Prosecution Insights
Last updated: October 04, 2026
Application No. 19/192,111

ENGINEERING TOMATO FRUITS AS A PRODUCTION PLATFORM FOR TERPENOID PRODUCTS

Non-Final OA §101§103§112§Other
Filed
Apr 28, 2025
Priority
Apr 26, 2024 — provisional 63/639,464
Examiner
ROBINSON, KEITH O NEAL
Art Unit
1661
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University of Georgia Research Foundation Inc.
OA Round
1 (Non-Final)
92%
Grant Probability
Favorable
1-2
OA Rounds
4m
Est. Remaining
95%
With Interview

Examiner Intelligence

Grants 92% — above average
92%
Career Allowance Rate
1262 granted / 1377 resolved
+31.6% vs TC avg
Minimal +4% lift
Without
With
+3.8%
Interview Lift
resolved cases with interview
Fast prosecutor
1y 10m
Avg Prosecution
11 currently pending
Career history
1384
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
13.7%
-26.3% vs TC avg
§102
17.6%
-22.4% vs TC avg
§112
62.1%
+22.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1377 resolved cases

Office Action

§101 §103 §112 §Other
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Restriction to one of the following inventions is required under 35 U.S.C. 121: I. Claims 1-12, drawn to a modified tomato plant, classified in A01H 5/08, for example. II. Claims 13-24, drawn to a method of producing a modified tomato plant material, classified in C12N 15/00, for example. Response to Election/Restrictions Requirement Applicant's election with traverse of Group I (claims 1-12) in the reply filed on May 29, 2026 is acknowledged. The traversal is on the grounds that restriction requirements are optional and if a search and examination of an entire application can be made without burden the Examiner must examine it on the merits (see page 7, 4th paragraph to page 8, bridging paragraph of ‘Remarks’ filed May 29, 2026). This is not found persuasive because the inventions are distinct and require searching different classes/subclasses or search queries. In addition, the prior art applicable to one invention would not likely be applicable to another invention. Furthermore, the inventions are likely to raise different non-prior art issues under 35 USC 101 and/or USC 112, first paragraph. Applicant’s election with traverse of SEQ ID NO: 1 and SEQ ID NO: 45 in the reply filed on May 29, 2026 is acknowledged. The traversal is on the grounds that a search of the alleged species could be made by the Examiner without undue burden (see page 8, 4th paragraph of ‘Remarks’ filed May 29, 2026). This is not persuasive. Applicant is reminded that different nucleotide sequences and amino acid sequences are structurally distinct chemical compounds and are unrelated to one another. These sequences are thus deemed to normally constitute independent and distinct inventions within the meaning of 35 U.S.C. 121. Absent evidence to the contrary, each such nucleotide sequence and each amino acid sequence is presumed to represent an independent and distinct invention, subject to a restriction requirement pursuant to 35 U.S.C. 121 and 37 CFR 1.141 et seq. The requirement is still deemed proper and is therefore made FINAL. Status of the claims Claims 1-24 are pending. Claims 1-12 are under examination. Claims 13-24 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected group, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on May 29, 2026. Drawings The drawings filed April 28, 2025 have been accepted. Specification It is noted that pages 61-62 of the specification has a listing of references. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the Examiner on form PTO-892, they have not been considered. Claim Objections Claims 3, 4, 11 and 12 are objected to because of the following informalities: The claims read on non-elected SEQ ID NOs. Appropriate correction is required. Claim Rejections - 35 USC § 112 – second paragraph The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 10 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The claim does not particularly point out or distinctly claim the elected SEQ ID NO: 1 or SEQ ID NO: 45. The SEQ ID NOs cited in the claim are not under examination. Claim Rejections - 35 USC § 112 – Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-12 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claims are drawn to modified tomato plants comprising at least one targeted modification in at least one endogenous terpene or terpenoid biosynthetic gene resulting in decreased expression of the endogenous terpene or terpenoid biosynthetic gene relative to a reference plant lacking the modification, wherein the targeted modification in the endogenous terpene or terpenoid biosynthetic gene comprises an insertion, replacement, and/or deletion of one or more nucleotides in the endogenous terpene or terpenoid biosynthetic gene, and wherein the decrease of expression in the endogenous terpene or terpenoid biosynthetic gene results in a depletion of carotene compounds in fruit of the tomato relative to the reference tomato plant lacking the modification. The Federal Circuit has recently clarified the application of the written description requirement. The court stated that a written description of an invention “requires a precise definition, such as by structure, formula, [or] chemical name, of the claimed subject matter sufficient to distinguish it from other materials”. University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568; 43 USPQ2d 1398, 1406 (Fed. Cir. 1997). The court also concluded that “naming a type of material generally known to exist, in the absence of knowledge as to what that material consists of, is not description of that material”. Id. Further, the court held that to adequately describe a claimed genus, Patent Owner must describe a representative number of the species of the claimed genus, and that one of skill in the art should be able to “visualize or recognize the identity of the members of the genus”. Id. See MPEP 2163. In addition, the specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention at the time of filing. The purpose of the written description requirement is to ensure that the scope of the right to exclude, as set forth in the claims, does not overreach the scope of the inventor’s contribution to the field of art as described in the patent specification. The entire claim must be considered, including the preamble language and transitional phrases. "Preamble language" is that language in a claim appearing before the transitional phase, e.g., before "comprising," "consisting essentially of," or "consisting of." The transitional term "comprising" is "open-ended" in that it covers the expressly recited subject matter, alone or in combination with unrecited subject matter. See, e.g., Genentech, Inc. v. Chiron Corp., 112 F.3d 495, 501, 42 USPQ2d 1608, 1613 (Fed. Cir. 1997) ("‘Comprising’ is a term of art used in claim language which means that the named elements are essential, but other elements may be added and still form a construct within the scope of the claim."); Ex parte Davis, 80 USPQ 448, 450 (Bd. App. 1948) ("comprising" leaves the "claim open for the inclusion of unspecified ingredients even in major amounts"). It is noted that the transitional phrase, and the body of the claim, must be sufficiently supported to satisfy the written description requirement. In the instant case, the claims may be construed as any modified tomato plant that includes specific structures or elements in addition to the at least one targeted modification in at least one endogenous terpene or terpenoid biosynthetic gene resulting in decreased expression of the endogenous terpene or terpenoid biosynthetic gene relative to a reference plant lacking the modification. There is insufficient description of any other structures or elements embraced by the claim, thus, the scope and meaning of the claim is not clear. PNG media_image1.png 18 19 media_image1.png Greyscale In addition, the claims are drawn to a genus of modified tomato plants comprising at least one targeted modification in at least one endogenous terpene or terpenoid biosynthetic gene resulting in decreased expression of the endogenous terpene or terpenoid biosynthetic gene relative to a reference plant lacking the modification. The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice , reduction to drawings or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. PNG media_image2.png 18 19 media_image2.png Greyscale A "representative number of species" means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. In the instant case, there is no evidence in the specification of a variety of species that reflect any variation of the claimed genus nor is there any evidence that Applicant has invented species sufficient to constitute the claimed genus of modified tomato plants comprising at least one targeted modification in at least one endogenous terpene or terpenoid biosynthetic gene resulting in decreased expression of the endogenous terpene or terpenoid biosynthetic gene relative to a reference plant lacking the modification. See Enzo Biochem, 323 F.3d at 966, 63 USPQ2d at 1615; Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) ("[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated."). "A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species. See Vas-Cath Inc. v. Mahurkar 1991 (CA FC) 19 USPQ2d 1111, 1115, which teaches that the purpose of the written description is for the purpose of warning an innocent purchaser, or other person using a machine, of his infringement of the patent; and at the same time, of taking from the inventor the means of practicing upon the credulity or the fears of other persons, by pretending that his invention is more than what it really is, or different from its ostensible objects, that the patentee is required to distinguish his invention in his specification. Thus, it is unclear that Applicant was in possession of the invention as broadly claimed. Claim Rejections - 35 USC § 112 – Enablement The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 1-12 are rejected under 35 U.S.C. 112(a), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. The invention appears to employ novel plants. Since the plant is essential to the claimed invention it must be obtainable by a repeatable method set forth in the specification or otherwise be readily available to the public. If the plant is not so obtainable or available, the requirements of 35 USC § 112 may be satisfied by a deposit of the plant. A deposit of 650 seeds of each of the claimed embodiments is considered sufficient to ensure public availability. The specification does not disclose a repeatable process to obtain the plant and it is not apparent if the plant is readily available to the public. There is no indication in the specification of a deposited plant(s) for the pending embodiments nor does the specification indicate under what conditions any deposit(s) have been/will be made. (a) If a deposit is made under the terms of the Budapest Treaty, then a statement, affidavit or declaration by Applicants, or a statement by an attorney of record over his or her signature and registration number, or someone empowered to make such a statement, stating that the instant invention will be irrevocably and without restriction released to the public upon the issuance of a patent, would satisfy the deposit requirement made herein. (b) If a deposit has not been made under the Budapest Treaty, then in order to certify that the deposit meets the criteria set forth in 37 CFR 1.801 -1.809 and MPEP 2402-2411.05, Applicant may provide assurance of compliance by statement, affidavit or declaration, or by someone empowered to make the same, or by a statement by an attorney of record over his or her signature and registration number showing that: (i) during the pendency of this application, access to the invention will be afforded to the Commissioner upon request; (ii) all restrictions upon availability to the public will be irrevocably removed upon granting of the patent in accordance with 37 CFR § 1.808(a)(2); (iii) the deposit will be maintained in a public depository for a period of 30 years or 5 years after the last request or for the effective life of the patent, whichever is longer; (iv) a test of the viability of the biological material at the time of deposit (see 37 CFR § 1.807); and, (v) the deposit will be replaced if it should ever become inviable. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-9, 11 and 12 are rejected under 35 U.S.C. 103 as being unpatentable over D’Ambrosio et al (Transgenic Research 27, 367-378, 2018), in view of Gady et al (Molecular Breeding 29, 801-812, 2012), further in view of Cermak et al (U.S. Patent No. 11,926,835, March 12, 2024). . The claims read on modified tomato plants comprising at least one targeted modification in at least one endogenous terpene or terpenoid biosynthetic gene resulting in decreased expression of the endogenous terpene or terpenoid biosynthetic gene relative to a reference plant lacking the modification, wherein the targeted modification in the endogenous terpene or terpenoid biosynthetic gene comprises an insertion, replacement, and/or deletion of one or more nucleotides in the endogenous terpene or terpenoid biosynthetic gene, and wherein the decrease of expression in the endogenous terpene or terpenoid biosynthetic gene results in a depletion of carotene compounds in fruit of the tomato relative to the reference tomato plant lacking the modification (claim 1). Limitations include wherein the at least one endogenous terpene or terpenoid biosynthetic gene comprises a beta carotene hydroxylase, a phytoene synthase, a cytochrome P450, a uracil dependent glucosyl transferase, or a combination thereof (claim 2); wherein the endogenous terpene or terpenoid biosynthetic gene comprises a DNA molecule having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleic acid sequence set forth in any one of SEQ ID NOs: 1-44 or an allelic variant thereof (claim 3); wherein the endogenous terpene or terpenoid biosynthetic genes comprise:(a) beta carotene hydroxylase (CrtR-B2; SEQ ID NO: 2 or 24), phytoene synthase (PSY1; SEQ ID NO: 1 or 23), cytochrome P450_1 (P450_1; SEQ ID NO: 5 or 27), cytochrome P450_2 (P450_2; SEQ ID NO: 6 or 28), cytochrome P450_3 (P450_3; SEQ ID NO: 7 or 29), cytochrome P450_4 (P450_4; SEQ ID NO: 8 or 30), and uracil dependent glucosyl transferase - 4 (UGT_4; SEQ ID NO: 17 or 39) (claim 4); wherein the at least one targeted modification in the at least one endogenous terpene or terpenoid biosynthetic gene is non-naturally occurring (claim 5); wherein the plant is not exclusively obtained by means of an essentially biological process (claim 6); wherein the modified tomato plant further comprises a heterologous terpene or terpenoid biosynthetic gene (claim 7); wherein the heterologous terpene or terpenoid biosynthetic gene is expressed in the tomato fruit (claim 8); wherein the heterologous terpene or terpenoid biosynthetic gene comprises a heterologous terpene synthase, cytochrome P450, uracil dependent glucosyl transferase, or a combination thereof (claim 9); a modified tomato plant cell containing a chromosome comprising the targeted modification(s) in the at least one terpene or terpenoid biosynthetic gene of claim 3 (claim 11); and a tissue culture of regenerable cells comprising the modified tomato plant cell of claim 11 (claim 12). With regard to claim 1, it is noted that the specification discloses that Psy1 is an endogenous terpene or terpenoid biosynthetic gene (see, for example, Table 1) and that carotenoids are tetraterpenes (see, for example, page 18, Table 2). D’Ambrosio et al teach modified tomato plants comprising at least one targeted modification in at least one endogenous terpene or terpenoid biosynthetic gene. See, for example, page 369, first column, first paragraph and second column, first paragraph where it teaches targeted CRISPR/Cas9 modifications to endogenous carotenoid biosynthetic genes, including Psy1 and CrtR-b2. See, for example, page 370, second column, last paragraph to page 371, bridging paragraph and Table 1 where it teaches tomato plants with modified genes edited by CRISPR/Cas9. Thus, D’Ambrosio et al teach or imply the limitation of the targeted modification comprising an insertion, replacement and/or deletion of one or more nucleotides in the gene. With regard to the limitation of decrease of expression in the endogenous terpene or terpenoid biosynthetic gene resulting in depletion of carotene compounds, Gady et al teach that mutant tomato plants carrying the Psy1 knockout allele have no carotenoid accumulation in ripening fruit. See, for example, page 802, second column, last paragraph to page 803, bridging paragraph where it teaches that suppression of PSY1 activity is sufficient to stop the accumulation and synthesis of phytoene and also of the downstream compounds of the carotenoid pathway. With regard to claim 2, D’Ambrosio et al teach phytoene synthase. See, for example, page 369, first column, first paragraph were it teaches CRISPR/Cas9 tested on the phytoene synthase 1 (Psy1). With regard to claim 5, D’Ambrosio et al teach non-naturally occurring gene. See, for example, page 372, Figure 1 where it depicts flower and fruit phenotypes of different genotype classes wherein the flower and fruit have edited genes. With regard to claim 6, D’Ambrosio et al teach tomato plants that are not exclusively obtained by means of an essentially biological process. See, for example, page 369, second column, last paragraph to page 370, bridging paragraph where it teaches tomato plants were genetically transformed. With regard to claims 7-8, D’Ambrosio et al teach a modified tomato plant comprising a heterologous terpene or terpenoid biosynthetic gene wherein the gene is expressed in the tomato fruit. See, for example, page 372, Figure 1 where it teaches modified tomato plants with edited alleles. D’Ambrosio et al and Gady et al do not teach the limitation of claim 9; however, one of ordinary skill in the art would have been able to modify the combined teachings that teach phytoene synthase 1 gene modification to produce modified tomatoes having other heterologous terpene or terpenoid biosynthetic genes. D’Ambrosio et al and Gady et al do not teach the limitations of claims 3, 4, 11 and 12. With regard to claims 3-4, Cermak et al teach a gene sequence (SEQ ID NO: 342) which is 100% identical to SEQ ID NO:1 (see sequence search attached at the end of this Office Action). Cermak et al teach modifying genes of SEQ ID NO: 342 to manipulate traits in tomato plants. See, for example, columns 109-112. See Table 5, column 133 where it discloses that SEQ ID NO: 342 (i.e., SEQ ID NO: 1 in the instant application) is gene PSY1. With regard to claims 11-12, plant cells are inherent to tomato plant and therefore the combined teachings would inherently read on the limitations. In conclusion, it would have been obvious to one of ordinary skill in the art at the time of the invention to modify the endogenous Psy1 gene of the tomato plants of D’Ambrosio et al using the disclosed CRISPR/Cas9 methodology to decrease Psy1 expression, as taught Gady et al, because reduction of PSY1 activity was known to reduce or eliminate carotenoid accumulation in tomato fruit. One of ordinary skill in the art would have had a reasonable expectation of success because the cited references demonstrate successful targeted CRISPR/Cas9 modification of endogenous Psy1 in tomato and the predictable yellow flesh phenotype resulting from reduction or elimination of PSY1 activity. In addition, one of ordinary skill in the art would have been motivated to modify SEQ ID NO: 1 based on the teachings of Cermak et al. Thus, the combination of the cited teachings would have resulted in a modified tomato plant having a targeted modification in an endogenous terpene/terpenoid biosynthetic gene resulting in decreased expression or function of the gene, wherein the decrease results in depletion of carotenoid compounds. Conclusion No claims are allowed. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEITH O. ROBINSON whose telephone number is (571)272-2918. The examiner can normally be reached Monday - Friday, 9:00 a.m. - 5:30 p.m. EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic, can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEITH O. ROBINSON/Primary Examiner, Art Unit 1661 RESULT 2 BOY97765 (NOTE: this sequence has 1 duplicate in the database searched. See complete list at the end of this report) ID BOY97765 standard; DNA; 7044 BP. XX AC BOY97765; XX DT 02-MAY-2024 (first entry) XX DE Solanum lycopersicum PSY1 coding DNA, SEQ ID 342. XX KW Genome editing; PSY1 gene; abiotic stress tolerance; coding sequence; KW crop improvement; ds; flowering; genetically modified plant; KW photosynthesis; plant; senescence. XX OS Solanum lycopersicum. XX CC PN US11926835-B1. XX CC PD 12-MAR-2024. XX CC PF 29-JAN-2019; 2019US-00261233. XX PR 29-JAN-2018; 2018US-0623481P. XX CC PA (INAR-) INARI AGRIC TECHNOLOGY INC. XX CC PI Kock MA, Casey JP, Unson MMD, Sosso D, Shultz RW, Raji JA; CC PI Nuccio ML, Niu Y, Konecna E, Flavell RB, Cermak,t; XX DR WPI; 2024-25871X/023. DR P-PSDB; BOY98106. XX CC PT Providing modified tomato cell having modified genome involves effecting CC PT targeted modification in genes in genome of tomato cell, where CC PT modifications comprise insertion of predetermined sequence encoded by CC PT single-stranded DNA donor molecule, and predetermined sequence comprises CC PT an enhancer element. XX CC PS Example 39; SEQ ID NO 342; 74pp; English. XX CC The present invention relates to a novel method for providing a modified CC tomato cell having a modified genome by effecting targeted modifications CC in at least two genes in the genome of the tomato cell. The targeted CC modifications comprise an insertion of a predetermined sequence encoded CC by a single-stranded DNA donor molecule, wherein the predetermined CC sequence comprises an enhancer element. Each targeted modification is CC achieved by integrating the predetermined sequence comprising the CC enhancer element by non-homologous end joining (NHEJ) at one or more site CC -specific double-strand breaks (DSBs) introduced at about 50 to about 500 CC nucleotides upstream of the start codon of the coding sequence of the two CC genes. The targeted modifications are effected in a tomato cell by site- CC specific effector molecules comprising at least one CRISPR nuclease and CC at least one guide RNA. The targeted modifications result in an increase CC in expression of the first gene and an increase in expression of the CC second gene relative to a tomato cell lacking the modifications, where CC the gene can be selected from SEQ ID NO: 427 (see BOY97850), SEQ ID NO: CC 429 (see BOY97852) and SEQ ID NO: 771 (see BOY98192), wherein the at CC least two genes are associated with the same trait and the trait is CC selected from the group consisting of abiotic stress, architecture, CC biotic stress, flowering time, nutrient use efficiency, photosynthesis, CC resource partitioning and senescence. The method further comprises CC growing or regenerating a modified tomato plant from the modified tomato CC cell. The method of the present invention is used for editing two or more CC endogenous tomato genes by insertion of one or more single stranded DNA CC donor molecules that are not homologous to the insertion sites in the CC tomato genome, wherein the modification improves the trait in a tomato CC cell comprising the targeted modifications relative to a tomato cell CC having an unmodified genome, or in a tomato plant grown from or CC comprising a tomato cell comprising the modifications relative to a CC tomato plant lacking the modifications. XX SQ Sequence 7044 BP; 2238 A; 1057 C; 1263 G; 2486 T; 0 U; 0 Other; Query Match 100.0%; Score 3888; Length 7044; Best Local Similarity 100.0%; Matches 3888; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAGTCAAGAAACAGGTTACTCCTGTTTGAGTGAGGAAAAGTTGGTTTGCCTGTCTGTGGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2307 AAGTCAAGAAACAGGTTACTCCTGTTTGAGTGAGGAAAAGTTGGTTTGCCTGTCTGTGGT 2366 Qy 61 CTTTTTATAATCTTTTTCTACAGAAGAGAAAGTGGGTAATTTTGTTTGAGAGTGGAAATA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2367 CTTTTTATAATCTTTTTCTACAGAAGAGAAAGTGGGTAATTTTGTTTGAGAGTGGAAATA 2426 Qy 121 TTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTAAGTAAAGTTTGGAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2427 TTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTAAGTAAAGTTTGGAA 2486 Qy 181 GGTGACAAAAAGAAAGACAAAAATCTTGGAATTGTTTTAGACAACCAAGGTTTTCTTGCT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2487 GGTGACAAAAAGAAAGACAAAAATCTTGGAATTGTTTTAGACAACCAAGGTTTTCTTGCT 2546 Qy 241 CAGAATGTCTGTTGCCTTGTTATGGGTTGTTTCTCCTTGTGACGTCTCAAATGGGACAAG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2547 CAGAATGTCTGTTGCCTTGTTATGGGTTGTTTCTCCTTGTGACGTCTCAAATGGGACAAG 2606 Qy 301 TTTCATGGAATCAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCATAGGAATTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2607 TTTCATGGAATCAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCATAGGAATTT 2666 Qy 361 GGTGTCCAATGAGAGAATCAATAGAGGTGGTGGAAAGCAAACTAATAATGGACGGAAATT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2667 GGTGTCCAATGAGAGAATCAATAGAGGTGGTGGAAAGCAAACTAATAATGGACGGAAATT 2726 Qy 421 TTCTGTACGGTCTGCTATTTTGGCTACTCCATCTGGAGAACGGACGATGACATCGGAACA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2727 TTCTGTACGGTCTGCTATTTTGGCTACTCCATCTGGAGAACGGACGATGACATCGGAACA 2786 Qy 481 GATGGTCTATGATGTGGTTTTGAGGCAGGCAGCCTTGGTGAAGAGGCAACTGAGATCTAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2787 GATGGTCTATGATGTGGTTTTGAGGCAGGCAGCCTTGGTGAAGAGGCAACTGAGATCTAC 2846 Qy 541 CAATGAGTTAGAAGTGAAGCCGGATATACCTATTCCGGGGAATTTGGGCTTGTTGAGTGA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2847 CAATGAGTTAGAAGTGAAGCCGGATATACCTATTCCGGGGAATTTGGGCTTGTTGAGTGA 2906 Qy 601 AGCATATGATAGGTGTGGTGAAGTATGTGCAGAGTATGCAAAGACGTTTAACTTAGGTTA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2907 AGCATATGATAGGTGTGGTGAAGTATGTGCAGAGTATGCAAAGACGTTTAACTTAGGTTA 2966 Qy 661 GCTTCTTCAATCTATTCATTCGTTTACCAAATATTATTTGGTAAGCACTAATTATGAATA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2967 GCTTCTTCAATCTATTCATTCGTTTACCAAATATTATTTGGTAAGCACTAATTATGAATA 3026 Qy 721 TATATATGTTCATGTTATTGATGAAGACAAAATTTGATCTTTGTTTGTTTATTCAGGAAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3027 TATATATGTTCATGTTATTGATGAAGACAAAATTTGATCTTTGTTTGTTTATTCAGGAAC 3086 Qy 781 TATGCTAATGACTCCCGAGAGAAGAAGGGCTATCTGGGCAATATATGGTGAGGTTTCTAG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3087 TATGCTAATGACTCCCGAGAGAAGAAGGGCTATCTGGGCAATATATGGTGAGGTTTCTAG 3146 Qy 841 CCATTTAATAACAGTTACGCGCACAAACACATATGATTAATCGGGGACGAGAAAAAAAGA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3147 CCATTTAATAACAGTTACGCGCACAAACACATATGATTAATCGGGGACGAGAAAAAAAGA 3206 Qy 901 AATGAAGTTTGAGTTTTGAGGGTCATATGTAATAGGTAAATCCGAGCTTGACTAGCTTGA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3207 AATGAAGTTTGAGTTTTGAGGGTCATATGTAATAGGTAAATCCGAGCTTGACTAGCTTGA 3266 Qy 961 GATGTTTATTGTCATATCATGCTCAATACTAACCAAAACACTGAAAAAGAACTTGATTAT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3267 GATGTTTATTGTCATATCATGCTCAATACTAACCAAAACACTGAAAAAGAACTTGATTAT 3326 Qy 1021 ATTTACATACTAATATTTTCATTTGCGTTGCTGTTCACATTTTTACCTATGGAACTGGTT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3327 ATTTACATACTAATATTTTCATTTGCGTTGCTGTTCACATTTTTACCTATGGAACTGGTT 3386 Qy 1081 TTTGTGATTTGTTATACTTCATATTCGATGTTAATAAAATATATCATTCCTCCCTTTTTC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3387 TTTGTGATTTGTTATACTTCATATTCGATGTTAATAAAATATATCATTCCTCCCTTTTTC 3446 Qy 1141 TCCACTTCAAGCTTTACTGTAGTGTTGAAAGGGGAAACTCCTTTTAATGATTGCATATAT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3447 TCCACTTCAAGCTTTACTGTAGTGTTGAAAGGGGAAACTCCTTTTAATGATTGCATATAT 3506 Qy 1201 AAACGAACTTCTTGAGTTGAATAGTTTCTCATTATGATCTGTTTAAACAGTATGGTGCAG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3507 AAACGAACTTCTTGAGTTGAATAGTTTCTCATTATGATCTGTTTAAACAGTATGGTGCAG 3566 Qy 1261 AAGAACAGATGAACTTGTTGATGGCCCAAACGCATCATATATTACCCCGGCAGCCTTAGA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3567 AAGAACAGATGAACTTGTTGATGGCCCAAACGCATCATATATTACCCCGGCAGCCTTAGA 3626 Qy 1321 TAGGTGGGAAAATAGGCTAGAAGATGTTTTCAATGGGCGGCCATTTGACATGCTCGATGG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3627 TAGGTGGGAAAATAGGCTAGAAGATGTTTTCAATGGGCGGCCATTTGACATGCTCGATGG 3686 Qy 1381 TGCTTTGTCCGATACAGTTTCTAACTTTCCAGTTGATATTCAGGTTAGTCTACCAATTCT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3687 TGCTTTGTCCGATACAGTTTCTAACTTTCCAGTTGATATTCAGGTTAGTCTACCAATTCT 3746 Qy 1441 ATGGTCTTTATATTTGTTCAATTTGCGTTTGATGTCACTTTTGCTGAGGGCTTTTCTAAT 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3747 ATGGTCTTTATATTTGTTCAATTTGCGTTTGATGTCACTTTTGCTGAGGGCTTTTCTAAT 3806 Qy 1501 AGCTTACTTCAGCCTAGCGGAAATGTTTGTAGTTGAATCTCTAGTTCTGTCTCCTATATC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3807 AGCTTACTTCAGCCTAGCGGAAATGTTTGTAGTTGAATCTCTAGTTCTGTCTCCTATATC 3866 Qy 1561 TGTTTCTCTCGTCCTAGATACTACACATACTTCATTTCTGTTTTAACATTTTATTCGTCT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3867 TGTTTCTCTCGTCCTAGATACTACACATACTTCATTTCTGTTTTAACATTTTATTCGTCT 3926 Qy 1621 TTTGGTGTTGTTTTGTATGTGAATCATATATTTGGAACAGAATCATTATTAGTTCACATG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3927 TTTGGTGTTGTTTTGTATGTGAATCATATATTTGGAACAGAATCATTATTAGTTCACATG 3986 Qy 1681 ATTTCATTTGCTTTCTTCAATAGCGTAATTGTCTAACCTTCCAATATATGTTGCAGCCAT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3987 ATTTCATTTGCTTTCTTCAATAGCGTAATTGTCTAACCTTCCAATATATGTTGCAGCCAT 4046 Qy 1741 TCAGAGATATGATTGAAGGAATGCGTATGGACTTGAGAAAATCGAGATACAAAAACTTCG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4047 TCAGAGATATGATTGAAGGAATGCGTATGGACTTGAGAAAATCGAGATACAAAAACTTCG 4106 Qy 1801 ACGAACTATACCTTTATTGTTATTATGTTGCTGGTACGGTTGGGTTGATGAGTGTTCCAA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4107 ACGAACTATACCTTTATTGTTATTATGTTGCTGGTACGGTTGGGTTGATGAGTGTTCCAA 4166 Qy 1861 TTATGGGTATCGCCCCTGAATCAAAGGCAACAACAGAGAGCGTATATAATGCTGCTTTGG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4167 TTATGGGTATCGCCCCTGAATCAAAGGCAACAACAGAGAGCGTATATAATGCTGCTTTGG 4226 Qy 1921 CTCTGGGGATCGCAAATCAATTAACTAACATACTCAGAGATGTTGGAGAAGAGTAAGTAC 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4227 CTCTGGGGATCGCAAATCAATTAACTAACATACTCAGAGATGTTGGAGAAGAGTAAGTAC 4286 Qy 1981 AAAGCTGTGTTTTACGCACATAATTTTTTTTGCTAATATTTACATATCAAAATATAGGAA 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4287 AAAGCTGTGTTTTACGCACATAATTTTTTTTGCTAATATTTACATATCAAAATATAGGAA 4346 Qy 2041 AATGAGCTCTTCGGTTATCCGGTTTATATTTTTTTTATGTCAACATAATAGTATAAAGTA 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4347 AATGAGCTCTTCGGTTATCCGGTTTATATTTTTTTTATGTCAACATAATAGTATAAAGTA 4406 Qy 2101 ATTAGTATCAGTCGTTCTGGGAATAAAATTGCAGAACTCAATTTAGCCGTGTTGTGAAAT 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4407 ATTAGTATCAGTCGTTCTGGGAATAAAATTGCAGAACTCAATTTAGCCGTGTTGTGAAAT 4466 Qy 2161 CCTGCTTGTTTTGAGAGCTTAAAGCTCATTAGTTAGTCGTTAGAGACGAAGAAATTCTTC 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4467 CCTGCTTGTTTTGAGAGCTTAAAGCTCATTAGTTAGTCGTTAGAGACGAAGAAATTCTTC 4526 Qy 2221 GTTGTCCATCTTTATTCCACCTTAAAGTTGTGATATTTTCATTATTGGTACATTTGGCAA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4527 GTTGTCCATCTTTATTCCACCTTAAAGTTGTGATATTTTCATTATTGGTACATTTGGCAA 4586 Qy 2281 AAACACCTGAACAAATTTATGACGGATGCCTTTTGAAAGTCACTATACCTGTCTAGTCGG 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4587 AAACACCTGAACAAATTTATGACGGATGCCTTTTGAAAGTCACTATACCTGTCTAGTCGG 4646 Qy 2341 CGTTTATCACATTTCTTTGACATATTGAACTTTGAAACATGATATCAGCTCTAGACAGTG 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4647 CGTTTATCACATTTCTTTGACATATTGAACTTTGAAACATGATATCAGCTCTAGACAGTG 4706 Qy 2401 ACGAGCCATGATCAATTTCTTTCCTTTATTCTTTCTTTGGAAGTGCCGTATTTAGGCTTC 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4707 ACGAGCCATGATCAATTTCTTTCCTTTATTCTTTCTTTGGAAGTGCCGTATTTAGGCTTC 4766 Qy 2461 CGTTGTTCTTATATATTGCTTTCCCTGCAGTGCCAGAAGAGGAAGAGTCTACTTGCCTCA 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4767 CGTTGTTCTTATATATTGCTTTCCCTGCAGTGCCAGAAGAGGAAGAGTCTACTTGCCTCA 4826 Qy 2521 AGATGAATTAGCACAGGCAGGTCTATCCGATGAAGATATATTTGCTGGAAGGGTGACCGA 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4827 AGATGAATTAGCACAGGCAGGTCTATCCGATGAAGATATATTTGCTGGAAGGGTGACCGA 4886 Qy 2581 TAAATGGAGAATCTTTATGAAGAAACAAATACATAGGGCAAGAAAGTTCTTTGATGAGGC 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4887 TAAATGGAGAATCTTTATGAAGAAACAAATACATAGGGCAAGAAAGTTCTTTGATGAGGC 4946 Qy 2641 AGAGAAAGGCGTGACAGAATTGAGCTCAGCTAGTAGATTCCCTGTAAGCATTCGTAAACT 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4947 AGAGAAAGGCGTGACAGAATTGAGCTCAGCTAGTAGATTCCCTGTAAGCATTCGTAAACT 5006 Qy 2701 CTTTAGTTTTATGAAATGATTCTTTTTTCGCGTTATTAGATGAATATGGTTGCTTGTGTT 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5007 CTTTAGTTTTATGAAATGATTCTTTTTTCGCGTTATTAGATGAATATGGTTGCTTGTGTT 5066 Qy 2761 GAGTATTTCTAGGTCGATGAAGTTGAGACAAGGGTTTTTAAGTTTTAACGACTTTTACGG 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5067 GAGTATTTCTAGGTCGATGAAGTTGAGACAAGGGTTTTTAAGTTTTAACGACTTTTACGG 5126 Qy 2821 GGTGCCATGTTATCTGCTACCTAATCTTAGGTAGTTGACCGGAAGGGCTAGAATTTTAAC 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5127 GGTGCCATGTTATCTGCTACCTAATCTTAGGTAGTTGACCGGAAGGGCTAGAATTTTAAC 5186 Qy 2881 CTCATGTTCACCCTACCAACCAAGAAATGAACCTCGCATAGAGCTCGTAGTTATGAATAT 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5187 CTCATGTTCACCCTACCAACCAAGAAATGAACCTCGCATAGAGCTCGTAGTTATGAATAT 5246 Qy 2941 TTGCTTTGGCATGACATTGTGCGGATCATGAAATGTCTTAGATTATATGGAAAAATCATT 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5247 TTGCTTTGGCATGACATTGTGCGGATCATGAAATGTCTTAGATTATATGGAAAAATCATT 5306 Qy 3001 CTATTACATCGAATAGATACATTAGATCTAAGAAGCACGCCGTGTTGTAAATGAGAAATT 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5307 CTATTACATCGAATAGATACATTAGATCTAAGAAGCACGCCGTGTTGTAAATGAGAAATT 5366 Qy 3061 CTATAGCTCAGATCTTTAGTTTTCTCTGAACGACCTACAAACCAACGGATAACCTTGTAT 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5367 CTATAGCTCAGATCTTTAGTTTTCTCTGAACGACCTACAAACCAACGGATAACCTTGTAT 5426 Qy 3121 TGAGCTTGTCGTTCTCAGTATTTGCACTAACATTACGTCGTGTGGATCCTGAAATGGCTT 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5427 TGAGCTTGTCGTTCTCAGTATTTGCACTAACATTACGTCGTGTGGATCCTGAAATGGCTT 5486 Qy 3181 GGATTGCTATTATTCTGGATATGGCAAAACCATTTTATTAGTACTAGATATCGAATAACT 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5487 GGATTGCTATTATTCTGGATATGGCAAAACCATTTTATTAGTACTAGATATCGAATAACT 5546 Qy 3241 ACATTTGACCCTACAAGTACCCTGGGTTGGAGTTACAATATCCCATACCTCGTATCTTTA 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5547 ACATTTGACCCTACAAGTACCCTGGGTTGGAGTTACAATATCCCATACCTCGTATCTTTA 5606 Qy 3301 GTGTTCTCTTATTTATCACCTTTGTCTACTATTCTGGCAAAATAACCTCACTCGTTACTC 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5607 GTGTTCTCTTATTTATCACCTTTGTCTACTATTCTGGCAAAATAACCTCACTCGTTACTC 5666 Qy 3361 GGTGTTTTCCAGGTATGGGCATCTTTGGTCTTGTACCGCAAAATACTAGATGAGATTGAA 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5667 GGTGTTTTCCAGGTATGGGCATCTTTGGTCTTGTACCGCAAAATACTAGATGAGATTGAA 5726 Qy 3421 GCCAATGACTACAACAACTTCACAAAGAGAGCATATGTGAGCAAATCAAAGAAGTTGATT 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5727 GCCAATGACTACAACAACTTCACAAAGAGAGCATATGTGAGCAAATCAAAGAAGTTGATT 5786 Qy 3481 GCATTACCTATTGCATATGCAAAATCTCTTGTGCCTCCTACAAAAACTGCCTCTCTTCAA 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5787 GCATTACCTATTGCATATGCAAAATCTCTTGTGCCTCCTACAAAAACTGCCTCTCTTCAA 5846 Qy 3541 AGATAAAGCATGAAATGAAGATATATATATATATATATATAGCAATATACATTAGAAGAA 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5847 AGATAAAGCATGAAATGAAGATATATATATATATATATATAGCAATATACATTAGAAGAA 5906 Qy 3601 AAAAAGGAAGAAGAAATGTTGTTGTATTGATATAAATGTATATCATAAATATTAGGTTGT 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5907 AAAAAGGAAGAAGAAATGTTGTTGTATTGATATAAATGTATATCATAAATATTAGGTTGT 5966 Qy 3661 AGTAACATTCAATATAATTATCTCTTGTAGTTGTTGTATCTTCACTTTATCTCAACTCCT 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5967 AGTAACATTCAATATAATTATCTCTTGTAGTTGTTGTATCTTCACTTTATCTCAACTCCT 6026 Qy 3721 TTGAGAGAACTTTCCGTAGTTATCTGCTTTGCACTTGGTTACTCAGAATTTTACTGTGGG 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6027 TTGAGAGAACTTTCCGTAGTTATCTGCTTTGCACTTGGTTACTCAGAATTTTACTGTGGG 6086 Qy 3781 CATGATAATTGATATACCAAATTCAGTTTTGATTCTATCGAAAAATTTGTTATTACATTT 3840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6087 CATGATAATTGATATACCAAATTCAGTTTTGATTCTATCGAAAAATTTGTTATTACATTT 6146 Qy 3841 TTTTGGGGGGAAAGGAATTATCTCAGATATGACGATTTTACATTTCAA 3888 |||||||||||||||||||||||||||||||||||||||||||||||| Db 6147 TTTTGGGGGGAAAGGAATTATCTCAGATATGACGATTTTACATTTCAA 6194
Read full office action

Prosecution Timeline

Apr 28, 2025
Application Filed
Aug 13, 2026
Non-Final Rejection mailed — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12653181
CONTROL OF RIPENING AND SENESCENCE IN PRE-HARVEST AND POST-HARVEST PLANTS AND PLANT MATERIALS BY MANIPULATING ALTERNATIVE OXIDASE ACTIVITY
3y 0m to grant Granted Jun 16, 2026
Patent PP37445
SEASHORE PASPALUM PLANT NAMED 'UGP 73'
1y 1m to grant Granted May 26, 2026
Patent PP37389
Nectarine Tree Named 'PRIMA DIAMOND 7'
2y 1m to grant Granted Apr 28, 2026
Patent PP37148
Grandiflora Rose Plant Named 'KORdreimela'
11m to grant Granted Dec 16, 2025
Patent PP37140
Scirpus pendulus plant named 'Stars and Stripes'
11m to grant Granted Dec 09, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
92%
Grant Probability
95%
With Interview (+3.8%)
1y 10m (~4m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1377 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month