Prosecution Insights
Last updated: July 17, 2026
Application No. 19/157,392

METHOD FOR ACQUIRING HUMIDITY-SENSITIVE MALE-STERILE TRITICUM AESTIVUM L.

Non-Final OA §101§103§112
Filed
Aug 18, 2025
Priority
Aug 10, 2023 — CN 202311006149.6 +1 more
Examiner
DELEO, VICTORIA LYNN
Art Unit
Tech Center
Assignee
Anhui Kaitai Agriculture And Animal Husbandry Technology Co. Ltd.
OA Round
1 (Non-Final)
37%
Grant Probability
At Risk
1-2
OA Rounds
1y 7m
Est. Remaining
-3%
With Interview

Examiner Intelligence

Grants only 37% of cases
37%
Career Allowance Rate
10 granted / 27 resolved
-23.0% vs TC avg
Minimal -40% lift
Without
With
+-40.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
33 currently pending
Career history
66
Total Applications
across all art units

Statute-Specific Performance

§101
1.7%
-38.3% vs TC avg
§103
52.0%
+12.0% vs TC avg
§102
8.5%
-31.5% vs TC avg
§112
12.4%
-27.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 27 resolved cases

Office Action

§101 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of Claims Claims 13-21 are under examination on the merits. Specification The disclosure is objected to because of the following informalities: the specification presents tables on pages 7, 9 and 15, which are not numbered. Appropriate correction is required. Claim Objections Claims 13-21 are objected to because of the following informalities: Claim 13 (lines 7), claim 14 (lines 3, 4, 5, 8), claim 15 (lines 1 & 2), claim 16 (lines 2, 3, 4), claim 17 (line 3), claim 18 (line 3), claim 19 (lines 3, 4, 5), claim 20 (line 3), and claim 21 (line 3): --plant-- should be inserted after each occurrence of “Triticum aestivum L.”. Claim 13 (line 1), claim 14 (line 1), claim 19 (lines 1-2): “humidity-sensitive male-sterile Triticum aestivum L.” should read --a humidity-sensitive male-sterile Triticum aestivum L. plant--. Claim 13 (line 3): “Triticum aestivum L.” should read --a Triticum aestivum L. plant--. Claim 14 (line 3, line 4, and line 4): “a” should be inserted before “first”, “second” and “third”. Claim 14 (line 8): “the plant” should read --the triple-mutant plant--. Claim 14 (line 3), claim 15 (line 2): the acronym CGMCC should be written out in full in its first use in an independent claim. Appropriate correction is required. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 15-18 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claim(s) does/do not fall within at least one of the four categories of patent eligible subject matter because claims 15-18 are drawn to a “use” of humidity-sensitive male-sterile Triticum aestivum L. Claim 15 recites no steps, while claims 16, 17 & 18 are drawn to the “use” of claim 15 and do not actually require the recited active method steps to be performed as part of the “use”. Claims 15-18 as presented are therefore “use” claims and not patent eligible subject matter. Claims 19-21 rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon without significantly more. The claim(s) recite(s) maintaining a humidity in an environment for an ear of the humidity-sensitive male-sterile Triticum aestivum L. at 90% or more during a flowering period of the Triticum aestivum L. This judicial exception is not integrated into a practical application because the step of maintaining humidity in an environment at 90% or more is a natural occurrence, such as when it rains. Claim 20 recites “a” method for maintaining the humidity in the environment in claim 19, and claim 21 recites “a” method for the wrapping in claim 20, but neither of these claims requires that the step for maintaining the humidity in claim 19 comprise wrapping the ear of the Triticum aestivum L. plant and so the claims still encompass a natural phenomenon such as rain maintaining humidity at 90% or more. The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because although the humidity-sensitive male-sterile Triticum aestivum L. requires specific mutations and coding sequences in TaGMS-A, TaGMS-B, and TaGMS-D, the method of claims 19-21 do not require that this plant be present. “a flowering period of” the humidity-sensitive male sterile plant (claim 19, lines 2-3) under broadest reasonable interpretation just requires a period of time wherein the humidity-sensitive male sterile plant would be flowering. “an environment for an ear of” the humidity sensitive male sterile plant (claim 19, lines 3-4) requires an environment where an ear of the male sterile plant could be found, such as an agricultural field. In order to amount to more than a natural phenomenon, the specific tagms-aabbdd mutant plant would need to be required in the method. Additionally, claims 20-21 could be amended such that the additional steps of wrapping the ear of the humidity-sensitive male-sterile plant are required, which would amount to more than a natural phenomenon. Claim Rejections - 35 USC § 112 Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 15-18 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Dependent claims are included in all rejections. Claim 15 is drawn to a use of humidity-sensitive male-sterile Tritcum aestivum L. in a crossbreeding of Triticum aestivum L. However, there are no recited active steps in the “use”, so it is unclear how the humidity-sensitive male-sterile plant is to be used in crossbreeding. It is indefinite whether the claim requires a step of crossbreeding, and if so if the claim encompasses methods wherein the humidity-sensitive male-sterile plant is used just as a female parent or as the male parent as well. Claim 16 is drawn to the use of claim 15, and also recites that a method for improving fertility of the humidity-sensitive male-sterile plant is maintaining a humidity in an environment for an ear of the humidity-sensitive male-sterile plant at 90% or more. Claim 17 is similarly drawn to the use of claim 16 and also recites that a method for the maintaining the humidity is wrapping the ear of the plant. Claim 18 is drawn to the use of claim 17 and recites that a method for the wrapping is covering the ear with a transparent bag or wrapping with transparent plastic film. None of these dependent claims require that the steps in the methods be performed as part of the “use” of claim 15. Thus, claims 15-18 are “use” claims with no active steps, and the invention encompassed by the claims is indefinite. Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 13 & 19-21 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claims 13 & 19-21 recite a humidity-sensitive male-sterile Triticum aestivum L. triple-mutant plant tagms-aabbdd comprising a coding sequence of SEQ ID NO: 8, SEQ ID NO: 10, and SEQ ID NO: 12 and a mutation in the 1595th nucleotide of a coding sequence of TaGMS-A, a mutation in the 6th nucleotide of a coding sequence of TaGMS-B, and a mutation in the 791st nucleotide of a coding sequence of TaGMS-D. The required humidity-sensitive male-sterile Triticum aestivum L. triple-mutant plant broadly encompasses any Triticum aestivum L. mutant plant with a coding sequence of SEQ ID NO: 8, SEQ ID NO: 10, and SEQ ID NO: 12 for the TaGMS-A, TaGMS-B, and TaGMS-D genes. The instant specification describes the coding sequences of TaGMS-A, TaGMS-B, and TaGMS-D genes in two wheat cultivars: Chinese Spring and Xichang 76-9 (page 12, paragraphs 3-14). No other coding sequences of TaGMS-A, TaGMS-B, and TaGMS-D are described, and no cultivars comprising the coding sequences of SEQ ID NOs: 8, 10, and 12 are described other than Xichang 76-9. For example, Chinese Spring does not comprise SEQ ID NO: 10; see first alignment below between the Chinese Spring TaGMS-B sequence (SEQ ID NO: 4) and SEQ ID NO: 10. US-19-157-392-4 Sequence 4, US/19157392 Publication No. US20250380655A1 GENERAL INFORMATION APPLICANT: Anhui Kaitai Agriculture and Animal Husbandry Technology Co., Ltd. (en) TITLE OF INVENTION: METHOD FOR ACQUIRING HUMIDITY-SENSITIVE MALE-STERILE TRITICUM AESTIVUM L. (en) FILE REFERENCE: GBJC038-PKG-LD CURRENT APPLICATION NUMBER: US/19/157,392 CURRENT FILING DATE: 2025-08-18 NUMBER OF SEQ ID NOS: 37 SEQ ID NO 4 LENGTH: 2274 TYPE: DNA FEATURE: NAME/KEY: source LOCATION: 1..2274 QUALIFIERS: mol_type = other DNA organism = Triticum aestivum Query Match 99.5%; Score 2262.8; Length 2274; Best Local Similarity 99.7%; Matches 2267; Conservative 0; Mismatches 7; Indels 0; Gaps 0; Qy 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAATCACGTC 60 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCTCGAGCGGCAACAATCACGTC 60 Qy 61 GGAAGAGAAACATGGGAGTTTGACCAAAACGATGCCGGATCAAGCGAAGAGCGGGATGCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGAAGAGAAACATGGGAGTTTGACCAAAACGATGCCGGATCAAGCGAAGAGCGGGATGCG 120 Qy 121 GTCGACACTGCACGGGCCGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GTCGACGCTGCACGGGCCGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 Qy 181 GTTTTGGCTCGCATGCAGCTAGCAAAGAAGAATAACTTCAGCCTTGATCAGCAGAAACCA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GTTTTGGCTCGCATGCAGCTAGCAAAGAAGAATAACTTCAGCCTTGATCAGCAGAAACCA 240 Qy 241 AATGATGAAGCTACTGTCGACATCAATGTAGCTACGGTATCAGAGGCACTGAGAAGGGCA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AATGATGAAGCTACTGTCGACATCAATGTAGCTACGGTATCAGAGGCACTGAGAAGGGCA 300 Qy 301 CTCGGATACTTCTCCGCCATACAAGCGCATGATGGGCACTGGCCAGGAGATTTTCCGGGG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CTCGGATACTTCTCCGCCATACAAGCGCATGATGGGCACTGGCCAGGAGATTTTCCGGGG 360 Qy 361 CCACTCTTTACCACAGCAACCATGATCATAGTTTTGTATGTCACCGAGTCATTAGGTACT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CCACTCTTTACCACAGCAACCATGATCATAGTTTTGTATGTCACCGAGTCATTAGGTACT 420 Qy 421 ACGCTGTCATCGGAGCATCGCAAGGAGATCTGTCGTTACTTGTACAACCGTCAGAATATA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 ACGCTGTCATCGGAGCATCGCAAGGAGATCTGTCGTTACTTGTACAACCGTCAGAATATA 480 Qy 481 GATGGAGGCTGGGGACTACACGCAGAAGGCGAAAGCTCCATGCTCAGCTCAGCTCTCAAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GATGGAGGCTGGGGACTACACGCAGAAGGCGAAAGCTCCATGCTCAGCTCAGCTCTCAAC 540 Qy 541 TACACTGCTCTAAGACTACTTGGTGAGGGCGCTGATGATGGACCGGATATGTCCATGCCG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TACACTGCTCTAAGACTACTTGGTGAGGGCGCTGATGATGGACCGGATATGTCCATGCCG 600 Qy 601 AAAGCTCGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATCTTGGGAAAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 AAAGCTCGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATCTTGGGAAAA 660 Qy 661 GTGTGGCTCTCGGTACTTGGGGTTTTTGAATGGTCAGGTGTAAACCCTATGCCCCCAGAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GTGTGGCTCTCGGTACTTGGGGTTTTTGAATGGTCAGGTGTAAACCCTATGCCCCCAGAA 720 Qy 721 TTGTTCCTTCTGCCATCCTTCGTTCCTATTCAACCAGGACGGTTGTGGAGTCACTTCAGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 TTGTTCCTTCTGCCATCCTTCGTTCCTATTCAACCAGGACGGTTGTGGAGTCACTTCAGA 780 Qy 781 ATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATAACAAAA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 ATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATAACAAAA 840 Qy 841 CTGGTTTTATCATTAAGAGAAGAGCTGCATATTCACCCCTACAAAAAGATTAACTGGAAG 900 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CTGGTTTTGTCATTAAGAGAAGAGCTGCATATTCACCCCTACAAAAAGATTAACTGGAAG 900 Qy 901 CAAGCGCGCAAATTATGCGCAAAGGAAGATGCCTATCATCCACATACCTGGCTCCAAGAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CAAGCGCGCAAATTATGCGCAAAGGAAGATGCCTATCATCCACATACCTGGCTCCAAGAA 960 Qy 961 TGCTTGTCTGACTGCCTTTACAGTTTCGGTGTACCGTTTCTGGCATGTTGGCCGGTTTCC 1020 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Db 961 TGCTTGTCTGACTGCCTTTACAGTTTCGGTGAACCGTTTCTGGCATGTTGGCCGGTTTCC 1020 Qy 1021 TACATGAGACGAAGAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGATGATATT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 TACATGAGACGAAGAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGATGATATT 1080 Qy 1081 TCACGGTATATCTGCATCGGCGCCGCGCAAAAGGCATTATCCATGTTATGCTGTTGGTCT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 TCACGGTATATCTGCATCGGCGCCGCGCAAAAGGCATTATCCATGTTATGCTGTTGGTCT 1140 Qy 1141 GAGGATCCCAATTCAGATGCATTCAAGCGCCACTTGGCTAGAGTCGCTGATTTCCTATGG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GAGGATCCCAATTCAGATGCATTCAAGCGCCACTTGGCTAGAGTCGCTGATTTCCTATGG 1200 Qy 1201 CTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCGGGCCAATCATGGGATGTTGCTTTT 1260 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 CTCAGTGAAGATGGCATGAAAGTGCGGGTATGTGCGGGCCAATCATGGGATGTTGCTTTT 1260 Qy 1261 GCCGTACAAGCGATATTAGCGTCTAATGTTGCAGAGGAATTTGGAACTACTCTCAGGAAA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GCCGTACAAGCGATATTAGCGTCTAATGTTGCAGAGGAATTTGGAACTACTCTCAGGAAA 1320 Qy 1321 GCACATCATTTCATAAAAGCATCCCAGATTGTGGACAATCCTTCAGGTGACTTCGCCAGA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 GCACATCATTTCATAAAAGCATCCCAGATTGTGGACAATCCTTCAGGTGACTTCGCCAGA 1380 Qy 1381 AAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGCTGGCAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 AAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGCTGGCAG 1440 Qy 1441 GTTTCAGATTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCGAAGTTTCCGTCA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GTTTCAGATTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCGAAGTTTCCGTCA 1500 Qy 1501 GATATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCGGTGAACGTATTACTA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 GATATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCGGTGAACGTATTACTA 1560 Qy 1561 TCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATATCCATGG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 TCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATATCCATGG 1620 Qy 1621 ATGGAGAATTTAAACATGACAGAGATATATGCGGACATCATGGTGGAGCATCAGTACGTC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 ATGGAGAATTTAAACATGACAGAGATATATGCGGACATCATGGTGGAGCATCAGTACGTC 1680 Qy 1681 GAGTGTACCTCATCGGTCATCCAAGCATTGGCCCTGTTTTGGCAAAAGTACCCCGGGCAT 1740 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 1681 GAGTGTACCTCATCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAGTACCCCGGGCAT 1740 Qy 1741 CGGGAAGATGAAATAGAACAGTGCATCAGGAGAGCGACAGAATTCATTGAGAAGTTGCAG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 CGGGAAGATGAAATAGAACAGTGCATCAGGAGAGCGACAGAATTCATTGAGAAGTTGCAG 1800 Qy 1801 AATGAAGACGGTTCATGGTTTGGATCATGGGGTATTTGCTTCACATATGGCACATGGTTT 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 AATGAAGACGGTTCATGGTTTGGATCATGGGGTATTTGCTTCACATATGGCACATGGTTT 1860 Qy 1861 GCTATAGAGGGCCTATCAGCAGTTGGACAGTGTTACAATAACAGCACCTACATTCGGAAG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 GCTATAGAGGGCCTATCAGCAGTTGGACAGTGTTACAATAACAGCACCTACATTCGGAAG 1920 Qy 1921 GGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGCCATCTT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 GGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGCCATCTT 1980 Qy 1981 TCATCCACAACCAAGGCATACACCAACCTAGACGGGGAGAAATCACACATAGTCAACACC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 TCATCCACAACCAAGGCATACACCAACCTAGACGGGGAGAAATCACACATAGTCAACACC 2040 Qy 2041 GCATGGGCGATGTTGGCGCTTATGAAAGCTGGACAGGCCGAAAGAGATCCGTCTCCTTTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 GCATGGGCGATGTTGGCGCTTATGAAAGCTGGACAGGCCGAAAGAGATCCGTCTCCTTTG 2100 Qy 2101 CACGAATCTGCAAGACTTATCATGAGCATGCAGCTTGGCAATGGTGACTTCCCACAGGAG 2160 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 CACGAAGCTGCAAGACTTATCATGAGCATGCAGCTTGGCAATGGTGACTTCCCACAGGAG 2160 Qy 2161 GAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGCAACATA 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 GAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGCAACATA 2220 Qy 2221 TTCCCCATATGGGCCCTTGGAGAGTATCATAGATTAGTACTTTGCTCTGGCTAA 2274 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 TTCCCCATATGGGCCCTTGGAGAGTATCATAGATTAGTACTTTGCTCTGGCTAA 2274 Wheat plants comprising the coding sequences of SEQ ID NOs: 8, 10, and 12 are not described in the art. An mRNA sequence comprising a sequence with 100% identity to SEQ ID NO: 12 is known from the Triticum aestivum cultivar Kukri (GenBank locus JP836315, available 9/24/2012). See first alignment below. However, the most similar mRNA sequence in Triticum aestivum cultivar Kukri to instant SEQ ID NO: 10 has only 99.4% similarity (GenBank locus JP836313, available 9/24/2012, see second alignment below), so Kukri wheat plants are not within the genus of plants encompassed by the instant invention. JP836315 LOCUS JP836315 2823 bp mRNA linear TSA 24-SEP-2012 DEFINITION TSA: Triticum aestivum cultivar Kukri KukriC558_3 mRNA sequence. ACCESSION JP836315 VERSION JP836315.1 DBLINK BioProject: PRJNA76847 KEYWORDS TSA; Transcriptome Shotgun Assembly. SOURCE Triticum aestivum (bread wheat) ORGANISM Triticum aestivum Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Pooideae; Triticodae; Triticeae; Triticinae; Triticum. REFERENCE 1 (bases 1 to 2823) AUTHORS Schreiber,A.W., Hayden,M.J., Forrest,K.L., Kong,S.L., Langridge,P. and Baumann,U. TITLE Transcriptome-scale homoeolog-specific transcript assemblies of bread wheat JOURNAL BMC Genomics 13 (1), 492 (2012) PUBMED 22989011 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 2823) AUTHORS Schreiber,A.W. TITLE Direct Submission JOURNAL Submitted (21-NOV-2011) Australian Centre for Plant Functional Genomics, University of Adelaide, Hartley Grove, Waite Campus, Glen Osmond, South Australia 5064, Australia COMMENT First, reads were grouped into clusters through comparison to a preliminary Velvet/Oases assembly, with each cluster corresponding to homologous copies of genes and/or gene family members. Next, each cluster was assembled separately on a compute cloud using MIRA. ##Assembly-Data-START## Assembly Method :: Velvet 1.0.18; MIRA 3.2.1 Sequencing Technology :: 454; Solexa ##Assembly-Data-END## FEATURES Location/Qualifiers source 1..2823 /organism="Triticum aestivum" /mol_type="mRNA" /cultivar="Kukri" /isolation_source="pooled seedlings 8-12 days after germination and florets from pre-meiosis to just prior to anthesis" /db_xref="taxon:4565" /tissue_type="roots; shoots; florets" ORIGIN Query Match 100.0%; Score 2280; Length 2823; Best Local Similarity 100.0%; Matches 2280; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAACCACTTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2605 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAACCACTTC 2546 Qy 61 GGAAGAGAAACATGGGAGTTTGACCGAAATGACGCTGGATCAAGCGAAGAGCGGGATGCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2545 GGAAGAGAAACATGGGAGTTTGACCGAAATGACGCTGGATCAAGCGAAGAGCGGGATGCG 2486 Qy 121 GTCGACGCTGCACGGGCTGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2485 GTCGACGCTGCACGGGCTGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 2426 Qy 181 GTTTTGGCCCGCATGCAGTTAGTAAAGGGGAATAACTTCAGCCTTGACCAACAACAGAAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2425 GTTTTGGCCCGCATGCAGTTAGTAAAGGGGAATAACTTCAGCCTTGACCAACAACAGAAA 2366 Qy 241 CCAAAAGGTGATGAAACTAGTGTCGACATCAACATAGCTACGGTGTCGGAGACACTGAAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2365 CCAAAAGGTGATGAAACTAGTGTCGACATCAACATAGCTACGGTGTCGGAGACACTGAAA 2306 Qy 301 AGGGCACTCAGATACTTCTCAGCCATACAAGCGCACGATGGGCACTGGCCAGGAGATTTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2305 AGGGCACTCAGATACTTCTCAGCCATACAAGCGCACGATGGGCACTGGCCAGGAGATTTT 2246 Qy 361 CCGGGCCCTCTCTTTACCACAGCAACCATGATCGTAGTTTTGTATGTCACGGAGTCGTTA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2245 CCGGGCCCTCTCTTTACCACAGCAACCATGATCGTAGTTTTGTATGTCACGGAGTCGTTA 2186 Qy 421 GGTACTACGCTATCGTCAGAACACCGCAAGGAGATCTGTCGCTATTTGTACAACCGACAG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2185 GGTACTACGCTATCGTCAGAACACCGCAAGGAGATCTGTCGCTATTTGTACAACCGACAG 2126 Qy 481 AATATGGATGGAGGATGGGGACTACATGCGGAAGGCGAGAGCTCCATGCTCAGCTCAGCT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2125 AATATGGATGGAGGATGGGGACTACATGCGGAAGGCGAGAGCTCCATGCTCAGCTCAGCT 2066 Qy 541 CTCAACTACGCTGCTCTAAGACTACTTGGTGAGGGTGCTGATGATGGACCAGATATGTCC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2065 CTCAACTACGCTGCTCTAAGACTACTTGGTGAGGGTGCTGATGATGGACCAGATATGTCC 2006 Qy 601 ATGCCAAAAGCTAGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATATTG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2005 ATGCCAAAAGCTAGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATATTG 1946 Qy 661 GGAAAAGTGTGGCTTTCGGTACTTGGGGTTTCTGAATGGTCAGGTGTAAACCCTATGCCC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1945 GGAAAAGTGTGGCTTTCGGTACTTGGGGTTTCTGAATGGTCAGGTGTAAACCCTATGCCC 1886 Qy 721 CCAGAATTGTTCCTTCTGCCATCCTTCGTTCCTATCCAACCAGGACGGTTGTGGAGTCAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1885 CCAGAATTGTTCCTTCTGCCATCCTTCGTTCCTATCCAACCAGGACGGTTGTGGAGTCAC 1826 Qy 781 TTCAGAATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1825 TTCAGAATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATA 1766 Qy 841 ACAAAACTGGTTTTATCATTAAGGGAAGAGCTGCATATTCACCCCTACAAAAAGATTAAC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1765 ACAAAACTGGTTTTATCATTAAGGGAAGAGCTGCATATTCACCCCTACAAAAAGATTAAC 1706 Qy 901 TGGAAGCAAGCGCGCAAATTATGCGCAAAGGAAGATGCGTATCATCCACATACCTGGCTC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1705 TGGAAGCAAGCGCGCAAATTATGCGCAAAGGAAGATGCGTATCATCCACATACCTGGCTC 1646 Qy 961 CAAGAATGCTTGTCCGATTGCCTTTACAGTTTCGGTGAACCTTTTCTGGCATGTTGGCCA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1645 CAAGAATGCTTGTCCGATTGCCTTTACAGTTTCGGTGAACCTTTTCTGGCATGTTGGCCA 1586 Qy 1021 GTTTCCCACATGAGACGAAAAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGAT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1585 GTTTCCCACATGAGACGAAAAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGAT 1526 Qy 1081 GATATTTCACGGTATATCTGCATTGGCGCTGCGCAAAAGGCATTATCCATGTTATGCTGT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1525 GATATTTCACGGTATATCTGCATTGGCGCTGCGCAAAAGGCATTATCCATGTTATGCTGT 1466 Qy 1141 TGGTCTGAGAATCCCAGTTCAGATGCATTCAAGCGCCACTTGGCTAGAGTTTCTGATTTC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1465 TGGTCTGAGAATCCCAGTTCAGATGCATTCAAGCGCCACTTGGCTAGAGTTTCTGATTTC 1406 Qy 1201 CTATGGCTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCAGGTCAGTCATGGGATGTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1405 CTATGGCTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCAGGTCAGTCATGGGATGTT 1346 Qy 1261 GCTTTTGCTGTACAAGCAATATTAGCGTGTGATGTTGCACAGGAATTTGGAACTACTCTG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1345 GCTTTTGCTGTACAAGCAATATTAGCGTGTGATGTTGCACAGGAATTTGGAACTACTCTG 1286 Qy 1321 AAGAAAGCACACCATTTCATAAAAGCATCCCAGATTGTCAGCAATCCTACCGGTGACTTC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1285 AAGAAAGCACACCATTTCATAAAAGCATCCCAGATTGTCAGCAATCCTACCGGTGACTTC 1226 Qy 1381 AGCAGAAAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1225 AGCAGAAAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGC 1166 Qy 1441 TGGCAGGTTTCAGACTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCAAAGTTT 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1165 TGGCAGGTTTCAGACTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCAAAGTTT 1106 Qy 1501 CCGTCAGAGATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCAGTGAACATA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1105 CCGTCAGAGATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCAGTGAACATA 1046 Qy 1561 TTATTATCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATAT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1045 TTATTATCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATAT 986 Qy 1621 CCATGGATGGAGAATTTAAACATGACAGAGATATATGCAGACATCATGGTGGAGCATCAG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 985 CCATGGATGGAGAATTTAAACATGACAGAGATATATGCAGACATCATGGTGGAGCATCAG 926 Qy 1681 TACGTCGAGTGTACCTCGTCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAATACCCC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 925 TACGTCGAGTGTACCTCGTCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAATACCCC 866 Qy 1741 GGGCATCGGGAAGATGAAGTAGAACAATGCATCAGGAGAGCGACAGAATTCATCGAGAAG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 865 GGGCATCGGGAAGATGAAGTAGAACAATGCATCAGGAGAGCGACAGAATTCATCGAGAAG 806 Qy 1801 TTACAGAATGAGGACGGTTCATGGTTCGGATCATGGGGTATTTGCTTCACATACGGCACG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 805 TTACAGAATGAGGACGGTTCATGGTTCGGATCATGGGGTATTTGCTTCACATACGGCACG 746 Qy 1861 TGGTTTGCTATAGAGGGCCTATCGGCAGTTGGACAGTGTTACAATAATAGCACCTACATC 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 745 TGGTTTGCTATAGAGGGCCTATCGGCAGTTGGACAGTGTTACAATAATAGCACCTACATC 686 Qy 1921 CGGAAGGGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 685 CGGAAGGGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGT 626 Qy 1981 CATCTTTCATCCACAACCAAGGCATACACGAACCTAGACGGGGAGAAATCACATGTAGTC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 625 CATCTTTCATCCACAACCAAGGCATACACGAACCTAGACGGGGAGAAATCACATGTAGTC 566 Qy 2041 AACACCGCATGGGCAATGTTGGCACTAATGAAAGCTGGACAGGCCGAACGAGATCCGTCT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 565 AACACCGCATGGGCAATGTTGGCACTAATGAAAGCTGGACAGGCCGAACGAGATCCGTCT 506 Qy 2101 CCTTTGCACGAAGCTGCAAGACTTATCATGAGCATGCAACTTGGCAATGGTGACTTCCCA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 505 CCTTTGCACGAAGCTGCAAGACTTATCATGAGCATGCAACTTGGCAATGGTGACTTCCCA 446 Qy 2161 CAGGAGGAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGC 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 445 CAGGAGGAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGC 386 Qy 2221 AACATATTCCCCATATGGGCCCTTGGAGAGTATCATAGACTAGTACTTTGCTCTGGCTAA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 385 AACATATTCCCCATATGGGCCCTTGGAGAGTATCATAGACTAGTACTTTGCTCTGGCTAA 326 JP836313 LOCUS JP836313 2865 bp mRNA linear TSA 24-SEP-2012 DEFINITION TSA: Triticum aestivum cultivar Kukri KukriC558_1 mRNA sequence. ACCESSION JP836313 VERSION JP836313.1 DBLINK BioProject: PRJNA76847 KEYWORDS TSA; Transcriptome Shotgun Assembly. SOURCE Triticum aestivum (bread wheat) ORGANISM Triticum aestivum Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Pooideae; Triticodae; Triticeae; Triticinae; Triticum. REFERENCE 1 (bases 1 to 2865) AUTHORS Schreiber,A.W., Hayden,M.J., Forrest,K.L., Kong,S.L., Langridge,P. and Baumann,U. TITLE Transcriptome-scale homoeolog-specific transcript assemblies of bread wheat JOURNAL BMC Genomics 13 (1), 492 (2012) PUBMED 22989011 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 2865) AUTHORS Schreiber,A.W. TITLE Direct Submission JOURNAL Submitted (21-NOV-2011) Australian Centre for Plant Functional Genomics, University of Adelaide, Hartley Grove, Waite Campus, Glen Osmond, South Australia 5064, Australia COMMENT First, reads were grouped into clusters through comparison to a preliminary Velvet/Oases assembly, with each cluster corresponding to homologous copies of genes and/or gene family members. Next, each cluster was assembled separately on a compute cloud using MIRA. ##Assembly-Data-START## Assembly Method :: Velvet 1.0.18; MIRA 3.2.1 Sequencing Technology :: 454; Solexa ##Assembly-Data-END## FEATURES Location/Qualifiers source 1..2865 /organism="Triticum aestivum" /mol_type="mRNA" /cultivar="Kukri" /isolation_source="pooled seedlings 8-12 days after germination and florets from pre-meiosis to just prior to anthesis" /db_xref="taxon:4565" /tissue_type="roots; shoots; florets" ORIGIN Query Match 99.4%; Score 2261.2; Length 2865; Best Local Similarity 99.6%; Matches 2266; Conservative 0; Mismatches 8; Indels 0; Gaps 0; Qy 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAATCACGTC 60 ||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||| Db 218 ATGTGGAAGCTCAAGATTGCTGAGGGTGGCCCGTGGCTCACGAGCGGCAACAATCACGTC 277 Qy 61 GGAAGAGAAACATGGGAGTTTGACCAAAACGATGCCGGATCAAGCGAAGAGCGGGATGCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 278 GGAAGAGAAACATGGGAGTTTGACCAAAACGATGCCGGATCAAGCGAAGAGCGGGATGCG 337 Qy 121 GTCGACACTGCACGGGCCGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 338 GTCGACGCTGCACGGGCCGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 397 Qy 181 GTTTTGGCTCGCATGCAGCTAGCAAAGAAGAATAACTTCAGCCTTGATCAGCAGAAACCA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 398 GTTTTGGCTCGCATGCAGCTAGCAAAGAAGAATAACTTCAGCCTTGATCAGCAGAAACCA 457 Qy 241 AATGATGAAGCTACTGTCGACATCAATGTAGCTACGGTATCAGAGGCACTGAGAAGGGCA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 458 AATGATGAAGCTACTGTCGACATCAATGTAGCTACGGTATCAGAGGCACTGAGAAGGGCA 517 Qy 301 CTCGGATACTTCTCCGCCATACAAGCGCATGATGGGCACTGGCCAGGAGATTTTCCGGGG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 518 CTCGGATACTTCTCCGCCATACAAGCGCATGATGGGCACTGGCCAGGAGATTTTCCGGGG 577 Qy 361 CCACTCTTTACCACAGCAACCATGATCATAGTTTTGTATGTCACCGAGTCATTAGGTACT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 578 CCACTCTTTACCACAGCAACCATGATCATAGTTTTGTATGTCACCGAGTCATTAGGTACT 637 Qy 421 ACGCTGTCATCGGAGCATCGCAAGGAGATCTGTCGTTACTTGTACAACCGTCAGAATATA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 638 ACGCTGTCATCGGAGCATCGCAAGGAGATCTGTCGTTACTTGTACAACCGTCAGAATATA 697 Qy 481 GATGGAGGCTGGGGACTACACGCAGAAGGCGAAAGCTCCATGCTCAGCTCAGCTCTCAAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 698 GATGGAGGCTGGGGACTACACGCAGAAGGCGAAAGCTCCATGCTCAGCTCAGCTCTCAAC 757 Qy 541 TACACTGCTCTAAGACTACTTGGTGAGGGCGCTGATGATGGACCGGATATGTCCATGCCG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 758 TACACTGCTCTAAGACTACTTGGTGAGGGCGCTGATGATGGACCGGATATGTCCATGCCG 817 Qy 601 AAAGCTCGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATCTTGGGAAAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 818 AAAGCTCGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATCTTGGGAAAA 877 Qy 661 GTGTGGCTCTCGGTACTTGGGGTTTTTGAATGGTCAGGTGTAAACCCTATGCCCCCAGAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 878 GTGTGGCTCTCGGTACTTGGGGTTTTTGAATGGTCAGGTGTAAACCCTATGCCCCCAGAA 937 Qy 721 TTGTTCCTTCTGCCATCCTTCGTTCCTATTCAACCAGGACGGTTGTGGAGTCACTTCAGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 938 TTGTTCCTTCTGCCATCCTTCGTTCCTATTCAACCAGGACGGTTGTGGAGTCACTTCAGA 997 Qy 781 ATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATAACAAAA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 998 ATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATAACAAAA 1057 Qy 841 CTGGTTTTATCATTAAGAGAAGAGCTGCATATTCACCCCTACAAAAAGATTAACTGGAAG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1058 CTGGTTTTATCATTAAGAGAAGAGCTGCATATTCACCCCTACAAAAAGATTAACTGGAAG 1117 Qy 901 CAAGCGCGCAAATTATGCGCAAAGGAAGATGCCTATCATCCACATACCTGGCTCCAAGAA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1118 CAAGCGCGCAAATTATGCGCAAAGGAAGATGCCTATCATCCACATACCTGGCTCCAAGAA 1177 Qy 961 TGCTTGTCTGACTGCCTTTACAGTTTCGGTGTACCGTTTCTGGCATGTTGGCCGGTTTCC 1020 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Db 1178 TGCTTGTCTGACTGCCTTTACAGTTTCGGTGAACCGTTTCTGGCATGTTGGCCGGTTTCC 1237 Qy 1021 TACATGAGACGAAGAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGATGATATT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1238 TACATGAGACGAAGAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGATGATATT 1297 Qy 1081 TCACGGTATATCTGCATCGGCGCCGCGCAAAAGGCATTATCCATGTTATGCTGTTGGTCT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1298 TCACGGTATATCTGCATCGGCGCCGCGCAAAAGGCATTATCCATGTTATGCTGTTGGTCT 1357 Qy 1141 GAGGATCCCAATTCAGATGCATTCAAGCGCCACTTGGCTAGAGTCGCTGATTTCCTATGG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1358 GAGGATCCCAATTCAGATGCATTCAAGCGCCACTTGGCTAGAGTCGCTGATTTCCTATGG 1417 Qy 1201 CTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCGGGCCAATCATGGGATGTTGCTTTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1418 CTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCGGGCCAATCATGGGATGTTGCTTTT 1477 Qy 1261 GCCGTACAAGCGATATTAGCGTCTAATGTTGCAGAGGAATTTGGAACTACTCTCAGGAAA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1478 GCCGTACAAGCGATATTAGCGTCTAATGTTGCAGAGGAATTTGGAACTACTCTCAGGAAA 1537 Qy 1321 GCACATCATTTCATAAAAGCATCCCAGATTGTGGACAATCCTTCAGGTGACTTCGCCAGA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1538 GCACATCATTTCATAAAAGCATCCCAGATTGTGGACAATCCTTCAGGTGACTTCGCCAGA 1597 Qy 1381 AAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGCTGGCAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1598 AAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGCTGGCAG 1657 Qy 1441 GTTTCAGATTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCGAAGTTTCCGTCA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1658 GTTTCAGATTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCGAAGTTTCCGTCA 1717 Qy 1501 GATATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCGGTGAACGTATTACTA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1718 GATATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCGGTGAACGTATTACTA 1777 Qy 1561 TCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATATCCATGG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1778 TCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATATCCATGG 1837 Qy 1621 ATGGAGAATTTAAACATGACAGAGATATATGCGGACATCATGGTGGAGCATCAGTACGTC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1838 ATGGAGAATTTAAACATGACAGAGATATATGCGGACATCATGGTGGAGCATCAGTACGTC 1897 Qy 1681 GAGTGTACCTCATCGGTCATCCAAGCATTGGCCCTGTTTTGGCAAAAGTACCCCGGGCAT 1740 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 1898 GAGTGTACCTCATCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAGTACCCCGGGCAT 1957 Qy 1741 CGGGAAGATGAAATAGAACAGTGCATCAGGAGAGCGACAGAATTCATTGAGAAGTTGCAG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1958 CGGGAAGATGAAATAGAACAGTGCATCAGGAGAGCGACAGAATTCATTGAGAAGTTGCAG 2017 Qy 1801 AATGAAGACGGTTCATGGTTTGGATCATGGGGTATTTGCTTCACATATGGCACATGGTTT 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2018 AATGAAGACGGTTCATGGTTTGGATCATGGGGTATTTGCTTCACATATGGCACATGGTTT 2077 Qy 1861 GCTATAGAGGGCCTATCAGCAGTTGGACAGTGTTACAATAACAGCACCTACATTCGGAAG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2078 GCTATAGAGGGCCTATCAGCAGTTGGACAGTGTTACAATAACAGCACCTACATTCGGAAG 2137 Qy 1921 GGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGCCATCTT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2138 GGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGCCATCTT 2197 Qy 1981 TCATCCACAACCAAGGCATACACCAACCTAGACGGGGAGAAATCACACATAGTCAACACC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2198 TCATCCACAACCAAGGCATACACCAACCTAGACGGGGAGAAATCACACATAGTCAACACC 2257 Qy 2041 GCATGGGCGATGTTGGCGCTTATGAAAGCTGGACAGGCCGAAAGAGATCCGTCTCCTTTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2258 GCATGGGCGATGTTGGCGCTTATGAAAGCTGGACAGGCCGAAAGAGATCCGTCTCCTTTG 2317 Qy 2101 CACGAATCTGCAAGACTTATCATGAGCATGCAGCTTGGCAATGGTGACTTCCCACAGGAG 2160 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2318 CACGAAGCTGCAAGACTTATCATGAGCATGCAGCTTGGCAATGGTGACTTCCCACAGGAG 2377 Qy 2161 GAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGCAACATA 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2378 GAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGCAACATA 2437 Qy 2221 TTCCCCATATGGGCCCTTGGAGAGTATCATAGATTAGTACTTTGCTCTGGCTAA 2274 ||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 2438 TTCCCCATATGGGCCCTTGGAGAGTATCATAGACTAGTACTTTGCTCTGGCTAA 2491 Given the diversity of coding sequences at the TaGMS-A, TaGMS-B, and TaGMS-D genes across Triticum aestivum L. cultivars, Applicant has not demonstrated possession of the full genus of Triticum aestivum L. plants comprising TaGMS-A, TaGMS-B, and TaGMS-D genes comprising the coding sequences of SEQ ID NOs: 8, 10, and 12 in light of the single example Applicant has described within this genus. Hence, Applicant has not, in fact, described humidity-sensitive male-sterile Triticum aestivum L. plants comprising TaGMS-A, TaGMS-B, and TaGMS-D genes comprising the coding sequences of SEQ ID NOs: 8, 10, and 12 respectively over the full scope of the claims, and the specification fails to provide an adequate written description of the claimed invention. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed. Enablement Claims 14-18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. The claims all require a Triticum aestivum L. plant with an accession number of CGMCC No. 45691 or Triticum aestivum L. plants with accession numbers CGMCC No. 45692, 45693, and 45694. Since the plant claimed is essential to the claimed invention, it must be obtainable by a repeatable method set forth in the specification or otherwise be readily available to the public. The specification does not disclose a repeatable process to obtain the exact same seed in each occurrence and it is not apparent if such a seed is readily available to the public. If a seed is not so obtainable or available, a deposit thereof may satisfy the requirements of 35 U.S.C. 112. So long as the number of seeds deposited complies with the requirements of the IDA where the deposit is made, the USPTO considers such a compliant submission as satisfying the rules under 37 CFR 1.801 through 1.809. Applicant’s deposit of seeds at the China General Microbiological Culture Collection Center is noted (specification, page 7). However, there is no indication of the number of seeds that have been deposited. Further, there is no affirmative statement in the specification that all restrictions upon availability to the public will be irrevocably removed upon granting of the patent. If the deposit of these seeds is made and accepted under the terms of the Budapest Treaty, then an affidavit or declaration by the Applicant, or a statement by an attorney of record over his or her signature and registration number, stating that the seeds will be irrevocably and without restriction or condition released to the public upon the issuance of a patent would satisfy the deposit requirement made herein. If the deposit has not been made and accepted under the Budapest Treaty, then in order to certify that the deposit, meets the requirements set forth in 37 CFR 1.801-1.809, Applicant may provide assurance of compliance by an affidavit or declaration, or by a statement by an attorney of record over his or her signature and registration number showing that (a) during the pendency of the application, access to the invention will be afforded to the Commissioner upon request; (b) all restrictions upon availability to the public will be irrevocably removed upon granting of the patent; (c) the deposit will be maintained in a public depository for a period of 30 years or 5 years after the last request or for the enforceable life of the patent, whichever is longer; and (d) the viability of the biological material at the time of deposit will be tested (see 37 CFR 1.807). In addition, the identifying information set forth in 37 CFR 1.809(d) should be added to the specification. See 37 CFR 1.801 - 1.809 [MPEP 2401-2411.05] for additional explanation of these requirements. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim(s) 13-21 are rejected under 35 U.S.C. 103 as being unpatentable over Qi et al US 2015/0020237 A1 (published 1/15/2015, hereafter Qi) in view of Guo et al (2017) Creation and Application of Novel Humidity-Sensitive Male Sterile Materials In Common Wheat, The 8th National Conference on Wheat Genomics and Molecular Breeding. p.206. (based on English translation provided by Applicant, hereafter Guo) and Guo et al (2022) Journal of Systematics and Evolution. 60(6): 1378-1392 (available online 2/23/2021 more than 1 year prior to the earliest priority date, hereafter Guo 2022). Claims 13-21 are drawn to methods for acquiring or improving fertility of humidity-sensitive male-sterile Triticum aestivum L. plants or a use of such a plant. Qi teaches that male sterility in plant can be used in breeding research and utilization of crop heterosis, recurrent selection, and backcross without artificial emasculation (paragraph [0002]). Qi teaches that humidity-sensitive male sterile Arabidopsis was found as early as 1993, and that the mutant had restored fertility when transferred to an environment with a relative humidity of 90% (paragraph [0004]). Qi teaches a method of obtaining fertility-lowered mutants in rice using TILLING technology, but mutating seeds of rice with sodium azide. Mutated seeds were cultivated in field, and the first and second generations were self-crossed (paragraphs [0136-0145]). To identify mutants, enzyme-digested products of pooled DNA from the plants was analyzed by electrophoresis, and point mutations in triterpene synthase gene OsOSC8 were observed (paragraphs [0163-0169], figure 3). The mutations were observed in nucleotides 764, 809, and 1431, corresponding to amino acids 255, 270, and 477 (table 10). Qi teaches a method of restoring fertility of rice with RNAi silencing leading to humidity-sensitive male sterility, by wrapping the whole rice inflorescence with a plastic bag or using preservative film to cover the whole inflorescence during rice anthesis. This maintained humidity during growth of rice inflorescence at 80-100% humidity and returned to natural humidity of 40-60% after one week (paragraph [0203-0204]). Qi teaches the use of fertility-lowered mutants in breeding for preparing hybrid rice with wild-type and mutant parents (paragraphs [0209-0213]). Qi teaches homologous genes to OsOSC8 found in wheat, which Qi names TaOSC1 (paragraphs [0215-0218]). TaOSC114) (Qi SEQ ID NO:14 has a sequence with 99.9% sequence identity to instant SEQ ID NO: 12. See alignment below. Qi suggests that mutation of the sites P34E8, 4928, and 1708 in the wheat gene may lead to a similar restorable sterile phenotype and teaches that the functions of homologous genes of OsOSC8 in gramineous plants are very conservative (paragraphs [0226-0228]). US-14-362-900-14 Sequence 14, US/14362900 Publication No. US20150020237A1 GENERAL INFORMATION APPLICANT: Qi, Xiaoquan APPLICANT: Xue, Zheyong APPLICANT: Zhang, Yingchun APPLICANT: Xu, Xia APPLICANT: Liu, Dan TITLE OF INVENTION: Method for Preparing Fertility-Lowered TITLE OF INVENTION: Plant FILE REFERENCE: 59122-908222 CURRENT APPLICATION NUMBER: US/14/362,900 CURRENT FILING DATE: 2014-06-04 PRIOR APPLICATION NUMBER: CN 201110406266.2 PRIOR FILING DATE: 2011-12-08 PRIOR APPLICATION NUMBER: WO PCT/CN12/01546 PRIOR FILING DATE: 2012-11-14 NUMBER OF SEQ ID NOS: 24 SEQ ID NO 14 LENGTH: 2280 TYPE: DNA ORGANISM: Triticum aestivum FEATURE: OTHER INFORMATION: Chinese spring wheat Triticum aestivum triterpene synthase TaOSC1 Query Match 99.9%; Score 2278.4; Length 2280; Best Local Similarity 99.9%; Matches 2279; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAACCACTTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGTGGAAGCTCAAGATCGCCGAGGGCGGCCCGTGGCTCACGAGCGGCAACAACCACTTC 60 Qy 61 GGAAGAGAAACATGGGAGTTTGACCGAAATGACGCTGGATCAAGCGAAGAGCGGGATGCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGAAGAGAAACATGGGAGTTTGACCGAAATGACGCTGGATCAAGCGAAGAGCGGGATGCG 120 Qy 121 GTCGACGCTGCACGGGCTGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GTCGACGCTGCACGGGCTGAATTCCAGAAGAACAGGTTCAGGACAAGGCACAGCTCCGAT 180 Qy 181 GTTTTGGCCCGCATGCAGTTAGTAAAGGGGAATAACTTCAGCCTTGACCAACAACAGAAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GTTTTGGCCCGCATGCAGTTAGTAAAGGGGAATAACTTCAGCCTTGACCAACAACAGAAA 240 Qy 241 CCAAAAGGTGATGAAACTAGTGTCGACATCAACATAGCTACGGTGTCGGAGACACTGAAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 CCAAAAGGTGATGAAACTAGTGTCGACATCAACATAGCTACGGTGTCGGAGACACTGAAA 300 Qy 301 AGGGCACTCAGATACTTCTCAGCCATACAAGCGCACGATGGGCACTGGCCAGGAGATTTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AGGGCACTCAGATACTTCTCAGCCATACAAGCGCACGATGGGCACTGGCCAGGAGATTTT 360 Qy 361 CCGGGCCCTCTCTTTACCACAGCAACCATGATCGTAGTTTTGTATGTCACGGAGTCGTTA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CCGGGCCCTCTCTTTACCACAGCAACCATGATCGTAGTTTTGTATGTCACGGAGTCGTTA 420 Qy 421 GGTACTACGCTATCGTCAGAACACCGCAAGGAGATCTGTCGCTATTTGTACAACCGACAG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GGTACTACGCTATCGTCAGAACACCGCAAGGAGATCTGTCGCTATTTGTACAACCGACAG 480 Qy 481 AATATGGATGGAGGATGGGGACTACATGCGGAAGGCGAGAGCTCCATGCTCAGCTCAGCT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 AATATGGATGGAGGATGGGGACTACATGCGGAAGGCGAGAGCTCCATGCTCAGCTCAGCT 540 Qy 541 CTCAACTACGCTGCTCTAAGACTACTTGGTGAGGGTGCTGATGATGGACCAGATATGTCC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 CTCAACTACGCTGCTCTAAGACTACTTGGTGAGGGTGCTGATGATGGACCAGATATGTCC 600 Qy 601 ATGCCAAAAGCTAGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATATTG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 ATGCCAAAAGCTAGGAAATGGATACATGACCATGGTGGTGCAACAATGATACCAATATTG 660 Qy 661 GGAAAAGTGTGGCTTTCGGTACTTGGGGTTTCTGAATGGTCAGGTGTAAACCCTATGCCC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GGAAAAGTGTGGCTTTCGGTACTTGGGGTTTCTGAATGGTCAGGTGTAAACCCTATGCCC 720 Qy 721 CCAGAATTGTTCCTTCTGCCATCCTTCGTTCCTATCCAACCAGGACGGTTGTGGAGTCAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CCAGAATTGTTCCTTCTGCCATCCTTCGTTCCTATCCAACCAGGACGGTTGTGGAGTCAC 780 Qy 781 TTCAGAATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TTCAGAATGGCTTTCATCCCCATGTCCTATTTATATGGCAAGAAGTTTGTTGGCCCAATA 840 Qy 841 ACAAAACTGGTTTTATCATTAAGGGAAGAGCTGCATATTCACCCCTACAAAAAGATTAAC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 ACAAAACTGGTTTTATCATTAAGGGAAGAGCTGCATATTCACCCCTACAAAAAGATTAAC 900 Qy 901 TGGAAGCAAGCGCGCAAATTATGCGCAAAGGAAGATGCGTATCATCCACATACCTGGCTC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 TGGAAGCAAGCGCGCAAATTATGCGCAAAGGAAGATGCGTATCATCCACATACCTGGCTC 960 Qy 961 CAAGAATGCTTGTCCGATTGCCTTTACAGTTTCGGTGAACCTTTTCTGGCATGTTGGCCA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CAAGAATGCTTGTCCGATTGCCTTTACAGTTTCGGTGAACCTTTTCTGGCATGTTGGCCA 1020 Qy 1021 GTTTCCCACATGAGACGAAAAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGAT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 GTTTCCCACATGAGACGAAAAGCTCTACGACAAATTGCCGATTTCCTGAAATACGAAGAT 1080 Qy 1081 GATATTTCACGGTATATCTGCATTGGCGCTGCGCAAAAGGCATTATCCATGTTATGCTGT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GATATTTCACGGTATATCTGCATTGGCGCTGCGCAAAAGGCATTATCCATGTTATGCTGT 1140 Qy 1141 TGGTCTGAGAATCCCAGTTCAGATGCATTCAAGCGCCACTTGGCTAGAGTTTCTGATTTC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 TGGTCTGAGAATCCCAGTTCAGATGCATTCAAGCGCCACTTGGCTAGAGTTTCTGATTTC 1200 Qy 1201 CTATGGCTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCAGGTCAGTCATGGGATGTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 CTATGGCTCGGTGAAGATGGCATGAAAGTGCGGGTATGTGCAGGTCAGTCATGGGATGTT 1260 Qy 1261 GCTTTTGCTGTACAAGCAATATTAGCGTGTGATGTTGCACAGGAATTTGGAACTACTCTG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GCTTTTGCTGTACAAGCAATATTAGCGTGTGATGTTGCACAGGAATTTGGAACTACTCTG 1320 Qy 1321 AAGAAAGCACACCATTTCATAAAAGCATCCCAGATTGTCAGCAATCCTACCGGTGACTTC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 AAGAAAGCACACCATTTCATAAAAGCATCCCAGATTGTCAGCAATCCTACCGGTGACTTC 1380 Qy 1381 AGCAGAAAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 AGCAGAAAGTACCGTCACATCTCTAAAGGAGGATGGGCCTTCCAGGTTGCAGACCAGGGC 1440 Qy 1441 TGGCAGGTTTCAGACTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCAAAGTTT 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 TGGCAGGTTTCAGACTGCACAGCAGAAGCTCTCAAGGCTCTGTTACTGCTCTCAAAGTTT 1500 Qy 1501 CCGTCAGAGATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCAGTGAACATA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 CCGTCAGAGATCGTGGGTGATCAGATGGAAACATGCCGCTTCCATGATGCAGTGAACATA 1560 Qy 1561 TTATTATCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATAT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 TTATTATCTTTACAGAATCCTAATGGTGGCTATGGAACTTGGGAGCTAGCTCGTACATAT 1620 Qy 1621 CCATGGATGGAGAATTTAAACATGACAGAGATATATGCAGACATCATGGTGGAGCATCAG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 CCATGGATGGAGAATTTAAACATGACAGAGATATATGCAGACATCATGGTGGAGCATCAG 1680 Qy 1681 TACGTCGAGTGTACCTCGTCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAATACCCC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 TACGTCGAGTGTACCTCGTCGGTCATCCAAGCATTGGCCCTGTTTCGGCAAAAATACCCC 1740 Qy 1741 GGGCATCGGGAAGATGAAGTAGAACAATGCATCAGGAGAGCGACAGAATTCATCGAGAAG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 GGGCATCGGGAAGATGAAGTAGAACAATGCATCAGGAGAGCGACAGAATTCATCGAGAAG 1800 Qy 1801 TTACAGAATGAGGACGGTTCATGGTTCGGATCATGGGGTATTTGCTTCACATACGGCACG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 TTACAGAATGAGGACGGTTCATGGTTCGGATCATGGGGTATTTGCTTCACATACGGCACG 1860 Qy 1861 TGGTTTGCTATAGAGGGCCTATCGGCAGTTGGACAGTGTTACAATAATAGCACCTACATC 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 TGGTTTGCTATAGAGGGCCTATCGGCAGTTGGACAGTGTTACAATAATAGCACCTACATC 1920 Qy 1921 CGGAAGGGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 CGGAAGGGTTGCCAGTTTCTATTATCAAAGCAGCTAAGGAATGGTGGATGGGGTGAGAGT 1980 Qy 1981 CATCTTTCATCCACAACCAAGGCATACACGAACCTAGACGGGGAGAAATCACATGTAGTC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 CATCTTTCATCCACAACCAAGGCATACACGAACCTAGACGGGGAGAAATCACATGTAGTC 2040 Qy 2041 AACACCGCATGGGCAATGTTGGCACTAATGAAAGCTGGACAGGCCGAACGAGATCCGTCT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 AACACCGCATGGGCAATGTTGGCACTAATGAAAGCTGGACAGGCCGAACGAGATCCGTCT 2100 Qy 2101 CCTTTGCACGAAGCTGCAAGACTTATCATGAGCATGCAACTTGGCAATGGTGACTTCCCA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 CCTTTGCACGAAGCTGCAAGACTTATCATGAGCATGCAACTTGGCAATGGTGACTTCCCA 2160 Qy 2161 CAGGAGGAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGC 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 CAGGAGGAAATGATTGGAAGTTTCTTGAAAAATGGTCCCTTGTGTTATATGGCTTATCGC 2220 Qy 2221 AACATATTCCCCATATGGGCCCTTGGAGAGTATCATAGACTAGTACTTTGCTCTGGCTAA 2280 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 2221 AACATATTCCCCATATGGGCCCTTGGAGAGTATCATAGATTAGTACTTTGCTCTGGCTAA 2280 Qi does not teach a Triticum aestivum L. plant with a TaGMS-A gene with the coding sequence of SEQ ID NO: 8, a TaGMS-B gene with the coding sequence of SEQ ID NO: 10, or a TaGMS-D gene with the coding sequence of SEQ ID NO: 12, or mutations in the 1595th, 6th, and 791st nucleotides of said genes. Guo teaches three wheat genes (TaOSC12A/B/D) homologous to the rice OsOSC12 gene (abstract). Guo teaches that the sequences of these genes were obtained in the common wheat Xichang 76-9 (abstract). Guo teaches a loss of catalytic function in TaOSC12A and further teaches screening for mutants of TaOSC12A/B/D using TILLING and site-directed mutagenesis to identify nonsense mutation sites and corresponding plants (abstract). Guo suggests that the next step is to hybridize TaOSC12B and TaOSC12D mutants to obtain a plant with a moisture-sensitive sterile phenotype (abstract). Guo 2022 teaches three candidate TaOSC genes, Ta4A495100, Ta7A003500, and Ta7D004000, that authors proposed to be associated with pollen coat formation and deficiency may lead to humidity-sensitive male sterility phenotype similar to OsOSC12/OsPTS1 in rice (page 1389, right column, paragraph 2). Guo 2022 teaches that this information is very important for the crossbreeding of bread wheat (page 1389, right column, paragraph 2). These genes are the same genes described in the instant specification as TaGMS-A, TaGMS-B, and TaGMS-D; see Table 1 of Guo 2022 in comparison to the instant specification, page 9, paragraph 2. Guo 2022 teaches that these genes have conserved motifs, including 2 QW domains around and C-terminal to the 600th amino acid (figure 3). Before the filing of the instant application, one of ordinary skill in the art would have been motivated to modify the method of Qi of mutating an OSC gene in rice to provide humidity-sensitive male sterile plants to instead mutate homologous genes in wheat. One of ordinary skill in the art would have been motivated to mutate a Xichang 76-9 plant, as taught by Guo, because it was a common wheat plant. One of ordinary skill in the art would have been motivated to mutate genes which are identical to the TaGMS-A, TaGMS-B, and TaGMS-D genes of the instant specification, because Guo 2022 teaches these genes to be homologous to the rice OsOSC12 gene responsible for humidity-sensitive male-sterility. One of ordinary skill in the art would have had a reasonable expectation of success, because Qi teaches that these homologous genes have conserved functionality in gramineous plants. Regarding mutations specifically in the 1595th nucleotide of the coding sequence of the TaGMS-A gene of G to A, in the 6th nucleotide of the coding sequence of the TaGMS-B gene of G to A, and in the 791st nucleotide of the coding sequence of the TaGMS-D gene of C to T, although these exact mutations are not taught in the prior art, such mutations would have been expected to occur as a result of random mutagenesis described by Qi and Guo. It would have been obvious to one of ordinary skill in the art that nonsense and non-conservative mutations such as the mutations of the instant invention would be likely to have a negative effect on the function of these genes. Moreover, all of the claimed mutations are present in the encoded amino acid sequence, N-terminal to conserved domains, which one of ordinary skill in the art would expect to contribute to protein function. Two of the three claimed mutations fall upstream of the mutations described in the art to reduce function of the homologous rice gene. Therefore, the mutations of the instant invention would have been obvious to one of ordinary skill in the art to disrupt the function of the recited wheat genes and would have been generated through random mutagenesis described in the prior art. Thus, such mutations would have been obvious. In order to demonstrate that the claimed mutations of the instant invention would have been non-obvious, Applicant would need to demonstrate that these specific mutations provide surprising results as compared to other point mutations leading to non-conservative and premature stop codon mutations in the genes. A mutated Xichang 76-9 plant, as taught by Guo, would comprise coding sequences of TaGMS-A, TaGMS-B, and TaGMS-D of SEQ ID NOs: 8, 10, and 12 respectively. In light of the above, a method for acquiring humidity-sensitive male-sterile Triticum aestivum L. by mutating a donor plant to produce a triple-mutant plant (instant claim 13) would have been obvious. Guo teaches hybridizing null mutant plants for TaOSC-B and TaOSC-D and obtaining plants with a humidity-sensitive male sterile phenotype, which reads on selecting a plant from the progeny plants. Although Guo does not explicitly state that the TaOSC-B and TaOSC-D mutants would be crossed with a TaOSC-A mutant, it would have been obvious to one of skill in the art to further cross the double mutant with the TaOSC-A mutant to obtain a triple mutant, because Guo and Guo 2022 teach that there are three homologs of this gene in wheat. It would also have been obvious to self-pollinate, as taught by Qi, to generate homozygous mutants. One of ordinary skill in the art would have had reasonable expectation of success, because Guo had already identified a TaOSC-A version without catalytic activity. A Xichang 76-9 plant comprising null mutations in TaOSC-A, TaOSC-B, or TaOSC-D as described above would appear to be the deposited Triticum aestivum L. lines with accession numbers of CGMCC No. 45692, 45693, and 45694, given the plants with the mutations would have the same mutations in the same Xichang 76-9 genetic backgrouns. Thus, the method of acquiring humidity sensitive male-sterile Triticum aestivum L. comprising subjecting a first, second, and third Triticum aestivum L. plant with accession number of CGMCC No. 45692, 45693, and 45694 to a triallelic crossing and self-pollinating to produce progeny plants and selecting a plant from the progeny plants to obtain a triple-mutant plant (claim 14) would have been obvious in view of Qi, Guo, and Guo 2022. The triple mutant itself, being in a Xichang 76-9 background, would appear to be the deposited humidity-sensitive male-sterile Triticum aestivum L. line with an accession number of CGMCC No. 45691, because the plants described above would have the same mutations and the same genetic background. Because Guo 2022 teaches the importance of the mutant in crossbreeding of bread wheat, the use of said plant in a crossbreeding (instant claim 15) is obvious. Claims 16-18 do not require that the use of claim 15 comprise any additional steps, so claims 16-18 would also be obvious. However, Qi does teach a method of improving fertility of the humidity-sensitive male-sterile rice plants of wrapping the inflorescence of the rice in a bag or preservative film, which reads on transparent plastic film, during rice anthesis, which reads on before a pollen shedding and after a heading. The film or bag was removed after one week, which reads on “until the pollen shedding is completed” (claim 18, lines 3-4). It would have been obvious to apply the same method to a humidity-sensitive male-sterile wheat plant, making the uses of claims 16-18 obvious. Qi’s method of improving fertility in the humidity-sensitive male-sterile plant comprised maintaining humidity during growth of the inflorescence at 80-100% humidity, which encompasses the 90% humidity in an environment for an ear of the plant during a flowering period required by instant claim 19 (lines 2-4). Wrapping the ear of the humidity-sensitive male-sterile triple mutant wheat plant with a plastic bag or plastic film until pollen shedding is completed (instant claims 20-21) would have been obvious to one of ordinary skill in the art because the method had been used successfully in the rice humidity-sensitive male-sterile plant of Qi. Claims 13-21 would have been obvious to one of ordinary skill in the art in light of Qi, Guo, and Guo 2022. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-F 8:00am-4pm EDT. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /VICTORIA L DELEO/Examiner, Art Unit 1662 /Anne Kubelik/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Aug 18, 2025
Application Filed
Jun 29, 2026
Non-Final Rejection mailed — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12668614
USE OF GLYCINE MAX GmSAMMT GENE IN REGULATION OF PROTEIN CONTENT AND/OR YIELD OF PLANT
2y 2m to grant Granted Jun 30, 2026
Patent 12584117
Use of Gene Encoding Gibberellin 3Beta-Hydroxylase of Glycine Max, GmGA3ox1
2y 11m to grant Granted Mar 24, 2026
Patent 12577577
COMPOSITIONS AND METHODS TO INCREASE RESISTANCE TO PHYTOPHTHORA SOJAE IN SOYBEAN
2y 9m to grant Granted Mar 17, 2026
Patent 12545926
NUCLEIC ACID MOLECULES FOR CONFERRING INSECTICIDAL PROPERTIES IN PLANTS
2y 3m to grant Granted Feb 10, 2026
Patent 12522839
USE OF ZLMYB1 AND ZLMYB2 GENES FROM ZIZANIA LATIFOLIA IN INCREASING ANTHOCYANIDIN CONTENT OF RICE SEED
2y 1m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
37%
Grant Probability
-3%
With Interview (-40.0%)
2y 6m (~1y 7m remaining)
Median Time to Grant
Low
PTA Risk
Based on 27 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month