Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Election/Restrictions
1. Applicant's election with traverse of Group I, claim 1, and SEQ ID NO: 1 in the reply filed on 6/19/2026 is acknowledged.
Applicants argue that SEQ ID NO:1-12 are unified because the sequences all related to the genotype for Stevia Cultivar “320032” and that examining entire sequences would not create an undue burden and would maintain the unity and utility of the invention (response, page 2, paragraphs 4-5).
The Office disagrees. First, this case is not restricted according to unity of the invention as for a national stage case of a PCT. Further, those SNAP have completely distinct primary structures. Still further, examining all the sequence needs individual sequence search for all 12 sequences, which is undue.
As a result, claim 1 and SEQ ID NO:1 is examined on the merits.
The requirement is still deemed proper and is therefore made FINAL.
Specification
2. The specification is objected to because the status of U.S. application needs to be updated. For example, U.S. application is recited on page 1.
3. In the specification and drawing, there are numerous places recite SNP ID NO: 1-12, however, in the sequence listing there is no sequence refers to SNP ID NO:. It is suggested to replace SNP ID NO: with –SEQ ID NO:-- or to clearly indicate that SNP ID NO: and corresponding SEQ ID NO: are identical.
Improper Markush Grouping
4. Claim 1 is rejected under the judicially-created basis that it contains an improper Markush grouping of alternative. See In re Harnisch, 631 F.2d 716, 721-722 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. and Int. 1984). The improper Markush grouping includes species of the claimed invention that do not share both a substantial structural feature and a common use that flows from the substantial structural feature. The members of the improper Markush grouping do not share a substantial feature and/or common use that flows from the substantial structural feature and/or common use that flows from the substantial structural feature for the following reasons:
In claim 1, SNAP ID NO:2-11 have distinct primary structures to elected SEQ ID NO:1.
In response to this rejection, Applicant should either amend the claim(s) to recite only individual species or groupings of species that share a substantial structural feature as well as a common use that flows from the substantial structural feature, or present a sufficient showing that the species recited in the alternative of the claims in fact share a substantial structural feature as well as a common use that flows from the substantial structural feature. This is a rejection on the merits and may be appealed to the Board of Patent Appeals and Interferences in accordance with 35 USC 134 and 37 CFR 41.31 (a)(1).
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
5. Claim 1 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
In claim 1, the recitation “SNP ID NO:1” renders the claim indefinite. On page 5 of specification, Applicants refer SNP ID NO:1 the Sequence Listing, however, in Sequence Listing, there is no sequence refers to SNP ID NO:1. The metes and bonds are not clear. It is suggested to replaced the recitation with –SEQ ID NO:1--.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
6. Claim 1 is rejected under 35 U.S.C. 103 as being obvious over Markosyan et al. (U.S. Patent No. 11,284,578).
The applied reference has a common assignee and inventors with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2).
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Instant claim is drawn to a method Instant claim is drawn to A method for determining the genotype of a stevia plant, wherein said method comprises: obtaining a sample of nucleic acids from said plant; and detecting in said nucleic acids, one or more single nucleotide polymorphisms (SNPs) comprising SEQ ID NO:1.
Claims 24-25 of U.S. Patent No. 11,284,578 is drawn to a method of producing a stevia seed or embryo by crossing a plant or plant part of stevia cultivar ‘16228013’, or a locus conversion thereof, wherein stevia cultivar ‘16228013’ has the single nucleotide polymorphisms of SNP ID NO:1, SNP ID NO:2, SNP ID NO:3, SNP SID NO:4, SNP ID NO:5, and SNP ID NO:6, with itself or a different stevia plant, wherein representative plant tissue of said stevia cultivar ‘16228013’ has been deposited under CGMCC No. 16984; collecting said seed or embryo from said crossing or selfing; and identifying progeny having the single nucleotide polymorphisms of SNP ID NO:1, SNP ID NO:2, SNP ID NO:3, SNP SID NO:4, SNP ID NO:5, and SNP ID NO:6.
Given instant SEQ ID NO:1 is the same as SEQ ID NO:1 of U.S. Patent No. 11,284,578 (see alignment below), obtaining a sample of nucleic acids from said plant; and detecting in said nucleic acids, one or more single nucleotide polymorphisms (SNPs) comprising SEQ ID NO:1 would have been obviously performed in order to identifying progeny having the single nucleotide polymorphisms of SNP ID NO:1 as taught in the claims in U.S. Patent No. 11,284,578.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
7. Claim 1 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 24-25 of U.S. Patent No. 11,284,578. Although the claims at issue are not identical, they are not patentably distinct from each other.
Instant claim is drawn to A method for determining the genotype of a stevia plant, wherein said method comprises: obtaining a sample of nucleic acids from said plant; and detecting in said nucleic acids, one or more single nucleotide polymorphisms (SNPs) comprising SEQ ID NO:1.
Claims 24-25 of U.S. Patent No. 11,284,578 is drawn to a method of producing a stevia seed or embryo by crossing a plant or plant part of stevia cultivar ‘16228013’, or a locus conversion thereof, wherein stevia cultivar ‘16228013’ has the single nucleotide polymorphisms of SNP ID NO:1, SNP ID NO:2, SNP ID NO:3, SNP SID NO:4, SNP ID NO:5, and SNP ID NO:6, with itself or a different stevia plant, wherein representative plant tissue of said stevia cultivar ‘16228013’ has been deposited under CGMCC No. 16984; collecting said seed or embryo from said crossing or selfing; and identifying progeny having the single nucleotide polymorphisms of SNP ID NO:1, SNP ID NO:2, SNP ID NO:3, SNP SID NO:4, SNP ID NO:5, and SNP ID NO:6.
Given instant SEQ ID NO:1 is the same as SEQ ID NO:1 of U.S. Patent No. 11,284,578 (see alignment below), obtaining a sample of nucleic acids from said plant; and detecting in said nucleic acids, one or more single nucleotide polymorphisms (SNPs) comprising SEQ ID NO:1 would have been obviously performed in order to identifying progeny having the single nucleotide polymorphisms of SNP ID NO:1 as taught in the claims in U.S. Patent No. 11,284,578.
RESULT 1
BGK24612
(NOTE: this sequence has 3 duplicates in the database searched.
See complete list at the end of this report)
ID BGK24612 standard; DNA; 102 BP.
XX
AC BGK24612;
XX
DT 25-JUL-2019 (first entry)
XX
DE Stevia rebaudiana SNP DNA fragment stv_snp_568899, SEQ ID 1.
XX
KW SNP; cell culture; crop improvement; disease resistance; dna typing; ds;
KW feedstuff; food; genetic marker; herbicide resistance; insect resistance;
KW plant; propagation; seed; single nucleotide polymorphism;
KW transgenic plant.
XX
OS Stevia rebaudiana; 16228013 CGMCC No. 11706.
XX
FH Key Location/Qualifiers
FT variation 56
FT /*tag= a
FT /standard_name= "Single nucleotide polymorphism"
XX
CC PN WO2019113485-A1.
XX
CC PD 13-JUN-2019.
XX
CC PF 07-DEC-2018; 2018WO-US064532.
XX
PR 07-DEC-2017; 2017US-0595609P.
XX
CC PA (PURE-) PURECIRCLE USA INC.
XX
CC PI Markosyan A, Ong SS, Jing R, Bu YC, Zhu J, Chen JN, Wong YY;
XX
DR WPI; 2019-510691/49.
XX
CC PT New seed of stevia cultivar 16228013 and a representative sample of plant
CC PT tissue of the cultivar was deposited under CGMCC No. 11706 is useful for
CC PT producing plant which is used in food or feed product.
XX
CC PS Claim 26; SEQ ID NO 1; 47pp; English.
XX
CC The present invention relates to a novel seed of stevia cultivar
CC '16228013', useful for propagating the plant vegetatively. The invention
CC further relates to: (1) a plant or its part produced by growing the seed;
CC (2) a Stevia plant, or its part having all the physiological and
CC morphological characteristics of the stevia plant; (3) a food or a feed
CC product comprising the plant or its part; (4) a tissue or a cell culture
CC of regenerable cells of the plant; (5) a stevia plant regenerated from
CC the tissue or cell culture; (6) a method for vegetatively propagating the
CC plant; (7) a stevia plant produced by growing the plantlets or
CC proliferated shoots; (8) a method for producing an F1 stevia seed; (9) a
CC method for determining the genotype of the Stevia plant; (10) a method
CC for producing an herbicide resistant stevia plant; (11) a method for
CC producing an insect resistant stevia plant; (12) a method for producing a
CC disease resistant stevia plant; (13) an herbicide resistant, insect
CC resistant, and disease resistant stevia plant; (14) a method for
CC introducing a desired trait into stevia cultivar 16228013; (15) a method
CC for developing a stevia plant in a stevia plant breeding program; (16)
CC six highly polymorphic SNPs loci and the corresponding genomic sequences
CC for identifying Stevia variety '16228013' derived plant materials; and
CC (17) a second stevia seed, a plant, a plant part, or a cell produced by
CC crossing a plant or plant part of stevia cultivar 16228013, or a locus
CC conversion, with another plant and the stevia cultivar 16228013 seed,
CC plant, plant part, or cell having the same polymorphisms for the single
CC nucleotide polymorphisms of SNP ID NOs: 1-6 as the plant or plant part of
CC stevia cultivar 16228013.
XX
SQ Sequence 102 BP; 34 A; 26 C; 7 G; 34 T; 0 U; 1 Other;
Query Match 100.0%; Score 101.6; Length 102;
Best Local Similarity 100.0%;
Matches 102; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AAAAATAGACTTTTTACCATCTCTTCCTCTCAAGTCTCAATCTCAACACCTACACRTGTA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 AAAAATAGACTTTTTACCATCTCTTCCTCTCAAGTCTCAATCTCAACACCTACACRTGTA 60
Qy 61 TGTTTTTTCAAACAAACCACACACATTGGTTTTGATCTAAAA 102
||||||||||||||||||||||||||||||||||||||||||
Db 61 TGTTTTTTCAAACAAACCACACACATTGGTTTTGATCTAAAA 102
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LI ZHENG whose telephone number is (571)272-8031. The examiner can normally be reached Monday-Friday (9-5).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/LI ZHENG/Primary Examiner, Art Unit 1662
Prosecution Insights