgLeu 500
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1441 GCCGAAAGGCTGTGGAGCAACAAGTTGACATCTGACCTGACATTTGCCTATGAACGTTTG 1500
Qy 501 SerHisPheArgCysGluLeuLeuArgArgGlyValGlnAlaGlnProLeuAsnValGly 520
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1501 TCACACTTCCGCTGTGAGTTGCTGAGGCGAGGTGTCCAGGCCCAACCCCTCAATGTAGGC 1560
Qy 521 PheCysGluGlnGluPheGluGlnThr 529
|||||||||||||||||||||||||||
Db 1561 TTCTGTGAGCAGGAGTTTGAACAGACC 1587
Further in regards to claim 11, Walia discloses that discloses that the sequence of HexB corresponds to nucleotides 1028-2709 of the SEQ ID NO: 1 construct (see Figure 1D). Walia discloses the entire nucleotide sequence of SEQ ID NO: 1 in Sequence listing (see Pg. 9-12). A sequence alignment of nucleotides 1028-2709, corresponding to HEXB, shares 99.8% sequence identity with SEQ ID NO:6 of the current instant application. (see sequence alignment below).
RESULT 1
NASEQ2_09142026_163029
Alignment Scores:
Length: 1682
Score: 2949.00 Matches: 555
Percent Similarity: 99.8% Conservative: 0
Best Local Similarity: 99.8% Mismatches: 1
Query Match: 99.8% Indels: 0
DB: 1 Gaps: 0
US-19-104-240-6 (1-556) x NASEQ2_09142026_163029 (1-1682)
Qy 1 MetGluLeuCysGlyLeuGlyLeuProArgProProMetLeuLeuAlaLeuLeuLeuAla 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 6 ATGGAGCTGTGCGGGCTGGGGCTGCCCCGGCCGCCCATGCTGCTGGCGCTGCTGTTGGCG 65
Qy 21 ThrLeuLeuAlaAlaMetLeuAlaLeuLeuThrGlnValAlaLeuValValGlnValAla 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 66 ACACTGCTGGCGGCGATGTTGGCGCTGCTGACTCAGGTGGCGCTGGTGGTGCAGGTGGCG 125
Qy 41 GluAlaAlaArgAlaProSerValSerAlaLysProGlyProAlaLeuTrpProLeuPro 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 126 GAGGCGGCTCGGGCCCCGAGCGTCTCGGCCAAGCCGGGGCCGGCGCTGTGGCCCCTGCCG 185
Qy 61 LeuLeuValLysMetThrProAsnLeuLeuHisLeuAlaProGluAsnPheTyrIleSer 80
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 186 CTCTCGGTGAAGATGACCCCGAACCTGCTGCATCTCGCCCCGGAGAACTTCTACATCAGC 245
Qy 81 HisSerProAsnSerThrAlaGlyProSerCysThrLeuLeuGluGluAlaPheArgArg 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 246 CACAGCCCCAATTCCACGGCGGGCCCCTCCTGCACCCTGCTGGAGGAAGCGTTTCGACGA 305
Qy 101 TyrHisGlyTyrIlePheGlyPheTyrLysTrpHisHisGluProAlaGluPheGlnAla 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 306 TATCATGGCTATATTTTTGGTTTCTACAAGTGGCATCATGAACCTGCTGAATTCCAGGCT 365
Qy 121 LysThrGlnValGlnGlnLeuLeuValSerIleThrLeuGlnSerGluCysAspAlaPhe 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 366 AAAACCCAGGTTCAGCAACTTCTTGTCTCAATCACCCTTCAGTCAGAGTGTGATGCTTTC 425
Qy 141 ProAsnIleSerSerAspGluSerTyrThrLeuLeuValLysGluProValAlaValLeu 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 426 CCCAACATATCTTCAGATGAGTCTTATACTTTACTTGTGAAAGAACCAGTGGCTGTCCTT 485
Qy 161 LysAlaAsnArgValTrpGlyAlaLeuArgGlyLeuGluThrPheSerGlnLeuValTyr 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 486 AAGGCCAACAGAGTTTGGGGAGCATTACGAGGTTTAGAGACCTTTAGCCAGTTAGTTTAT 545
Qy 181 GlnAspSerTyrGlyThrPheThrIleAsnGluSerThrIleIleAspSerProArgPhe 200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 546 CAAGATTCTTATGGAACTTTCACCATCAATGAATCCACCATTATTGATTCTCCAAGGTTT 605
Qy 201 SerHisArgGlyIleLeuIleAspThrSerArgHisTyrLeuProValLysIleIleLeu 220
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 606 TCTCACAGAGGAATTTTGATTGATACATCCAGACATTATCTGCCAGTTAAGATTATTCTT 665
Qy 221 LysThrLeuAspAlaMetAlaPheAsnLysPheAsnValLeuHisTrpHisIleValAsp 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 666 AAAACTCTGGATGCCATGGCTTTTAATAAGTTTAATGTTCTTCACTGGCACATAGTTGAT 725
Qy 241 AspGlnSerPheProTyrGlnSerIleThrPheProGluLeuSerAsnLysGlySerTyr 260
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 726 GACCAGTCTTTCCCATATCAGAGCATCACTTTTCCTGAGTTAAGCAATAAAGGAAGCTAT 785
Qy 261 SerLeuSerHisValTyrThrProAsnAspValArgMetValIleGluTyrAlaArgLeu 280
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 786 TCTTTGTCTCATGTTTATACACCAAATGATGTCCGTATGGTGATTGAATATGCCAGATTA 845
Qy 281 ArgGlyIleArgValLeuProGluPheAspThrProGlyHisThrLeuSerTrpGlyLys 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 846 CGAGGAATTCGAGTCCTGCCAGAATTTGATACCCCTGGGCATACACTATCTTGGGGAAAA 905
Qy 301 GlyGlnLysAspLeuLeuThrProCysTyrSerArgGlnAsnLysLeuAspSerPheGly 320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 906 GGTCAGAAAGACCTCCTGACTCCATGTTACAGTAGACAAAACAAGTTGGACTCTTTTGGA 965
Qy 321 ProIleAsnProThrLeuAsnThrThrTyrSerPheLeuThrThrPhePheLysGluIle 340
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 966 CCTATAAACCCTACTCTGAATACAACATACAGCTTCCTTACTACATTTTTCAAAGAAATT 1025
Qy 341 SerGluValPheProAspGlnPheIleHisLeuGlyGlyAspGluValGluPheLysCys 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1026 AGTGAGGTGTTTCCAGATCAATTCATTCATTTGGGAGGAGATGAAGTGGAATTTAAATGT 1085
Qy 361 TrpGluSerAsnProLysIleGlnAspPheMetArgGlnLysGlyPheGlyThrAspPhe 380
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1086 TGGGAATCAAATCCAAAAATTCAAGATTTCATGAGGCAAAAAGGCTTTGGCACAGATTTT 1145
Qy 381 LysLysLeuGluSerPheTyrIleGlnLysValLeuAspIleIleAlaThrIleAsnLys 400
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1146 AAGAAACTAGAATCTTTCTACATTCAAAAGGTTTTGGATATTATTGCAACCATAAACAAG 1205
Qy 401 GlySerIleValTrpGlnGluValPheAspAspLysAlaLysLeuAlaProGlyThrIle 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1206 GGATCCATTGTCTGGCAGGAGGTTTTTGATGATAAAGCAAAGCTTGCGCCGGGCACAATA 1265
Qy 421 ValGluValTrpLysAspSerAlaTyrProGluGluLeuSerArgValThrAlaSerGly 440
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1266 GTTGAAGTATGGAAAGACAGCGCATATCCTGAGGAACTCAGTAGAGTCACAGCATCTGGC 1325
Qy 441 PheProValIleLeuSerAlaProTrpTyrLeuAspLeuIleSerTyrGlyGlnAspTrp 460
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1326 TTCCCTGTAATCCTTTCTGCTCCTTGGTACTTAGATTTGATTAGCTATGGACAAGATTGG 1385
Qy 461 ArgLysTyrTyrLysValGluProLeuAspPheGlyGlyThrGlnLysGlnLysGlnLeu 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1386 AGGAAATACTATAAAGTGGAACCTCTTGATTTTGGCGGTACTCAGAAACAGAAACAACTT 1445
Qy 481 PheIleGlyGlyGluAlaCysLeuTrpGlyGluTyrValAspAlaThrAsnLeuThrPro 500
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1446 TTCATTGGTGGAGAAGCTTGTCTATGGGGAGAATATGTGGATGCAACTAACCTCACTCCA 1505
Qy 501 ArgLeuTrpProArgAlaSerAlaValGlyGluArgLeuTrpSerSerLysAspValArg 520
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1506 AGATTATGGCCTCGGGCAAGTGCTGTTGGTGAGAGACTCTGGAGTTCCAAAGATGTCAGA 1565
Qy 521 AspMetAspAspAlaTyrAspArgLeuThrArgHisArgCysArgMetValGluArgGly 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1566 GATATGGATGACGCCTATGACAGACTGACAAGGCACCGCTGCAGGATGGTCGAACGTGGA 1625
Qy 541 IleAlaAlaGlnProLeuTyrAlaGlyTyrCysAsnHisGluAsnMet 556
||||||||||||||||||||||||||||||||||||||||||||||||
Db 1626 ATAGCTGCACAACCTCTTTATGCTGGATATTGTAACCATGAGAACATG 1673
With regards to claim 18-19, Walia discloses the gene therapy constructs containing both HEXA and HEXB genes to treat GM2 gangliosidoses, including Sandhoff disease and Tay-Sach’s disease (see Abstract). Walia discloses that the composition may be suitable for systematic administration to a subject, or for intravenous administration to a subject. Walia teaches that the subject may be predisposed to having, suspect of having, or diagnosed as having a lysosomal storage disorder characterized by a deficiency in HexA expression or activity, and that HexA deficiency may comprise a partial or complete loss of endogenous expression of functional HEXA, and HEXB or both. Walia discloses that the HexA deficiency may comprise Tay-Sach’s disease or Sandhoff disease and that the composition may be for use in treating Tay-Sach’s disease and/or Sandhoff disease (see paragraph 0008).
With regards to claim 20, Walia discloses that direct administration of the pharmaceutical composition comprising the AAV9 expression constructs by intravenous administration or injection into the brain for distribution and expression of the constructs. Walia discloses that the infusion site is chosen from a group consisting of deep cerebral parenchyma intravenously or into the cerebrospinal fluid (intra-CSF administration) (see paragraph 0032).
Therefore, claims 1, 8, 9, 11, 12-13, 18-20 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Walia et al. (US Patent Application Publication No.: US 2018/0028685 A1; published February 1, 2018), hereinafter referred to as Walia.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 3-7 are rejected under 35 U.S.C. 103 as being unpatentable over Walia et al. (US Patent Application Publication No.: US 2018/0028685 A1; published February 1, 2018), hereinafter referred to as Walia, as applied to claim 1 above, and further in view of Chen et al. (Advanced Drug Delivery Reviews, Vol.65, pg. 1357-1369; published 2013), hereinafter referred to as Chen, and further in view of Pastan et al. (United States Patent Number: 5,635,599; published June 3, 1997), hereinafter referred to as Pastan.
The teachings of Walia as applied to claim 1 are summarized above.
With regards to claims 3-7, Walia does not specifically teach that the peptide linker is a flexible peptide linker, is a non-cleavable peptide, is not a self-cleavable peptide, wherein at least 30% of the amino acid residues of the peptide linker are glycine residues, or that the peptide linker is selected from the group consisting of a (a) a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid of SEQ ID NOs: 11, 12 or 13.
However, Chen teaches that as an indispensable component of recombinant fusion proteins, linkers have shown increasing importance in construction of stable, bioactive fusion proteins (see Abstract, pg. 1357). Chen teaches that flexible linkers are usually applied when joined domains require a certain degree of movement or interaction. They are generally composed of small, non-polar (e.g. Gly) or polar (e.g. Ser or Thr amino acids. Chen teaches that the small size of these amino acids provides flexibility and allows for mobility of the connection functional domains (see pg. 1357). Chen further teaches that the most widely used flexible linker has the sequence (Gly-Gly-Gly-Gly-Ser)n and by adjusting the copy number “n” the length of the GS linker can be optimized to achieve appropriate separation of the functional domains or maintain necessary inter-domain interactions (see pg. 1358). Chen further teaches the length of the flexible linkers can be adjusted to allow for proper folding or to achieve optimal biological activity of the fusion protein (see pg. 1361). Although Chen does not specifically specify that the (Gly-Gly-Gly-Gly-Ser)n linker is non-cleavable, it is known in the art that the (Gly-Gly-Gly-Gly-Ser)n linker motif is considered to be an inherently non-cleavable linker as evidenced by Allen et al. (The Journal of Gene Medicine, Vol. 6, pg. 1216-1227; published online September 30, 2004).
It would have been obvious to one of ordinary skill in the art of protein engineering to incorporate a flexible linker such as the (Gly-Gly-Gly-Gly-Ser) linker into the gene construct for expressing a covalently attached alpha beta dimer of beta-hexosaminidase taught by Walia in order to provide a linker that can function to covalently attach the HexA and HexB molecules. The motivation to do so would come from the teachings of Chen who teaches that flexible linkers such as (GGGS)n allow for joined domains to have a certain degree of movement or interaction and allows for mobility of the connected functional domains which can be optimized in length to achieve proper folding and optimal activity of the fusion protein. One of ordinary skill in the art would have expectations of success in doing so from the combined teachings of Walia and Chen who provide all the teachings, compositions, and methods needed to do so.
It would have been further obvious to one of ordinary skill in the art of protein engineering to arrive at a nucleotide sequence encoding a polypeptide comprising an amino acid sequence that has at least 70% sequence identity with the amino acid sequence of SEQ ID NO. 11 (GGGGSGGGGSGGGGSGGGGS) from the teachings of Chen who teach an example of a (GGGGS)4 linker as a flexible linker for fusion proteins (see pg.1361) and use it as the peptide linker in the gene construct taught by Walia. The motivation to do so would come from the teachings of Chen who teach the use of (GGGGS)4 as a linker for fusion proteins and who further teaches that the (GGGGS)n motif length can be optimized by adjusting the copy number “n” and allowing for the length of the GGGGS linker to optimized to achieve appropriate separation of the functional domains or maintain necessary inter-domain interactions. The combination of familiar elements according to known methods is obvious when it does no more than yield predictable results (see KSR Int’l v. Teleflex, Inc., 127 s. Ct. 1727, 1739 (2007). One of ordinary skill in the art would have expectations of success in doing so from the combined teachings of Chen and Walia who provide all the necessary teachings and methods needed to do so.
With regards to claim 7, Pastan also teaches the use of a “spacer” that is a peptide that joins the proteins comprising a fusion protein. Pastan teaches that generally a spacer has no specific biological activity other than to join the proteins or preserve a minimum distance or other special relationship between them. Pastan teaches that the constituent amino acids of a spacer may be selected to influence some property of the molecule such as folding (see lines 54-60, Column 3). Pastan teaches an amino acid sequence, SEQ ID NO: 54 that has an amino acid sequence that shares 100% sequence identity with SEQ ID NO: 11 of the current instant application (see sequence alignment below).
Query Match 100.0%; Score 112; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGGGSGGGGSGGGGSGGGGS 20
||||||||||||||||||||
Db 1 GGGGSGGGGSGGGGSGGGGS 20
It would have been obvious to one of ordinary skill in the art of protein engineering to arrive at a nucleotide sequence that shares at least 70% sequence identity with the amino acid sequence of SEQ ID NO: 11 of the current instant application by using the peptide linker, (GGGS)4 SEQ ID NO: 54; taught by Pastan), as a peptide linker in the gene construct expressing a covalently linked alpha beta dimer of beta-hexosaminidase comprising a nucleotide sequence encoding a peptide linker taught by Walia. The motivation to do so would come from the teachings of Pastan who teach that (GGGS)4 is a spacer sequence used as a linking peptide in fusion proteins (see lines 35-54, column 12). One of ordinary skill in the art would have expectations of success in doing so from the combined teachings of Walia and Pastan who provide all the necessary teachings, components, and methods to do so.
Therefore, claims 3-7 are rejected under 35 U.S.C. 103 as being unpatentable over Walia et al. (US Patent Application Publication No.: US 2018/0028685 A1; published February 1, 2018) as applied to claim 1 above, and further in view of Chen et al. (Advanced Drug Delivery Reviews, Vol.65, pg. 1357-1369; published 2013) and further in view of Pastan et al. (United States Patent Number: 5,635,599; published June 3, 1997).
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to GEORGE T LOUNTOS whose telephone number is (571)272-0502. The examiner can normally be reached Monday-Friday 8:00 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a U SPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached at 408-918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/GEORGE THEMISTOCLIS LOUNTOS/ Examiner, Art Unit 1652
/ROBERT B MONDESI/ Supervisory Patent Examiner, Art Unit 1652
