METHOD FOR ACQUIRING HUMIDITY-SENSITIVE MALE-STERILE TRITICUM AESTIVUM L.

§103 §112

DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of Claims Claims 13-19 are under examination on the merits. The objection to the specification is withdrawn in light of Applicant’s amendments. The objections to claims 14, 16-18 & 20-21 are withdrawn in light of Applicant's amendments. The rejection of claims 15-18 under 35 U.S.C. 101 is withdrawn in light of Applicant’s amendments. The rejection of claims 19-21 under 35 U.S.C. 101 is withdrawn in light of Applicant’s amendments. The rejection of claims 14-18 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement, is withdrawn in light of the provided signed statement by the Attorney of Record regarding the deposited material. Claim Objections Claims 13-16 & 19 are objected to because of the following informalities: Claim 13 (line 11) & Claim 19 (lines 9-10): "plant tagms-aabbdd Triticum aestivum L." should read --tagms-aabbdd Triticum aestivum L. plant--. Claim 14 (line 6): “self-pollinating” should read --self-pollination--. Claim 14 (lines 3, 4 & 5): --, representative seeds of which have been deposited -- should be inserted after “plant” on each line. Claim 15 (line 2, 3): --, representative seeds of which have been deposited -- should be inserted after “plant” and a comma should be inserted after “45691”. Claim 16 (line 2, 3): --, representative seeds of which have been deposited -- should be inserted after “plant” and a comma should be inserted after “45691”. Claim 19 (line 6): --plant-- should be inserted after "Triticum aestivum L.". Appropriate correction is required. Claim Rejections - 35 USC § 112 Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 13, 14 & 19 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 6/29/2026, as applied to claims 15-18. Applicant' s arguments filed 8/31/2026 have been fully considered but they are not persuasive. Claim 13 is drawn to a method comprising mutating the gene of SEQ ID NO: 8, the gene of SEQ ID NO: 10, and the gene of SEQ ID NO: 12 (lines 3-6). Claim 14 is drawn to a method requiring obtaining a plant comprising mutations in the gene of SEQ ID NO: 10, and the gene of SEQ ID NO: 12 (lines 19-21). Claim 19 requires a triple-mutant plant wherein the gene of SEQ ID NO: 8, the gene of SEQ ID NO: 10, and the gene of SEQ ID NO: 12 are mutated (lines 11-14). The recitation “gene” implies that the structure comprises the coding sequence and the associated promoter, terminator, enhancer and/or repressor regulatory encoding regions are also a part of the structure (see The Federal Register, Vol. 66, No. 4, Friday, January 5, 2001 at page 1108, left column, Endnote 13). In the instant case, SEQ ID NO: 8, 10 & 12 are coding sequences and do not comprise any regulatory or non-coding elements associated with the genes. It is indefinite whether the claims require mutation in genes which only comprise coding sequence (do not comprise introns) or if the claims encompass methods wherein genes which comprise coding sequences of SEQ ID NO: 8, 10 & 12 are mutated. If methods wherein genes which comprise coding sequences of SEQ ID NO: 8, 10 & 12 but may also comprise non-coding elements are encompassed, it is indefinite whether the required mutation of the 1595th, 6th, and 79th nucleotides refer specifically to positions of the nucleotide sequence of the coding sequence of the gene (SEQ ID NOs: 8, 10, 12) or if the recited positions encompass the 1595th, 6th, and 79th nucleotides of the full gene sequence (SEQ ID NOs: 7, 9 & 11). Because multiple distinct interpretations of the claims exist, the claims are indefinite. Replacing “the 1595th nucleotide of the TaGMS-A gene of SEQ ID NO: 8” with language like --the 1595th nucleotide of the coding sequence of SEQ ID NO: 8 of a TaGMS-A gene-- for each of the required mutations would resolve this issue of indefiniteness. Claim 13 requires mutating nucleotides with a Triticum aestivum L. plant as a donor plant to produce a triple-mutant plant, wherein representative seeds of the triple-mutant plant have been deposited at the China General Microbiological Culture Collection Center. It is unclear if the limitation that representative seeds of the triple-mutant plant requires that the method obtain the exact plant line of deposit accession number CGMCC No. 45691, or if the claim encompasses methods wherein plants that are similar to the plant line for which representative seeds have been deposited under accession number CGMCC No. 45691. If the method requires obtaining the exact plant line of deposit accession number CGMCC No. 45691, then it is unclear how the method which encompasses “a” Tricitum aestivum L. plant as a donor plant would result in the recited triple-mutant plant. It would not be possible to obtain the exact plant by using any Tricitum aestivum L. plant as a donor plant rather than a specific Tricitum aestivum L. donor plant. This issue of indefiniteness could be resolved by specifying the starting plant, if the method is intended to require that the exact plant line of deposit accession number CGMCC No. 45691 be produced. Applicant urges that the amended claims overcome the rejections under 35 USC 112(b) (Remarks, page 47, paragraph 3-page 48, paragraph 2). This argument is unpersuasive, because the amendments to the claims create new issues of indefiniteness under 35 USC 112(b). Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim 13 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 6/29/2026, as applied to claims 13 & 19-21. Applicant' s arguments filed 8/31/2026 have been fully considered but they are not persuasive. Claim 13 recites a humidity-sensitive male-sterile Triticum aestivum L. triple-mutant plant tagms-aabbdd comprising a sequence of SEQ ID NO: 8, SEQ ID NO: 10, and SEQ ID NO: 12 and a mutation in the 1595th nucleotide of a sequence of TaGMS-A, a mutation in the 6th nucleotide of a sequence of TaGMS-B, and a mutation in the 791st nucleotide of a sequence of TaGMS-D. Amended claim 13 requires that representative seeds of the triple-mutant plant have been deposited with an accession number of CGMCC No. 45691. It is unclear whether the claim requires that the method obtain the specific plant line for which representative seeds have been deposited as CGMCC No. 45691, which is a line which is described by the specification and the deposited material, and which was produced with a specific Triticum aestivum L. plant as a donor plant. See rejection under 35 USC 112(b) above. Alternatively, the claim might be interpreted as requiring any Tritcum aestivum L. plant as a donor plant, in which case the humidity-sensitive male-sterile Triticum aestivum L. triple-mutant plant of claim 13 broadly encompasses any Triticum aestivum L. mutant plant with a sequence of SEQ ID NO: 8, SEQ ID NO: 10, and SEQ ID NO: 12 for the TaGMS-A, TaGMS-B, and TaGMS-D genes. The instant specification describes the coding sequences of TaGMS-A, TaGMS-B, and TaGMS-D genes in two wheat cultivars: Chinese Spring and Xichang 76-9 (page 12, paragraphs 3-14). The gene sequences corresponding to the coding sequences of SEQ ID NOs: 8, 10 & 12 are SEQ ID NO: 7, 9, and 11. No other coding sequences of TaGMS-A, TaGMS-B, and TaGMS-D are described, and no cultivars comprising the coding sequences of SEQ ID NOs: 8, 10, and 12 are described other than Xichang 76-9. For example, Chinese Spring does not comprise SEQ ID NO: 10; see first alignment below between the Chinese Spring TaGMS-B sequence (SEQ ID NO: 4) and SEQ ID NO: 10. US-19-157-392-4 Sequence 4, US/19157392 Publication No. US20250380655A1 GENERAL INFORMATION APPLICANT: Anhui Kaitai Agriculture and Animal Husbandry Technology Co., Ltd. (en) TITLE OF INVENTION: METHOD FOR ACQUIRING HUMIDITY-SENSITIVE MALE-STERILE TRITICUM AESTIVUM L. (en) FILE REFERENCE: GBJC038-PKG-LD CURRENT APPLICATION NUMBER: US/19/157,392 CURRENT FILING DATE: 2025-08-18 NUMBER OF SEQ ID NOS: 37 SEQ ID NO 4 LENGTH: 2274 TYPE: DNA FEATURE: NAME/KEY: source LOCATION: 1..2274 QUALIFIERS: mol_type = other DNA organism = Triticum aestivum Query Match 99.5%; Score 2262.8; Length 2274; Best Local Similarity 99.7%; Matches 2267; Conservative 0; Mismatches 7; Indels 0; Gaps 0; Qy 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAATCACGTC 60 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCTCGAGCGGCAACAATCACGTC 60 Qy 61 GGAAGAGAAACATGGGAGTTTGACCAAAACGATGCCGGATCAAGCGAAGAGCGGGATGCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGAAGAGAAACATGGGAGTTTGACCAAAACGATGCCGGATCAAGCGAAGAGCGGGATGCG 120 Qy 121 GTCGACACTGCACGGGCCGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GTCGACGCTGCACGGGCCGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 Qy 181 GTTTTGGCTCGCATGCAGCTAGCAAAGAAGAATAACTTCAGCCTTGATCAGCAGAAACCA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GTTTTGGCTCGCATGCAGCTAGCAAAGAAGAATAACTTCAGCCTTGATCAGCAGAAACCA 240 Qy 241 AATGATGAAGCTACTGTCGACATCAATGTAGCTACGGTATCAGAGGCACTGAGAAGGGCA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AATGATGAAGCTACTGTCGACATCAATGTAGCTACGGTATCAGAGGCACTGAGAAGGGCA 300 Qy 301 CTCGGATACTTCTCCGCCATACAAGCGCATGATGGGCACTGGCCAGGAGATTTTCCGGGG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CTCGGATACTTCTCCGCCATACAAGCGCATGATGGGCACTGGCCAGGAGATTTTCCGGGG 360 Qy 361 CCACTCTTTACCACAGCAACCATGATCATAGTTTTGTATGTCACCGAGTCATTAGGTACT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CCACTCTTTACCACAGCAACCATGATCATAGTTTTGTATGTCACCGAGTCATTAGGTACT 420 Qy 421 ACGCTGTCATCGGAGCATCGCAAGGAGATCTGTCGTTACTTGTACAACCGTCAGAATATA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 ACGCTGTCATCGGAGCATCGCAAGGAGATCTGTCGTTACTTGTACAACCGTCAGAATATA 480 Qy 481 GATGGAGGCTGGGGACTACACGCAGAAGGCGAAAGCTCCATGCTCAGCTCAGCTCTCAAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GATGGAGGCTGGGGACTACACGCAGAAGGCGAAAGCTCCATGCTCAGCTCAGCTCTCAAC 540 Qy 541 TACACTGCTCTAAGACTACTTGGTGAGGGCGCTGATGATGGACCGGATATGTCCATGCCG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TACACTGCTCTAAGACTACTTGGTGAGGGCGCTGATGATGGACCGGATATGTCCATGCCG 600 Qy 601 AAAGCTCGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATCTTGGGAAAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 AAAGCTCGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATCTTGGGAAAA 660 Qy 661 GTGTGGCTCTCGGTACTTGGGGTTTTTGAATGGTCAGGTGTAAACCCTATGCCCCCAGAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GTGTGGCTCTCGGTACTTGGGGTTTTTGAATGGTCAGGTGTAAACCCTATGCCCCCAGAA 720 Qy 721 TTGTTCCTTCTGCCATCCTTCGTTCCTATTCAACCAGGACGGTTGTGGAGTCACTTCAGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 TTGTTCCTTCTGCCATCCTTCGTTCCTATTCAACCAGGACGGTTGTGGAGTCACTTCAGA 780 Qy 781 ATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATAACAAAA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 ATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATAACAAAA 840 Qy 841 CTGGTTTTATCATTAAGAGAAGAGCTGCATATTCACCCCTACAAAAAGATTAACTGGAAG 900 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CTGGTTTTGTCATTAAGAGAAGAGCTGCATATTCACCCCTACAAAAAGATTAACTGGAAG 900 Qy 901 CAAGCGCGCAAATTATGCGCAAAGGAAGATGCCTATCATCCACATACCTGGCTCCAAGAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CAAGCGCGCAAATTATGCGCAAAGGAAGATGCCTATCATCCACATACCTGGCTCCAAGAA 960 Qy 961 TGCTTGTCTGACTGCCTTTACAGTTTCGGTGTACCGTTTCTGGCATGTTGGCCGGTTTCC 1020 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Db 961 TGCTTGTCTGACTGCCTTTACAGTTTCGGTGAACCGTTTCTGGCATGTTGGCCGGTTTCC 1020 Qy 1021 TACATGAGACGAAGAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGATGATATT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 TACATGAGACGAAGAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGATGATATT 1080 Qy 1081 TCACGGTATATCTGCATCGGCGCCGCGCAAAAGGCATTATCCATGTTATGCTGTTGGTCT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 TCACGGTATATCTGCATCGGCGCCGCGCAAAAGGCATTATCCATGTTATGCTGTTGGTCT 1140 Qy 1141 GAGGATCCCAATTCAGATGCATTCAAGCGCCACTTGGCTAGAGTCGCTGATTTCCTATGG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GAGGATCCCAATTCAGATGCATTCAAGCGCCACTTGGCTAGAGTCGCTGATTTCCTATGG 1200 Qy 1201 CTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCGGGCCAATCATGGGATGTTGCTTTT 1260 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 CTCAGTGAAGATGGCATGAAAGTGCGGGTATGTGCGGGCCAATCATGGGATGTTGCTTTT 1260 Qy 1261 GCCGTACAAGCGATATTAGCGTCTAATGTTGCAGAGGAATTTGGAACTACTCTCAGGAAA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GCCGTACAAGCGATATTAGCGTCTAATGTTGCAGAGGAATTTGGAACTACTCTCAGGAAA 1320 Qy 1321 GCACATCATTTCATAAAAGCATCCCAGATTGTGGACAATCCTTCAGGTGACTTCGCCAGA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 GCACATCATTTCATAAAAGCATCCCAGATTGTGGACAATCCTTCAGGTGACTTCGCCAGA 1380 Qy 1381 AAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGCTGGCAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 AAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGCTGGCAG 1440 Qy 1441 GTTTCAGATTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCGAAGTTTCCGTCA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GTTTCAGATTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCGAAGTTTCCGTCA 1500 Qy 1501 GATATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCGGTGAACGTATTACTA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 GATATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCGGTGAACGTATTACTA 1560 Qy 1561 TCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATATCCATGG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 TCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATATCCATGG 1620 Qy 1621 ATGGAGAATTTAAACATGACAGAGATATATGCGGACATCATGGTGGAGCATCAGTACGTC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 ATGGAGAATTTAAACATGACAGAGATATATGCGGACATCATGGTGGAGCATCAGTACGTC 1680 Qy 1681 GAGTGTACCTCATCGGTCATCCAAGCATTGGCCCTGTTTTGGCAAAAGTACCCCGGGCAT 1740 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 1681 GAGTGTACCTCATCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAGTACCCCGGGCAT 1740 Qy 1741 CGGGAAGATGAAATAGAACAGTGCATCAGGAGAGCGACAGAATTCATTGAGAAGTTGCAG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 CGGGAAGATGAAATAGAACAGTGCATCAGGAGAGCGACAGAATTCATTGAGAAGTTGCAG 1800 Qy 1801 AATGAAGACGGTTCATGGTTTGGATCATGGGGTATTTGCTTCACATATGGCACATGGTTT 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 AATGAAGACGGTTCATGGTTTGGATCATGGGGTATTTGCTTCACATATGGCACATGGTTT 1860 Qy 1861 GCTATAGAGGGCCTATCAGCAGTTGGACAGTGTTACAATAACAGCACCTACATTCGGAAG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 GCTATAGAGGGCCTATCAGCAGTTGGACAGTGTTACAATAACAGCACCTACATTCGGAAG 1920 Qy 1921 GGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGCCATCTT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 GGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGCCATCTT 1980 Qy 1981 TCATCCACAACCAAGGCATACACCAACCTAGACGGGGAGAAATCACACATAGTCAACACC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 TCATCCACAACCAAGGCATACACCAACCTAGACGGGGAGAAATCACACATAGTCAACACC 2040 Qy 2041 GCATGGGCGATGTTGGCGCTTATGAAAGCTGGACAGGCCGAAAGAGATCCGTCTCCTTTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 GCATGGGCGATGTTGGCGCTTATGAAAGCTGGACAGGCCGAAAGAGATCCGTCTCCTTTG 2100 Qy 2101 CACGAATCTGCAAGACTTATCATGAGCATGCAGCTTGGCAATGGTGACTTCCCACAGGAG 2160 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 CACGAAGCTGCAAGACTTATCATGAGCATGCAGCTTGGCAATGGTGACTTCCCACAGGAG 2160 Qy 2161 GAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGCAACATA 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 GAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGCAACATA 2220 Qy 2221 TTCCCCATATGGGCCCTTGGAGAGTATCATAGATTAGTACTTTGCTCTGGCTAA 2274 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 TTCCCCATATGGGCCCTTGGAGAGTATCATAGATTAGTACTTTGCTCTGGCTAA 2274 Wheat plants comprising the coding sequences of SEQ ID NOs: 8, 10, and 12 are not described in the art. Wheat plants comprising the sequences of SEQ ID NOs: 8, 10, and 12 as a genomic sequence rather than a coding sequence are likewise not described. An mRNA sequence comprising a sequence with 100% identity to SEQ ID NO: 12 is known from the Triticum aestivum cultivar Kukri (GenBank locus JP836315, available 9/24/2012). See first alignment below. However, the most similar mRNA sequence in Triticum aestivum cultivar Kukri to instant SEQ ID NO: 10 has only 99.4% similarity (GenBank locus JP836313, available 9/24/2012, see second alignment below), so Kukri wheat plants are not within the genus of plants encompassed by the instant invention. JP836315 LOCUS JP836315 2823 bp mRNA linear TSA 24-SEP-2012 DEFINITION TSA: Triticum aestivum cultivar Kukri KukriC558_3 mRNA sequence. ACCESSION JP836315 VERSION JP836315.1 DBLINK BioProject: PRJNA76847 KEYWORDS TSA; Transcriptome Shotgun Assembly. SOURCE Triticum aestivum (bread wheat) ORGANISM Triticum aestivum Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Pooideae; Triticodae; Triticeae; Triticinae; Triticum. REFERENCE 1 (bases 1 to 2823) AUTHORS Schreiber,A.W., Hayden,M.J., Forrest,K.L., Kong,S.L., Langridge,P. and Baumann,U. TITLE Transcriptome-scale homoeolog-specific transcript assemblies of bread wheat JOURNAL BMC Genomics 13 (1), 492 (2012) PUBMED 22989011 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 2823) AUTHORS Schreiber,A.W. TITLE Direct Submission JOURNAL Submitted (21-NOV-2011) Australian Centre for Plant Functional Genomics, University of Adelaide, Hartley Grove, Waite Campus, Glen Osmond, South Australia 5064, Australia COMMENT First, reads were grouped into clusters through comparison to a preliminary Velvet/Oases assembly, with each cluster corresponding to homologous copies of genes and/or gene family members. Next, each cluster was assembled separately on a compute cloud using MIRA. ##Assembly-Data-START## Assembly Method :: Velvet 1.0.18; MIRA 3.2.1 Sequencing Technology :: 454; Solexa ##Assembly-Data-END## FEATURES Location/Qualifiers source 1..2823 /organism="Triticum aestivum" /mol_type="mRNA" /cultivar="Kukri" /isolation_source="pooled seedlings 8-12 days after germination and florets from pre-meiosis to just prior to anthesis" /db_xref="taxon:4565" /tissue_type="roots; shoots; florets" ORIGIN Query Match 100.0%; Score 2280; Length 2823; Best Local Similarity 100.0%; Matches 2280; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAACCACTTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2605 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAACCACTTC 2546 Qy 61 GGAAGAGAAACATGGGAGTTTGACCGAAATGACGCTGGATCAAGCGAAGAGCGGGATGCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2545 GGAAGAGAAACATGGGAGTTTGACCGAAATGACGCTGGATCAAGCGAAGAGCGGGATGCG 2486 Qy 121 GTCGACGCTGCACGGGCTGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2485 GTCGACGCTGCACGGGCTGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 2426 Qy 181 GTTTTGGCCCGCATGCAGTTAGTAAAGGGGAATAACTTCAGCCTTGACCAACAACAGAAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2425 GTTTTGGCCCGCATGCAGTTAGTAAAGGGGAATAACTTCAGCCTTGACCAACAACAGAAA 2366 Qy 241 CCAAAAGGTGATGAAACTAGTGTCGACATCAACATAGCTACGGTGTCGGAGACACTGAAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2365 CCAAAAGGTGATGAAACTAGTGTCGACATCAACATAGCTACGGTGTCGGAGACACTGAAA 2306 Qy 301 AGGGCACTCAGATACTTCTCAGCCATACAAGCGCACGATGGGCACTGGCCAGGAGATTTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2305 AGGGCACTCAGATACTTCTCAGCCATACAAGCGCACGATGGGCACTGGCCAGGAGATTTT 2246 Qy 361 CCGGGCCCTCTCTTTACCACAGCAACCATGATCGTAGTTTTGTATGTCACGGAGTCGTTA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2245 CCGGGCCCTCTCTTTACCACAGCAACCATGATCGTAGTTTTGTATGTCACGGAGTCGTTA 2186 Qy 421 GGTACTACGCTATCGTCAGAACACCGCAAGGAGATCTGTCGCTATTTGTACAACCGACAG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2185 GGTACTACGCTATCGTCAGAACACCGCAAGGAGATCTGTCGCTATTTGTACAACCGACAG 2126 Qy 481 AATATGGATGGAGGATGGGGACTACATGCGGAAGGCGAGAGCTCCATGCTCAGCTCAGCT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2125 AATATGGATGGAGGATGGGGACTACATGCGGAAGGCGAGAGCTCCATGCTCAGCTCAGCT 2066 Qy 541 CTCAACTACGCTGCTCTAAGACTACTTGGTGAGGGTGCTGATGATGGACCAGATATGTCC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2065 CTCAACTACGCTGCTCTAAGACTACTTGGTGAGGGTGCTGATGATGGACCAGATATGTCC 2006 Qy 601 ATGCCAAAAGCTAGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATATTG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2005 ATGCCAAAAGCTAGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATATTG 1946 Qy 661 GGAAAAGTGTGGCTTTCGGTACTTGGGGTTTCTGAATGGTCAGGTGTAAACCCTATGCCC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1945 GGAAAAGTGTGGCTTTCGGTACTTGGGGTTTCTGAATGGTCAGGTGTAAACCCTATGCCC 1886 Qy 721 CCAGAATTGTTCCTTCTGCCATCCTTCGTTCCTATCCAACCAGGACGGTTGTGGAGTCAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1885 CCAGAATTGTTCCTTCTGCCATCCTTCGTTCCTATCCAACCAGGACGGTTGTGGAGTCAC 1826 Qy 781 TTCAGAATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1825 TTCAGAATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATA 1766 Qy 841 ACAAAACTGGTTTTATCATTAAGGGAAGAGCTGCATATTCACCCCTACAAAAAGATTAAC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1765 ACAAAACTGGTTTTATCATTAAGGGAAGAGCTGCATATTCACCCCTACAAAAAGATTAAC 1706 Qy 901 TGGAAGCAAGCGCGCAAATTATGCGCAAAGGAAGATGCGTATCATCCACATACCTGGCTC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1705 TGGAAGCAAGCGCGCAAATTATGCGCAAAGGAAGATGCGTATCATCCACATACCTGGCTC 1646 Qy 961 CAAGAATGCTTGTCCGATTGCCTTTACAGTTTCGGTGAACCTTTTCTGGCATGTTGGCCA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1645 CAAGAATGCTTGTCCGATTGCCTTTACAGTTTCGGTGAACCTTTTCTGGCATGTTGGCCA 1586 Qy 1021 GTTTCCCACATGAGACGAAAAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGAT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1585 GTTTCCCACATGAGACGAAAAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGAT 1526 Qy 1081 GATATTTCACGGTATATCTGCATTGGCGCTGCGCAAAAGGCATTATCCATGTTATGCTGT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1525 GATATTTCACGGTATATCTGCATTGGCGCTGCGCAAAAGGCATTATCCATGTTATGCTGT 1466 Qy 1141 TGGTCTGAGAATCCCAGTTCAGATGCATTCAAGCGCCACTTGGCTAGAGTTTCTGATTTC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1465 TGGTCTGAGAATCCCAGTTCAGATGCATTCAAGCGCCACTTGGCTAGAGTTTCTGATTTC 1406 Qy 1201 CTATGGCTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCAGGTCAGTCATGGGATGTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1405 CTATGGCTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCAGGTCAGTCATGGGATGTT 1346 Qy 1261 GCTTTTGCTGTACAAGCAATATTAGCGTGTGATGTTGCACAGGAATTTGGAACTACTCTG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1345 GCTTTTGCTGTACAAGCAATATTAGCGTGTGATGTTGCACAGGAATTTGGAACTACTCTG 1286 Qy 1321 AAGAAAGCACACCATTTCATAAAAGCATCCCAGATTGTCAGCAATCCTACCGGTGACTTC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1285 AAGAAAGCACACCATTTCATAAAAGCATCCCAGATTGTCAGCAATCCTACCGGTGACTTC 1226 Qy 1381 AGCAGAAAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1225 AGCAGAAAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGC 1166 Qy 1441 TGGCAGGTTTCAGACTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCAAAGTTT 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1165 TGGCAGGTTTCAGACTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCAAAGTTT 1106 Qy 1501 CCGTCAGAGATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCAGTGAACATA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1105 CCGTCAGAGATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCAGTGAACATA 1046 Qy 1561 TTATTATCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATAT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1045 TTATTATCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATAT 986 Qy 1621 CCATGGATGGAGAATTTAAACATGACAGAGATATATGCAGACATCATGGTGGAGCATCAG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 985 CCATGGATGGAGAATTTAAACATGACAGAGATATATGCAGACATCATGGTGGAGCATCAG 926 Qy 1681 TACGTCGAGTGTACCTCGTCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAATACCCC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 925 TACGTCGAGTGTACCTCGTCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAATACCCC 866 Qy 1741 GGGCATCGGGAAGATGAAGTAGAACAATGCATCAGGAGAGCGACAGAATTCATCGAGAAG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 865 GGGCATCGGGAAGATGAAGTAGAACAATGCATCAGGAGAGCGACAGAATTCATCGAGAAG 806 Qy 1801 TTACAGAATGAGGACGGTTCATGGTTCGGATCATGGGGTATTTGCTTCACATACGGCACG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 805 TTACAGAATGAGGACGGTTCATGGTTCGGATCATGGGGTATTTGCTTCACATACGGCACG 746 Qy 1861 TGGTTTGCTATAGAGGGCCTATCGGCAGTTGGACAGTGTTACAATAATAGCACCTACATC 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 745 TGGTTTGCTATAGAGGGCCTATCGGCAGTTGGACAGTGTTACAATAATAGCACCTACATC 686 Qy 1921 CGGAAGGGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 685 CGGAAGGGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGT 626 Qy 1981 CATCTTTCATCCACAACCAAGGCATACACGAACCTAGACGGGGAGAAATCACATGTAGTC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 625 CATCTTTCATCCACAACCAAGGCATACACGAACCTAGACGGGGAGAAATCACATGTAGTC 566 Qy 2041 AACACCGCATGGGCAATGTTGGCACTAATGAAAGCTGGACAGGCCGAACGAGATCCGTCT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 565 AACACCGCATGGGCAATGTTGGCACTAATGAAAGCTGGACAGGCCGAACGAGATCCGTCT 506 Qy 2101 CCTTTGCACGAAGCTGCAAGACTTATCATGAGCATGCAACTTGGCAATGGTGACTTCCCA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 505 CCTTTGCACGAAGCTGCAAGACTTATCATGAGCATGCAACTTGGCAATGGTGACTTCCCA 446 Qy 2161 CAGGAGGAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGC 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 445 CAGGAGGAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGC 386 Qy 2221 AACATATTCCCCATATGGGCCCTTGGAGAGTATCATAGACTAGTACTTTGCTCTGGCTAA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 385 AACATATTCCCCATATGGGCCCTTGGAGAGTATCATAGACTAGTACTTTGCTCTGGCTAA 326 JP836313 LOCUS JP836313 2865 bp mRNA linear TSA 24-SEP-2012 DEFINITION TSA: Triticum aestivum cultivar Kukri KukriC558_1 mRNA sequence. ACCESSION JP836313 VERSION JP836313.1 DBLINK BioProject: PRJNA76847 KEYWORDS TSA; Transcriptome Shotgun Assembly. SOURCE Triticum aestivum (bread wheat) ORGANISM Triticum aestivum Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Pooideae; Triticodae; Triticeae; Triticinae; Triticum. REFERENCE 1 (bases 1 to 2865) AUTHORS Schreiber,A.W., Hayden,M.J., Forrest,K.L., Kong,S.L., Langridge,P. and Baumann,U. TITLE Transcriptome-scale homoeolog-specific transcript assemblies of bread wheat JOURNAL BMC Genomics 13 (1), 492 (2012) PUBMED 22989011 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 2865) AUTHORS Schreiber,A.W. TITLE Direct Submission JOURNAL Submitted (21-NOV-2011) Australian Centre for Plant Functional Genomics, University of Adelaide, Hartley Grove, Waite Campus, Glen Osmond, South Australia 5064, Australia COMMENT First, reads were grouped into clusters through comparison to a preliminary Velvet/Oases assembly, with each cluster corresponding to homologous copies of genes and/or gene family members. Next, each cluster was assembled separately on a compute cloud using MIRA. ##Assembly-Data-START## Assembly Method :: Velvet 1.0.18; MIRA 3.2.1 Sequencing Technology :: 454; Solexa ##Assembly-Data-END## FEATURES Location/Qualifiers source 1..2865 /organism="Triticum aestivum" /mol_type="mRNA" /cultivar="Kukri" /isolation_source="pooled seedlings 8-12 days after germination and florets from pre-meiosis to just prior to anthesis" /db_xref="taxon:4565" /tissue_type="roots; shoots; florets" ORIGIN Query Match 99.4%; Score 2261.2; Length 2865; Best Local Similarity 99.6%; Matches 2266; Conservative 0; Mismatches 8; Indels 0; Gaps 0; Qy 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAATCACGTC 60 ||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||| Db 218 ATGTGGAAGCTCAAGATTGCTGAGGGTGGCCCGTGGCTCACGAGCGGCAACAATCACGTC 277 Qy 61 GGAAGAGAAACATGGGAGTTTGACCAAAACGATGCCGGATCAAGCGAAGAGCGGGATGCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 278 GGAAGAGAAACATGGGAGTTTGACCAAAACGATGCCGGATCAAGCGAAGAGCGGGATGCG 337 Qy 121 GTCGACACTGCACGGGCCGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 338 GTCGACGCTGCACGGGCCGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 397 Qy 181 GTTTTGGCTCGCATGCAGCTAGCAAAGAAGAATAACTTCAGCCTTGATCAGCAGAAACCA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 398 GTTTTGGCTCGCATGCAGCTAGCAAAGAAGAATAACTTCAGCCTTGATCAGCAGAAACCA 457 Qy 241 AATGATGAAGCTACTGTCGACATCAATGTAGCTACGGTATCAGAGGCACTGAGAAGGGCA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 458 AATGATGAAGCTACTGTCGACATCAATGTAGCTACGGTATCAGAGGCACTGAGAAGGGCA 517 Qy 301 CTCGGATACTTCTCCGCCATACAAGCGCATGATGGGCACTGGCCAGGAGATTTTCCGGGG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 518 CTCGGATACTTCTCCGCCATACAAGCGCATGATGGGCACTGGCCAGGAGATTTTCCGGGG 577 Qy 361 CCACTCTTTACCACAGCAACCATGATCATAGTTTTGTATGTCACCGAGTCATTAGGTACT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 578 CCACTCTTTACCACAGCAACCATGATCATAGTTTTGTATGTCACCGAGTCATTAGGTACT 637 Qy 421 ACGCTGTCATCGGAGCATCGCAAGGAGATCTGTCGTTACTTGTACAACCGTCAGAATATA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 638 ACGCTGTCATCGGAGCATCGCAAGGAGATCTGTCGTTACTTGTACAACCGTCAGAATATA 697 Qy 481 GATGGAGGCTGGGGACTACACGCAGAAGGCGAAAGCTCCATGCTCAGCTCAGCTCTCAAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 698 GATGGAGGCTGGGGACTACACGCAGAAGGCGAAAGCTCCATGCTCAGCTCAGCTCTCAAC 757 Qy 541 TACACTGCTCTAAGACTACTTGGTGAGGGCGCTGATGATGGACCGGATATGTCCATGCCG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 758 TACACTGCTCTAAGACTACTTGGTGAGGGCGCTGATGATGGACCGGATATGTCCATGCCG 817 Qy 601 AAAGCTCGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATCTTGGGAAAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 818 AAAGCTCGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATCTTGGGAAAA 877 Qy 661 GTGTGGCTCTCGGTACTTGGGGTTTTTGAATGGTCAGGTGTAAACCCTATGCCCCCAGAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 878 GTGTGGCTCTCGGTACTTGGGGTTTTTGAATGGTCAGGTGTAAACCCTATGCCCCCAGAA 937 Qy 721 TTGTTCCTTCTGCCATCCTTCGTTCCTATTCAACCAGGACGGTTGTGGAGTCACTTCAGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 938 TTGTTCCTTCTGCCATCCTTCGTTCCTATTCAACCAGGACGGTTGTGGAGTCACTTCAGA 997 Qy 781 ATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATAACAAAA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 998 ATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATAACAAAA 1057 Qy 841 CTGGTTTTATCATTAAGAGAAGAGCTGCATATTCACCCCTACAAAAAGATTAACTGGAAG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1058 CTGGTTTTATCATTAAGAGAAGAGCTGCATATTCACCCCTACAAAAAGATTAACTGGAAG 1117 Qy 901 CAAGCGCGCAAATTATGCGCAAAGGAAGATGCCTATCATCCACATACCTGGCTCCAAGAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1118 CAAGCGCGCAAATTATGCGCAAAGGAAGATGCCTATCATCCACATACCTGGCTCCAAGAA 1177 Qy 961 TGCTTGTCTGACTGCCTTTACAGTTTCGGTGTACCGTTTCTGGCATGTTGGCCGGTTTCC 1020 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Db 1178 TGCTTGTCTGACTGCCTTTACAGTTTCGGTGAACCGTTTCTGGCATGTTGGCCGGTTTCC 1237 Qy 1021 TACATGAGACGAAGAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGATGATATT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1238 TACATGAGACGAAGAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGATGATATT 1297 Qy 1081 TCACGGTATATCTGCATCGGCGCCGCGCAAAAGGCATTATCCATGTTATGCTGTTGGTCT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1298 TCACGGTATATCTGCATCGGCGCCGCGCAAAAGGCATTATCCATGTTATGCTGTTGGTCT 1357 Qy 1141 GAGGATCCCAATTCAGATGCATTCAAGCGCCACTTGGCTAGAGTCGCTGATTTCCTATGG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1358 GAGGATCCCAATTCAGATGCATTCAAGCGCCACTTGGCTAGAGTCGCTGATTTCCTATGG 1417 Qy 1201 CTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCGGGCCAATCATGGGATGTTGCTTTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1418 CTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCGGGCCAATCATGGGATGTTGCTTTT 1477 Qy 1261 GCCGTACAAGCGATATTAGCGTCTAATGTTGCAGAGGAATTTGGAACTACTCTCAGGAAA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1478 GCCGTACAAGCGATATTAGCGTCTAATGTTGCAGAGGAATTTGGAACTACTCTCAGGAAA 1537 Qy 1321 GCACATCATTTCATAAAAGCATCCCAGATTGTGGACAATCCTTCAGGTGACTTCGCCAGA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1538 GCACATCATTTCATAAAAGCATCCCAGATTGTGGACAATCCTTCAGGTGACTTCGCCAGA 1597 Qy 1381 AAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGCTGGCAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1598 AAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGCTGGCAG 1657 Qy 1441 GTTTCAGATTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCGAAGTTTCCGTCA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1658 GTTTCAGATTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCGAAGTTTCCGTCA 1717 Qy 1501 GATATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCGGTGAACGTATTACTA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1718 GATATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCGGTGAACGTATTACTA 1777 Qy 1561 TCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATATCCATGG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1778 TCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATATCCATGG 1837 Qy 1621 ATGGAGAATTTAAACATGACAGAGATATATGCGGACATCATGGTGGAGCATCAGTACGTC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1838 ATGGAGAATTTAAACATGACAGAGATATATGCGGACATCATGGTGGAGCATCAGTACGTC 1897 Qy 1681 GAGTGTACCTCATCGGTCATCCAAGCATTGGCCCTGTTTTGGCAAAAGTACCCCGGGCAT 1740 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 1898 GAGTGTACCTCATCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAGTACCCCGGGCAT 1957 Qy 1741 CGGGAAGATGAAATAGAACAGTGCATCAGGAGAGCGACAGAATTCATTGAGAAGTTGCAG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1958 CGGGAAGATGAAATAGAACAGTGCATCAGGAGAGCGACAGAATTCATTGAGAAGTTGCAG 2017 Qy 1801 AATGAAGACGGTTCATGGTTTGGATCATGGGGTATTTGCTTCACATATGGCACATGGTTT 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2018 AATGAAGACGGTTCATGGTTTGGATCATGGGGTATTTGCTTCACATATGGCACATGGTTT 2077 Qy 1861 GCTATAGAGGGCCTATCAGCAGTTGGACAGTGTTACAATAACAGCACCTACATTCGGAAG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2078 GCTATAGAGGGCCTATCAGCAGTTGGACAGTGTTACAATAACAGCACCTACATTCGGAAG 2137 Qy 1921 GGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGCCATCTT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2138 GGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGCCATCTT 2197 Qy 1981 TCATCCACAACCAAGGCATACACCAACCTAGACGGGGAGAAATCACACATAGTCAACACC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2198 TCATCCACAACCAAGGCATACACCAACCTAGACGGGGAGAAATCACACATAGTCAACACC 2257 Qy 2041 GCATGGGCGATGTTGGCGCTTATGAAAGCTGGACAGGCCGAAAGAGATCCGTCTCCTTTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2258 GCATGGGCGATGTTGGCGCTTATGAAAGCTGGACAGGCCGAAAGAGATCCGTCTCCTTTG 2317 Qy 2101 CACGAATCTGCAAGACTTATCATGAGCATGCAGCTTGGCAATGGTGACTTCCCACAGGAG 2160 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2318 CACGAAGCTGCAAGACTTATCATGAGCATGCAGCTTGGCAATGGTGACTTCCCACAGGAG 2377 Qy 2161 GAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGCAACATA 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2378 GAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGCAACATA 2437 Qy 2221 TTCCCCATATGGGCCCTTGGAGAGTATCATAGATTAGTACTTTGCTCTGGCTAA 2274 ||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 2438 TTCCCCATATGGGCCCTTGGAGAGTATCATAGACTAGTACTTTGCTCTGGCTAA 2491 Given the diversity of coding sequences at the TaGMS-A, TaGMS-B, and TaGMS-D genes across Triticum aestivum L. cultivars, Applicant has not demonstrated possession of the full genus of Triticum aestivum L. plants comprising TaGMS-A, TaGMS-B, and TaGMS-D genes comprising the sequences of SEQ ID NOs: 8, 10, and 12 in light of the single example Applicant has described within this genus. Hence, Applicant has not, in fact, described humidity-sensitive male-sterile Triticum aestivum L. plants, or even Triticum aestivum L. plants, comprising TaGMS-A, TaGMS-B, and TaGMS-D genes comprising the sequences of SEQ ID NOs: 8, 10, and 12 respectively over the full scope of the claims, and the specification fails to provide an adequate written description of the claimed invention. Given the lack of written description of wheat plants over the fully genus claimed, methods drawn to mutating the genes in any wheat plant in order to produce a triple-mutant plant representative seeds of which have been deposited with an accession number of CGMCC No. 45691 are likewise not described. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed. Applicant urges that the amended claims require the triple-mutant plant tagms-aabbdd with an accession number of CGMCC No. 45691, and so the claims no longer present a genus of any Triticum aestivum L. mutant plant. Applicant urges that the triple-mutant plant tagms-aabbdd with an accession number of CGMCC No. 45691 and the recited phenotype has been sufficiently described in the specification and by the deposited material (Remarks, page 48, paragraph 3-page 50, paragraph 1). This argument is unpersuasive, because claim 13 is indefinite as to whether the method requires the production of the specific recited plant line, representative seed of which has been deposited as accession number CGMCC No. 45691, or if the claim encompasses methods wherein triple mutant plants are produced that are not specifically of the line which was deposited as accession number CGMCC No. 45691. Methods that result in a triple mutant wheat line other than that which was deposited as accession number CGMCC No. 45691 are not fully described by the instant specification. New Matter Claims 13, 14 and 19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a NEW MATTER rejection. Claim 13 is drawn to a method comprising mutating the gene of SEQ ID NO: 8, the gene of SEQ ID NO: 10, and the gene of SEQ ID NO: 12 (lines 3-6). Claim 14 is drawn to a method requiring obtaining a plant comprising mutations in the gene of SEQ ID NO: 10, and the gene of SEQ ID NO: 12 (lines 19-21). Claim 19 requires a triple-mutant plant wherein the gene of SEQ ID NO: 8, the gene of SEQ ID NO: 10, and the gene of SEQ ID NO: 12 are mutated (lines 11-14). The recitation “gene” implies a structure comprising the coding sequence and the associated promoter, terminator, enhancer and/or repressor regulatory encoding regions (see The Federal Register, Vol. 66, No. 4, Friday, January 5, 2001 at page 1108, left column, Endnote 13). In the instant case, SEQ ID NOs: 8, 10 & 12 are coding sequences and do not comprise any regulatory or non-coding elements associated with the genes. Although it is indefinite whether the claims require mutation in genes which only comprise coding sequence (do not comprise introns) or if the claims encompass methods wherein genes which comprise coding sequences of SEQ ID NO: 8, 10 & 12 are mutated, the instant specification does not describe any plants comprising SEQ ID NO: 8, 10 & 12 as the full gene sequence. The instant specification describes plants comprising nucleotide sequences, which read on genomic sequences, of SEQ ID NOs: 7, 9 & 11 of the TaGMS-A, TaGMS-B, and TaGMS-D genes respectively. Additionally, if the claims encompass methods wherein genes which comprise coding sequences of SEQ ID NO: 8, 10 & 12 but may also comprise non-coding elements are mutated, it is indefinite whether the required mutation of the 1595th, 6th, and 79th nucleotides refer specifically to positions of the nucleotide sequence of the coding sequence of (SEQ ID NOs: 8, 10, 12) or if the recited positions encompass the 1595th, 6th, and 79th nucleotides of the gene sequence (for example, SEQ ID NOs: 7, 9 & 11). The instant specification describes mutations at the recited nucleotides in SEQ ID NOs: 8, 10, 12, but the specification does not describe mutations at the 1595th, 6th, and 79th nucleotides of genomic sequences which merely comprise a coding sequence of SEQ ID NO: 8, 10, 12. Thus, amended claims 13, 14 & 19 encompass methods which require plants with mutations in genes that were not described in the original disclose and constitute New Matter. In response to this rejection, Applicant is required to specifically point to support for the concept in the original disclosure or to cancel the new matter. Applicant urges that support for the amendments can be found in paragraphs [0003, 0039, 0096] of Applicant’s PG Publication, corresponding to pages 1, 6, and 16 of the original specification (Remarks, page 43, paragraph 4). This argument is unpersuasive, because pages 1, 6 & 16 of the original specification describe single, double, and triple mutants of TaGMS-A, TaGMS-B, and TaGMS-D genes and their respective phenotypes, but they do not describe wheat plants comprising TaGMS-A, TaGMS-B, and TaGMS-D genes with a genomic sequence of SEQ ID NO: 8, 10 or 12 nor do they describe wheat plants comprising a mutation in the 1595th, 6th, and 79th nucleotides of genomic sequences which merely comprise a coding sequence of SEQ ID NO: 8, 10, 12. Applicant is also reminded that evidence of support should be in reference to the originally filed disclosure, not to Applicant’s PG Publication. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim(s) 13-19 are rejected under 35 U.S.C. 103 as being unpatentable over Qi et al US 2015/0020237 A1 (published 1/15/2015, hereafter Qi) in view of Guo et al (2017) Creation and Application of Novel Humidity-Sensitive Male Sterile Materials In Common Wheat, The 8th National Conference on Wheat Genomics and Molecular Breeding. p.206. (based on English translation provided by Applicant, hereafter Guo) and Guo et al (2022) Journal of Systematics and Evolution. 60(6): 1378-1392 (available online 2/23/2021 more than 1 year prior to the earliest priority date, hereafter Guo 2022). Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 6/29/2026, as applied to claims 13-21. Applicant' s arguments filed 8/31/2026 have been fully considered but they are not persuasive. Claims 13-19 are drawn to methods for acquiring or improving fertility of humidity-sensitive male-sterile Triticum aestivum L. plants or crossbreeding such a plant. Qi teaches that male sterility in plant can be used in breeding research and utilization of crop heterosis, recurrent selection, and backcross without artificial emasculation (paragraph [0002]). Qi teaches that humidity-sensitive male sterile Arabidopsis was found as early as 1993, and that the mutant had restored fertility when transferred to an environment with a relative humidity of 90% (paragraph [0004]). Qi teaches a method of obtaining fertility-lowered mutants in rice using TILLING technology, but mutating seeds of rice with sodium azide. Mutated seeds were cultivated in field, and the first and second generations were self-crossed (paragraphs [0136-0145]). To identify mutants, enzyme-digested products of pooled DNA from the plants was analyzed by electrophoresis, and point mutations in triterpene synthase gene OsOSC8 were observed (paragraphs [0163-0169], figure 3). The mutations were observed in nucleotides 764, 809, and 1431, corresponding to amino acids 255, 270, and 477 (table 10). Qi teaches a method of restoring fertility of rice with RNAi silencing leading to humidity-sensitive male sterility, by wrapping the whole rice inflorescence with a plastic bag or using preservative film to cover the whole inflorescence during rice anthesis. This maintained humidity during growth of rice inflorescence at 80-100% humidity and returned to natural humidity of 40-60% after one week (paragraph [0203-0204]). Qi teaches the use of fertility-lowered mutants in breeding for preparing hybrid rice with wild-type and mutant parents (paragraphs [0209-0213]). Qi teaches homologous genes to OsOSC8 found in wheat, which Qi names TaOSC1 (paragraphs [0215-0218]). TaOSC114) (Qi SEQ ID NO:14 has a sequence with 99.9% sequence identity to instant SEQ ID NO: 12. See alignment below. Qi suggests that mutation of the sites P34E8, 4928, and 1708 in the wheat gene may lead to a similar restorable sterile phenotype and teaches that the functions of homologous genes of OsOSC8 in gramineous plants are very conservative (paragraphs [0226-0228]). US-14-362-900-14 Sequence 14, US/14362900 Publication No. US20150020237A1 GENERAL INFORMATION APPLICANT: Qi, Xiaoquan APPLICANT: Xue, Zheyong APPLICANT: Zhang, Yingchun APPLICANT: Xu, Xia APPLICANT: Liu, Dan TITLE OF INVENTION: Method for Preparing Fertility-Lowered TITLE OF INVENTION: Plant FILE REFERENCE: 59122-908222 CURRENT APPLICATION NUMBER: US/14/362,900 CURRENT FILING DATE: 2014-06-04 PRIOR APPLICATION NUMBER: CN 201110406266.2 PRIOR FILING DATE: 2011-12-08 PRIOR APPLICATION NUMBER: WO PCT/CN12/01546 PRIOR FILING DATE: 2012-11-14 NUMBER OF SEQ ID NOS: 24 SEQ ID NO 14 LENGTH: 2280 TYPE: DNA ORGANISM: Triticum aestivum FEATURE: OTHER INFORMATION: Chinese spring wheat Triticum aestivum triterpene synthase TaOSC1 Query Match 99.9%; Score 2278.4; Length 2280; Best Local Similarity 99.9%; Matches 2279; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAACCACTTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAACCACTTC 60 Qy 61 GGAAGAGAAACATGGGAGTTTGACCGAAATGACGCTGGATCAAGCGAAGAGCGGGATGCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGAAGAGAAACATGGGAGTTTGACCGAAATGACGCTGGATCAAGCGAAGAGCGGGATGCG 120 Qy 121 GTCGACGCTGCACGGGCTGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GTCGACGCTGCACGGGCTGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 Qy 181 GTTTTGGCCCGCATGCAGTTAGTAAAGGGGAATAACTTCAGCCTTGACCAACAACAGAAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GTTTTGGCCCGCATGCAGTTAGTAAAGGGGAATAACTTCAGCCTTGACCAACAACAGAAA 240 Qy 241 CCAAAAGGTGATGAAACTAGTGTCGACATCAACATAGCTACGGTGTCGGAGACACTGAAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 CCAAAAGGTGATGAAACTAGTGTCGACATCAACATAGCTACGGTGTCGGAGACACTGAAA 300 Qy 301 AGGGCACTCAGATACTTCTCAGCCATACAAGCGCACGATGGGCACTGGCCAGGAGATTTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AGGGCACTCAGATACTTCTCAGCCATACAAGCGCACGATGGGCACTGGCCAGGAGATTTT 360 Qy 361 CCGGGCCCTCTCTTTACCACAGCAACCATGATCGTAGTTTTGTATGTCACGGAGTCGTTA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CCGGGCCCTCTCTTTACCACAGCAACCATGATCGTAGTTTTGTATGTCACGGAGTCGTTA 420 Qy 421 GGTACTACGCTATCGTCAGAACACCGCAAGGAGATCTGTCGCTATTTGTACAACCGACAG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GGTACTACGCTATCGTCAGAACACCGCAAGGAGATCTGTCGCTATTTGTACAACCGACAG 480 Qy 481 AATATGGATGGAGGATGGGGACTACATGCGGAAGGCGAGAGCTCCATGCTCAGCTCAGCT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 AATATGGATGGAGGATGGGGACTACATGCGGAAGGCGAGAGCTCCATGCTCAGCTCAGCT 540 Qy 541 CTCAACTACGCTGCTCTAAGACTACTTGGTGAGGGTGCTGATGATGGACCAGATATGTCC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 CTCAACTACGCTGCTCTAAGACTACTTGGTGAGGGTGCTGATGATGGACCAGATATGTCC 600 Qy 601 ATGCCAAAAGCTAGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATATTG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 ATGCCAAAAGCTAGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATATTG 660 Qy 661 GGAAAAGTGTGGCTTTCGGTACTTGGGGTTTCTGAATGGTCAGGTGTAAACCCTATGCCC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GGAAAAGTGTGGCTTTCGGTACTTGGGGTTTCTGAATGGTCAGGTGTAAACCCTATGCCC 720 Qy 721 CCAGAATTGTTCCTTCTGCCATCCTTCGTTCCTATCCAACCAGGACGGTTGTGGAGTCAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CCAGAATTGTTCCTTCTGCCATCCTTCGTTCCTATCCAACCAGGACGGTTGTGGAGTCAC 780 Qy 781 TTCAGAATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TTCAGAATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATA 840 Qy 841 ACAAAACTGGTTTTATCATTAAGGGAAGAGCTGCATATTCACCCCTACAAAAAGATTAAC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 ACAAAACTGGTTTTATCATTAAGGGAAGAGCTGCATATTCACCCCTACAAAAAGATTAAC 900 Qy 901 TGGAAGCAAGCGCGCAAATTATGCGCAAAGGAAGATGCGTATCATCCACATACCTGGCTC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 TGGAAGCAAGCGCGCAAATTATGCGCAAAGGAAGATGCGTATCATCCACATACCTGGCTC 960 Qy 961 CAAGAATGCTTGTCCGATTGCCTTTACAGTTTCGGTGAACCTTTTCTGGCATGTTGGCCA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CAAGAATGCTTGTCCGATTGCCTTTACAGTTTCGGTGAACCTTTTCTGGCATGTTGGCCA 1020 Qy 1021 GTTTCCCACATGAGACGAAAAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGAT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 GTTTCCCACATGAGACGAAAAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGAT 1080 Qy 1081 GATATTTCACGGTATATCTGCATTGGCGCTGCGCAAAAGGCATTATCCATGTTATGCTGT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GATATTTCACGGTATATCTGCATTGGCGCTGCGCAAAAGGCATTATCCATGTTATGCTGT 1140 Qy 1141 TGGTCTGAGAATCCCAGTTCAGATGCATTCAAGCGCCACTTGGCTAGAGTTTCTGATTTC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 TGGTCTGAGAATCCCAGTTCAGATGCATTCAAGCGCCACTTGGCTAGAGTTTCTGATTTC 1200 Qy 1201 CTATGGCTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCAGGTCAGTCATGGGATGTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 CTATGGCTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCAGGTCAGTCATGGGATGTT 1260 Qy 1261 GCTTTTGCTGTACAAGCAATATTAGCGTGTGATGTTGCACAGGAATTTGGAACTACTCTG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GCTTTTGCTGTACAAGCAATATTAGCGTGTGATGTTGCACAGGAATTTGGAACTACTCTG 1320 Qy 1321 AAGAAAGCACACCATTTCATAAAAGCATCCCAGATTGTCAGCAATCCTACCGGTGACTTC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 AAGAAAGCACACCATTTCATAAAAGCATCCCAGATTGTCAGCAATCCTACCGGTGACTTC 1380 Qy 1381 AGCAGAAAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 AGCAGAAAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGC 1440 Qy 1441 TGGCAGGTTTCAGACTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCAAAGTTT 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 TGGCAGGTTTCAGACTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCAAAGTTT 1500 Qy 1501 CCGTCAGAGATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCAGTGAACATA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 CCGTCAGAGATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCAGTGAACATA 1560 Qy 1561 TTATTATCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATAT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 TTATTATCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATAT 1620 Qy 1621 CCATGGATGGAGAATTTAAACATGACAGAGATATATGCAGACATCATGGTGGAGCATCAG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 CCATGGATGGAGAATTTAAACATGACAGAGATATATGCAGACATCATGGTGGAGCATCAG 1680 Qy 1681 TACGTCGAGTGTACCTCGTCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAATACCCC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 TACGTCGAGTGTACCTCGTCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAATACCCC 1740 Qy 1741 GGGCATCGGGAAGATGAAGTAGAACAATGCATCAGGAGAGCGACAGAATTCATCGAGAAG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 GGGCATCGGGAAGATGAAGTAGAACAATGCATCAGGAGAGCGACAGAATTCATCGAGAAG 1800 Qy 1801 TTACAGAATGAGGACGGTTCATGGTTCGGATCATGGGGTATTTGCTTCACATACGGCACG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 TTACAGAATGAGGACGGTTCATGGTTCGGATCATGGGGTATTTGCTTCACATACGGCACG 1860 Qy 1861 TGGTTTGCTATAGAGGGCCTATCGGCAGTTGGACAGTGTTACAATAATAGCACCTACATC 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 TGGTTTGCTATAGAGGGCCTATCGGCAGTTGGACAGTGTTACAATAATAGCACCTACATC 1920 Qy 1921 CGGAAGGGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 CGGAAGGGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGT 1980 Qy 1981 CATCTTTCATCCACAACCAAGGCATACACGAACCTAGACGGGGAGAAATCACATGTAGTC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 CATCTTTCATCCACAACCAAGGCATACACGAACCTAGACGGGGAGAAATCACATGTAGTC 2040 Qy 2041 AACACCGCATGGGCAATGTTGGCACTAATGAAAGCTGGACAGGCCGAACGAGATCCGTCT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 AACACCGCATGGGCAATGTTGGCACTAATGAAAGCTGGACAGGCCGAACGAGATCCGTCT 2100 Qy 2101 CCTTTGCACGAAGCTGCAAGACTTATCATGAGCATGCAACTTGGCAATGGTGACTTCCCA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 CCTTTGCACGAAGCTGCAAGACTTATCATGAGCATGCAACTTGGCAATGGTGACTTCCCA 2160 Qy 2161 CAGGAGGAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGC 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 CAGGAGGAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGC 2220 Qy 2221 AACATATTCCCCATATGGGCCCTTGGAGAGTATCATAGACTAGTACTTTGCTCTGGCTAA 2280 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 2221 AACATATTCCCCATATGGGCCCTTGGAGAGTATCATAGATTAGTACTTTGCTCTGGCTAA 2280 Qi does not teach a Triticum aestivum L. plant with a TaGMS-A gene with the sequence of SEQ ID NO: 8, a TaGMS-B gene with the sequence of SEQ ID NO: 10, or a TaGMS-D gene with the sequence of SEQ ID NO: 12, or mutations in the 1595th, 6th, and 791st nucleotides of said genes. Guo teaches three wheat genes (TaOSC12A/B/D) homologous to the rice OsOSC12 gene (abstract). Guo teaches that the sequences of these genes were obtained in the common wheat Xichang 76-9 (abstract). Guo teaches a loss of catalytic function in TaOSC12A and further teaches screening for mutants of TaOSC12A/B/D using TILLING and site-directed mutagenesis to identify nonsense mutation sites and corresponding plants (abstract). Guo suggests that the next step is to hybridize TaOSC12B and TaOSC12D mutants to obtain a plant with a moisture-sensitive sterile phenotype (abstract). Guo 2022 teaches three candidate TaOSC genes, Ta4A495100, Ta7A003500, and Ta7D004000, that authors proposed to be associated with pollen coat formation and deficiency may lead to humidity-sensitive male sterility phenotype similar to OsOSC12/OsPTS1 in rice (page 1389, right column, paragraph 2). Guo 2022 teaches that this information is very important for the crossbreeding of bread wheat (page 1389, right column, paragraph 2). These genes are the same genes described in the instant specification as TaGMS-A, TaGMS-B, and TaGMS-D; see Table 1 of Guo 2022 in comparison to the instant specification, page 9, paragraph 2. Guo 2022 teaches that these genes have conserved motifs, including 2 QW domains around and C-terminal to the 600th amino acid (figure 3). Before the filing of the instant application, one of ordinary skill in the art would have been motivated to modify the method of Qi of mutating an OSC gene in rice to provide humidity-sensitive male sterile plants to instead mutate homologous genes in wheat. One of ordinary skill in the art would have been motivated to mutate a Xichang 76-9 plant, as taught by Guo, because it was a common wheat plant. One of ordinary skill in the art would have been motivated to mutate genes which are identical to the TaGMS-A, TaGMS-B, and TaGMS-D genes of the instant specification, because Guo 2022 teaches these genes to be homologous to the rice OsOSC12 gene responsible for humidity-sensitive male-sterility. One of ordinary skill in the art would have had a reasonable expectation of success, because Qi teaches that these homologous genes have conserved functionality in gramineous plants. Regarding mutations specifically in the 1595th nucleotide of the coding sequence of the TaGMS-A gene of G to A, in the 6th nucleotide of the coding sequence of the TaGMS-B gene of G to A, and in the 791st nucleotide of the coding sequence of the TaGMS-D gene of C to T, although these exact mutations are not taught in the prior art, such mutations would have been expected to occur as a result of random mutagenesis described by Qi and Guo. It would have been obvious to one of ordinary skill in the art that nonsense and non-conservative mutations such as the mutations of the instant invention would be likely to have a negative effect on the function of these genes. Moreover, all of the claimed mutations are present in the encoded amino acid sequence, N-terminal to conserved domains, which one of ordinary skill in the art would expect to contribute to protein function. Two of the three claimed mutations fall upstream of the mutations described in the art to reduce function of the homologous rice gene. Therefore, the mutations of the instant invention would have been obvious to one of ordinary skill in the art to disrupt the function of the recited wheat genes and would have been generated through random mutagenesis described in the prior art. Thus, such mutations would have been obvious. In order to demonstrate that the claimed mutations of the instant invention would have been non-obvious, Applicant would need to demonstrate that these specific mutations provide surprising results as compared to other mutations leading to non-conservative and premature stop codon mutations in the genes. A mutated Xichang 76-9 plant, as taught by Guo, would comprise coding sequences of TaGMS-A, TaGMS-B, and TaGMS-D of SEQ ID NOs: 8, 10, and 12 respectively. It is indefinite whether the method of claim 13 is limited to only the method requiring the step of producing the exact plant line representative seed of which has been deposited under accession number CGMCC No. 45691, or if claim 13 encompasses methods of producing a triple-mutant plant that would produce the plant line of CGMCC No. 45691 or any other triple-mutant plant. In light of the above, the second interpretation of a method for acquiring humidity-sensitive male-sterile Triticum aestivum L. by mutating a donor plant to produce a triple-mutant plant (instant claim 13) would have been obvious. Guo teaches hybridizing null mutant plants for TaOSC-B and TaOSC-D and obtaining plants with a humidity-sensitive male sterile phenotype, which reads on selecting a plant from the progeny plants. Although Guo does not explicitly state that the TaOSC-B and TaOSC-D mutants would be crossed with a TaOSC-A mutant, it would have been obvious to one of skill in the art to further cross the double mutant with the TaOSC-A mutant to obtain a triple mutant, because Guo and Guo 2022 teach that there are three homologs of this gene in wheat. It would also have been obvious to self-pollinate, as taught by Qi, to generate homozygous mutants. One of ordinary skill in the art would have had reasonable expectation of success, because Guo had already identified a TaOSC-A version without catalytic activity. A Xichang 76-9 plant comprising null mutations in TaOSC-A, TaOSC-B, or TaOSC-D as described above would appear to be the deposited Triticum aestivum L. lines with accession numbers of CGMCC No. 45692, 45693, and 45694, given the plants with the mutations would have the same mutations in the same Xichang 76-9 genetic backgrouns. Thus, the method of acquiring humidity sensitive male-sterile Triticum aestivum L. comprising subjecting a first, second, and third Triticum aestivum L. plant with accession number of CGMCC No. 45692, 45693, and 45694 to a triallelic crossing and self-pollinating to produce progeny plants and selecting a plant from the progeny plants to obtain a triple-mutant plant (claim 14) would have been obvious in view of Qi, Guo, and Guo 2022. The triple mutant itself, being in a Xichang 76-9 background, would appear to be the deposited humidity-sensitive male-sterile Triticum aestivum L. line with an accession number of CGMCC No. 45691, because the plants described above would have the same mutations and the same genetic background. Because Guo 2022 teaches the importance of the mutant in crossbreeding of bread wheat, a method of crossbreeding said plant with another plant (instant claim 15) is obvious. It would have been obvious to apply the method of Qi of improving fertility of the humidity-sensitive male-sterile rice plants by wrapping the inflorescence of the rice in a bag or preservative film, which reads on transparent plastic film, during rice anthesis, which reads on before a pollen shedding and after a heading, and removing the film or bag after one week, which reads on “until the pollen shedding is completed” to a method of crossbreeding a humidity-sensitive male-sterile wheat plant, making claims 16-18 obvious. Qi’s method of improving fertility in the humidity-sensitive male-sterile plant comprised maintaining humidity during growth of the inflorescence at 80-100% humidity, which encompasses the 90% humidity in an environment for an ear of the plant during a flowering period required by instant claim 19. Wrapping the ear of the humidity-sensitive male-sterile triple mutant wheat plant with a plastic bag or plastic film until pollen shedding is completed would have been obvious to one of ordinary skill in the art because the method had been used successfully in the rice humidity-sensitive male-sterile plant of Qi. Finally, the triple-mutant plant of humidity-sensitive male-sterile Triticum aestivum L. plant with an accession number of CGMCC No. 45691 required by claim 19 would have been obvious over the mutant humidity-sensitive male-sterile Triticum aestivum L. plants suggested by Qi, Guo, and Guo 2022. In order to demonstrate that the humidity-sensitive male-sterile Triticum aestivum L. plant with an accession number of CGMCC No. 45691 comprising the claimed mutations of the instant invention would have been non-obvious, Applicant would need to demonstrate that these specific mutations provide surprising results as compared to other mutations leading to non-conservative and premature stop codon mutations in the genes or as compared to these mutations in a different wheat background. Claims 13-19 would have been obvious to one of ordinary skill in the art in light of Qi, Guo, and Guo 2022. Applicant urges that the amended claims require the specific deposited plant material, having the recited TaGMS-A, TaGMS-B and TaGMS-D coding sequences and recited mutations, which is not taught by the cited references. Applicant urges that the teaching of homologous genes to the mutated rice OsOSC8 leading to similar phenotype and the teaching of mutants of TaOSC12B and TaOSC12D are proposed future work or predictive statements, not an actually obtained triple-mutant tagms-aabbdd plant or a plant of accession number CGMCC No. 45691. Applicant urges that the rejection relies on hindsight to bridge the gap from broad OSC-homolog teachings and random mutagenesis to the specific deposited CGMCC No. 45691 material (Remarks, page 53, paragraph 1-page 54, paragraph 2 & page 55, paragraph 1). This argument is unpersuasive, because the deposited material comprises mutations in a known wheat genetic background in genes which would have been obvious to mutate to obtain a humidity-sensitive male sterile plant. In order to demonstrate that the deposited material was non-obvious Applicant would need to provide evidence that the deposited material comprising the specific mutations in the TaGMS-A, TaGMS-B and TaGMS-D coding sequences provided an unexpected or surprising result compared to other, comparable mutations in the genes or compared to another wheat background. Applicant is reminded that evidence provided after final will not be considered unless sufficient reason is provided why such evidence could not have been presented earlier. A working example is not required in the prior art to show enablement. While Applicant has performed the obvious method (in this case, mutating wheat homologs of the rice OSC8 gene) and obtained results, not just any results rise to the level of unexpected. The prior art need not have performed the obvious method to be used in the rejection. Indeed, that would make it an anticipatory reference. Finally, “[a]ny judgement on obviousness is in a sense necessarily a reconstruction based on hindsight reasoning, but so long as it takes into account only knowledge which was within the level of ordinary skill in the art at the time the claimed invention was made and does not include knowledge gleaned only from applicant’s disclosure, such a reconstruction is proper.” In re McLaughlin 443 F.2d 1392, 1395, 170 USPQ 209, 212 (CCPA 1971). Applicant urges that the art does not teach that a hypothetical Xichang 76-9 triple mutant is the deposited humidity-sensitive male-sterile Triticum aestivum L. line with an accession number of CGMCC No. 45691 and does not establish that the references render obvious the particular deposited biological material (Remarks, page 54, paragraph 1). This argument is unpersuasive, because, as presented above, the deposited material comprises mutations in a known wheat genetic background in genes which would have been obvious to mutate in order to obtain a humidity-sensitive male sterile plant. In order to demonstrate that the deposited material was non-obvious, Applicant would need to provide evidence that the deposited material comprising the specific mutations in the TaGMS-A, TaGMS-B and TaGMS-D coding sequences provided an unexpected or surprising result compared to comparable mutations in the genes or compared to another wheat background. Applicant is reminded that evidence provided after final will not be considered unless sufficient reason is provided why such evidence could not have been presented earlier. Applicant urges that the cited combination of references does not provide a reason supported by rational underpinning that would have led a person of ordinary skill in the art to make the particular claimed wheat triple mutant or arrive at the claimed methods, because the possibility that random mutagenesis could produce many mutations is not a reason why a skilled artisan would have selected the three claimed nucleotide positions, combined those mutations, and obtained the specific required plant. Applicant urges that the rejection does not explain why the skilled artisan would have had a reasonable expectation that this particular wheat triple mutant plant, required by the amended claims, would exhibit the claimed humidity-sensitive male-sterile behavior and be suitable for the claimed methods over some unspecified OSC-disrupted plant (Remarks, page 54, paragraph 3-page 55, paragraph 2). This argument is unpersuasive, because the three specifically claimed nucleotide positions would have been obvious to one of skill in the art as mutations which would likely disrupt the function of the recited wheat genes, as presented above. Applicant has provided no evidence that these specific mutations provide results that would be unexpected compared to any other mutations in these genes. Therefore, the specifically recited mutations are not non-obvious compared to other mutations which one of skill in the art would expect to disrupt the function of the recited wheat genes. As for the combination of the mutations, one of skill in the art would have known that Triticum aestivum is a hexaploid plant and comprises homologs of genes in each subgenome. One of skill in the art would have understood that a wheat plant would likely require the mutation of all such homologs, rather than mutation of a single copy gene found in diploid rice. A skilled artisan would have had a reasonable expectation that this particular wheat triple mutant, or any triple wheat mutant comprising mutations eliminating the function of these genes, would exhibit the claimed humidity-sensitive male-sterile behavior, because the art teaches these genes to be homologous to the rice gene which, when mutated, provides the claimed phenotype. The art teaches mutating these homologous genes in wheat. Applicant has provided no evidence that this particular wheat plant, or even these particular mutations, are distinct and non-obvious from plants comprising other mutations in these genes to confer the required phenotype. Applicant is reminded that evidence provided after final will not be considered unless sufficient reason is provided why such evidence could not have been presented earlier. Applicant urges that the claims require the specific humidity-sensitive male-sterile Triticum aestivum L. plant having accession number CGMCC No. 45691 rather than the general concept of disrupting an OSC homolog in wheat. Applicant urges that the cited references are predictive but do not provide a reasonable expectation that a skilled artisan would have obtained the particular deposited wheat triple-mutant plant recited in the claims or that the specific combination of mutations would produce the humidity-sensitive male-sterile phenotype. Applicant urges that because Guo teaches subsequent work would involve crossing mutant plants to obtain plants exhibiting humidity-sensitive sterility, the relevant wheat plant and phenotype had not yet been made or verified, and so the prior art is not enabling and requires experimental verification. Applicant urges that the teachings of the prior art suggesting mutating the homologous genes in wheat are different from a teaching that the claims would have been predicted or would have carried a reasonable expectation of success (Remarks, page 55, paragraph 3-page 57, paragraph 1). This argument is unpersuasive, because Applicant has provided no evidence that the specific humidity-sensitive male-sterile Triticum aestivum L. plant having accession number CGMCC No. 45691 provides surprising or unexpected results compared to any humidity-sensitive male-sterile Triticum aestivum L. plant having comparable mutations in the genes homologous to OSC8 in rice. Therefore, the Triticum aestivum L. plant having accession number CGMCC No. 45691 is not non-obvious given the teachings of the prior art. Applicant is reminded that evidence provided after final will not be considered unless sufficient reason is provided why such evidence could not have been presented earlier. A working example is not required in the prior art to show enablement. While Applicant has performed the obvious method (in this case, mutating wheat homologs of the rice OSC8 gene) and obtained results, not just any results rise to the level of unexpected. The prior art need not have performed the obvious method to be used in the rejection. Indeed, that would make it an anticipatory reference. One of ordinary skill in the art would have had reasonable expectation of success in mutating the homologous wheat genes in a known wheat variety to arrive at a humidity-sensitive male-sterile Triticum aestivum L. plant because this was suggested in the art. Methods of mutation of wheat, including wheat mutants in some of the OSC homologous genes, were known in the art prior to the filing of the instant application. Applicant urges that the proposed modification is unpredictable because each single mutant and double mutant did not show the same phenotype as the triple mutant, so the claimed phenotype and restoration were not the predictable result of any TaGMS/OSC mutation or single or double mutant combinations but depend on the specific deposited triple mutant plant recited in the amended claims (Remarks, page 57, paragraph 1). This argument is unpersuasive, because one of skill in the art would have known that Triticum aestivum is a hexaploid plant and comprises homologs of genes in each subgenome. One of skill in the art would have understood that a wheat plant would likely require the mutation of all such homologs, rather than mutation of a single copy gene found in diploid rice, in order to achieve the phenotype of humidity-sensitive male sterility. Applicant has provided no evidence that the specific deposited triple mutant plant provides unexpected or surprising results compared to a triple-mutant plant comprising different mutations in the recited genes or in a different genetic background. Applicant is reminded that evidence provided after final will not be considered unless sufficient reason is provided why such evidence could not have been presented earlier. Applicant urges that because Guo teaches a future research plant to generate humidity-sensitive male-sterile wheat material from mutants of TaOSC12B and TaOSC12D and not the deposited tagms-aabbdd triple mutant plants having the specific, recited mutations, the prior art was missing experimental confirmation and so the results of the present specification are unexpected when compared with the nearest subject matter. Applicant urges that because single- and double- mutants did not have the same shriveled pollen grain or seed-setting phenotype as the triple mutant, the claimed combination was not merely one more predictable loss-of-function variant among similar disruptive TaGMS point mutants but a qualitatively different and quantitatively dramatic phenotype. Applicant urges that a person of ordinary skill would not have reasonably expected that the specific claimed three-mutation combination in wheat would produce this sharp phenotypic threshold (Remarks, page 57, paragraph 3-page 58, paragraph 1). This argument is unpersuasive, because a working example is not required in the prior art to show enablement. While Applicant has performed the obvious method (in this case, mutating wheat homologs of the rice OSC8 gene) and obtained results, not just any results rise to the level of unexpected. The prior art need not have performed the obvious method to be used in the rejection. Indeed, that would make it an anticipatory reference. The comparison of single- and double- mutants to the triple-mutant does not demonstrate that the claimed combination was qualitatively and quantitatively different from the addition of a predictable loss-of-function TaGMS variant, because one of ordinary skill in the art would have known that Triticum aestivum L. is a hexaploid species which comprises in its genome subgenomes comprising homologous copies of many genes. One of ordinary skill in the art would have reasonably expected that disrupting or knocking out all three copies of the gene across the three subgenomes may have been required in order to recover a phenotype similar to knocking out the single copy of the gene in diploid rice. In order to show that these specifically recited mutations are qualitatively and quantitatively different and non-obvious over similar disruptive TaGMS point mutants, Applicant would need to provide evidence that triple mutant plants comprising other TaGMS point mutants in all three genes resulted in a different phenotype than the triple mutant plant of the instant invention. Applicant is reminded that evidence provided after final will not be considered unless sufficient reason is provided why such evidence could not have been presented earlier. Applicant urges that the specification shows that the claimed phenotype is practically useful and reversible, not just deleterious. Applicant urges that the restoration of the nearly sterile triple mutant is unexpected results and unexpectedly good results (Remarks, page 59, paragraph 1 & 3). This argument is unpersuasive, because the phenotype of reversible male sterility is taught by Qi in rice, and Guo 2022 teaches that mutation of these three genes in wheat may lead to humidity-sensitive male sterility in wheat. Given the teachings and suggestions in the prior art, the claimed phenotype cannot be considered unexpected. Applicant urges that the amended claims require the mutant plant with accession number CGMCC No. 45691, that the evidence in the specification tracks the scope recited in the amended claims, and even if the references supplied a general reason to investigate wheat OSC homologs, they did not render obvious the claimed specific deposited triple-mutant wheat plant or methods of using that plant (Remarks, page 59, paragraph 1). This argument is unpersuasive, because a plant comprising mutations in the genes TaGMS-A, TaGMS-B, and TaGMS-D leading to a moisture-sensitive sterile phenotype would have been obvious in light of the prior art. In order to demonstrate that the triple mutant plant with accession number CGMCC No. 45691 is non-obvious over the obvious triple-mutant TaGMS-A, TaGMS-B, and TaGMS-D plant, Applicant would need to provide evidence that the triple mutant plant with accession number CGMCC No. 45691 provides unexpected or surprising results compared to another triple-mutant plant, such as a wheat plant with another genetic background or a what plant comprising comparable but distinct mutations in the TaGMS-A, TaGMS-B, and TaGMS-D genes. Applicant is reminded that evidence provided after final will not be considered unless sufficient reason is provided why such evidence could not have been presented earlier. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-F 8:00am-4pm EDT. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /VICTORIA L DELEO/Examiner, Art Unit 1662 /Anne Kubelik/Primary Examiner, Art Unit 1663