DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s response filed January 28, 2026 is acknowledged. Claims 73-80, 82-84, 87-89, 92-97, and 103-112 are pending.
Restriction/Election
Applicant’s election of Group I (claims 73-80, 82-84, 87-89, and 103-109) with traverse in the response filed January 28, 2026 is acknowledged. The traversal is on the ground(s) that “there would not be a serious burden on the Office to search and examine all of the pending claims of the application together” because the Inventions are related as product and processes of use. Applicant also argues that the Office has not shown that there is a serious search burden and/or examination burden.
These arguments are not found persuasive. The Office has described that there would be a serious search and/or examination burden despite the relatedness of the Inventions, because the Inventions “are classified in different areas,” and examination would “require unique search queries within at least the classifications,” “as well as unique text searches.” See paragraph 5 of the prior action. For example, examination of the processes would require unique classification and text searches related to the methodological steps and outcomes. The requirement is still deemed proper and is therefore made FINAL. Accordingly, claims 92-97, and 110-112 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention. Claims 73-80, 82-84, 87-89, and 103-109 are under consideration herein.
Priority
Applicant’s priority claims to Application Nos. PCT/CN2022/073415, PCT/CN2023/073456, and 18/730,467 are acknowledged. Examiner notes that no certified copy of Application No. PCT/CN2022/073415 has been received, and no Access Code has been provided.
The disclosure of PCT/CN2022/073415 has been reviewed. Claims 73-80, 82-84, 87-89, and 103-109 under examination find support in Application No. PCT/CN2022/073415. The effective filing date of the claims under examination is January 24, 2022.
Specification
The use of terms which are trade names or marks used in commerce has been noted in this application, e.g., “psiCHECK2” (at least pg. 135, line 29), and “Lipofectamine” (at least pg. 136, line 1). Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. The terms, including the exemplary terms above, should be accompanied by the generic terminology. Furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 78 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 78 recites “an isomannitol residue.” Neither the claim nor specification set forth an explicit definition of “an isomannitol residue,” e.g., by chemical name or structure. The specification provides structures of “exemplary isomannitol residues (imann)” (pg. 78), but does not clearly set forth the required structural features of “an isomannitol residue.” A search for the term “isomannitol” did not uncover any art-recognized substances in CAS SciFinder. The specification also uses the abbreviation “imann” to refer to “isosorbide” (pg. 135, line 21). As shown in Fig. A below, the structures of the specification’s “exemplary isomannitol residues (imann)” appear to correspond to conjugated derivatives of a specific structure (“1,4:3,6-Dianhydro-L-mannitol”), which differs from “isosorbide.” The art provides many additional substances comprising structures similar to the “exemplary isomannitol residues” and isosorbide, e.g., “isomannide.” It is not clear what substances are encompassed by the claim term “an isomannitol residue,” e.g., the specific “exemplary isomannitol residues,” isosorbide, and/or one or more of the substances in Fig. A below, which renders the claim indefinite.
FIGURE A
PNG
media_image1.png
316
614
media_image1.png
Greyscale
Notice to Joint Inventors
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim Rejections - 35 USC § 103 – Brunner in view of Ui-Tei
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 73-77, 83-84, and 103 are rejected under 35 U.S.C. 103 as being unpatentable over Brunner (Brunner et al., WO 2022/079221 A1, published 21 April 2022, effectively filed 15 October 2021) in view of Ui-Tei (Ui-Tei et al., 2004, Nucleic Acids Research, Vol. 32, No. 3, pg. 936-948)
Regarding claim 73, Brunner teaches a dsRNA agent for inhibiting apolipoprotein (a) (LPA) gene expression (“Sequences of LPA siRNA constructs”), wherein the dsRNA agent comprises a sense strand and antisense strand, each no more than 23 nucleotides in length, wherein the sense strand comprises the nucleotide sequence “AGAGUUAUCGAGGCACAUA,” (“SEQ 62”) and the antisense strand comprises the nucleotide sequence “UAUGUGCCUCGAUAACUCU” (“SEQ 361”)(“CNS T# 0062,” Table 1, pg. 18). Brunner teaches the sequence of the LPA mRNA targeted by the dsRNA agent (“The start (ST) and end (ED) nucleotide positions in NM_005577.2 (SEQ ID NO: 1632) are indicated,” [0065]; “ST 563,” “ED 581,” “CNS T# 0062,” Table 1, pg. 18). As shown in Fig. B below, the sense and antisense strands of Brunner’s dsRNA agent are 19 nucleotides in length, fully complementary to one another, and fully complementary or identical to the target LPA mRNA. With respect to the instantly claimed dsRNA agent, the sense and antisense strands of Brunner’s dsRNA agent are 100% identical to nucleotides 2-20 of instant SEQ ID NOs: 117 and 244, respectively.
FIGURE B
GACAGAGTTATCGAGGCACATACTC nts 560-584 SEQ ID NO: 1632, Brunner
sense strand
AGAGUUAUCGAGGCACAUA SEQ ID NO: 62, Brunner
GAGAGTTATCGAGGCACATAA SEQ ID NO: 117
antisense strand
UAUGUGCCUCGAUAACUCU SEQ ID NO: 361, Brunner
TTATGTGCCTCGATAACTCTC SEQ ID NO: 244
Brunner does not teach a dsRNA comprising the nucleotide sequences of instant SEQ ID NOs: 117 and 244, because as shown in Fig. B above, the sense and antisense strand of Brunner’s dsRNA agent do not comprise the 5’-most and 3’-most nucleotide of instant SEQ ID NOs: 117 and 244, respectively.
However, Brunner teaches dsRNA agents in which the sense and antisense strands are each 21 nucleotides in length (“the sense strand may have 21, 22, 23, or 24 nucleotides… while the antisense strand may have 21 nucleotides,” [0044]). Brunner teaches dsRNA agents which are fully complementary to one another, and comprise a mismatch relative to the LPA target RNA at the 5’-most and 3’-most nucleotide of the antisense strand (“the sense and antisense sequences are substantially or fully complementary to each other,” [0035]; the antisense sequence of the LPA mRNA-targeting dsRNA comprises one or more mismatches to the target sequence… the one or more mismatches are not located in the center region of complementarity… the one or more mismatches are located within… one nucleotide of the 5’ and/or 3’ ends of the region of complementarity,” [0064]). As shown in Fig. C below, the sense and antisense strands of the instantly claimed dsRNA agent, while fully complementary to one another, are mismatched relative to the target LPA mRNA at the 5’-most and 3’-most nucleotide of each strand (see bolded nucleotides).
FIGURE C
GACAGAGTTATCGAGGCACATACTC nts 560-584 SEQ ID NO: 1632, Brunner
5’AGAGUUAUCGAGGCACAUA 3’ SEQ ID NO: 62, Brunner
3’UCUCAAUAGCUCCGUGUAU 5’ SEQ ID NO: 361, Brunner (reverse)
5’GAGAGTTATCGAGGCACATAA 3’ SEQ ID NO: 117
3’CTCTCAATAGCTCCGTGTATT 5’ SEQ ID NO: 244 (reverse)
Brunner teaches the parameters which would result in the instantly claimed dsRNA, but does not appear to provide motivation to modify the dsRNA so as to arrive at the instantly claimed dsRNA.
However, Ui-Tei teaches four design “rules” to prepare a dsRNA agent “capable of inducing highly effective gene silencing in mammalian cells” (Abstract). The rules are I) an A/U base pair at the 5’ end of the antisense strand, II) G/C base pair at the 5’ end of the sense strand, III) at least five A/U residues in the 5’ terminal one-third of the antisense strand, and IV) the absence of any GC stretch more than 9-nts in length (Abstract, pg. 936, right col.; Fig. 2). Ui-Tei teaches that dsRNA agents opposite in features with respect to the first three conditions “bring about little or no gene silencing” (pg. 944-945). As shown in Fig. C above, the instantly claimed dsRNA agent meets each of Ui-Tei’s design rules, including the inclusion of a G/C base pair at the 5’ end of the dsRNA agent with respect to the sense strand, and an A/U base pair at the 5’ end of the agent with respect to the antisense strand.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the dsRNA agent of Brunner using the design rules of Ui-Tei, so as to arrive at the instantly claimed dsRNA. It would have amounted to preparing a dsRNA agent using known design principles, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the instantly claimed dsRNA agent because as evidenced by Brunner and Ui-Tei, design principles for preparing dsRNA agents were known in the art, including designs which comprise mismatched ends relative to the target mRNA, a G/C base pair at the 5’ end relative to the sense strand, and an A/U base pair at the 5’ end of the agent with respect to the antisense strand. The skilled artisan would have had a reasonable expectation that the resulting dsRNA agent would be effective for use in inhibiting LPA gene expression because Brunner describes an effective dsRNA agent (“0059,” Table 1, pg. 18; “siLPA#0059,” Table 5, pg. 107) which overlaps the target region of the dsRNA agent, and because Ui-Tei teaches that dsRNA agents which follow the four design rules are “capable of inducing highly effective gene silencing in mammalian cells.” The skilled artisan would have been motivated to design additional dsRNA agents using the known design principles of Brunner and Ui-Tei in an effort to develop inhibitors of LPA expression for use in diseases associated with elevated Lp(a) and atherosclerosis-promoting lipids as described by Brunner ([0008]).
Regarding claims 74-76, Brunner teaches that all nucleotides in the sense and/or antisense strand are 2’-OMe or 2’-fluoro modified nucleotides (“the sense and antisense sequence of the dsRNA comprise alternating 2’-O-methyl ribonucleotides and 2’-deoxy-2’-fluoro ribonucleotides,” [0085]; These LPA siRNA sequences comprise a fixed pattern of 2’-O-methyl and 2’-fluoro modified nucleotides (Table 1),” [0169]; “0062,” Table 2, pg. 30).
Regarding claim 77, Brunner teaches the sense and/or antisense strand comprise at least 1 phosphorothioate linkage (“a dsRNA of the present disclosure comprises one or more phosphorothioate groups,” [0086]).
Regarding claims 83 and 103, Brunner teaches a composition comprising the dsRNA agent and a pharmaceutically acceptable carrier, wherein the carrier comprises a sodium salt (“The present dsRNAs can be formulated with a pharmaceutically acceptable excipient… saline solution… sodium acetate… sodium lauryl sulfate,” [0126]-[0127]).
Regarding claim 84, Brunner teaches compositions formulated for subcutaneous administration ([0153]).
Claim Rejections - 35 USC § 103 – Brunner and Ui-Tei in view of Li
Claim 80 is rejected under 35 U.S.C. 103 as being unpatentable over Brunner (Brunner et al., WO 2022/079221 A1, published 21 April 2022, effectively filed 15 October 2021) in view of Ui-Tei (Ui-Tei et al., 2004, Nucleic Acids Research, Vol. 32, No. 3, pg. 936-948) as applied to claims 73-77, 83-84, and 103, in further view of Li (Li et al., WO 2018/044350 A1, 18 March 2018).
The teachings of Brunner are described in paragraphs 9-17 above and applied as to claims 73-77, 83-84, and 103 therein. Brunner also teaches that the dsRNA agents may be conjugated to a targeting group, wherein the targeting group comprises three GalNAc derivatives connected via a trivalent branched linker (0120). Brunner teaches the GalNAc derivatives may be attached to the 5’ end of the sense strand ([0120]; [0217]).
Brunner does not teach the targeting group structure of claim 80, or that the dsRNA agent is connected to the targeting group via a phosphorothioate linkage.
However, Li teaches a trivalent GalNAc targeting group (“(NAG37)s”), the structure of which is provided in Fig. D below (pg. 174). Li teaches attaching the targeting group to the 5’ end of a sense strand via a phosphorothioate linkage (“a targeting ligand is linked to a double-stranded RNAi agent via a… phosphorothioate… linking group, at the 5’ end of the terminal nucleoside of the sense strand of the double-stranded RNAi agent,” pg. 36; “the linker is linked to a phosphorothioate,” pg. 37). Li teaches the targeting group follows the structural formula of “Formula II” (pg. 34). Using the terminology of Formula II, (NAG37)s is a trivalent GalNAc-comprising targeting group, that comprises identical “targeting moieties” (solid boxes), “tethers” (dashed boxes), and a similar “linker” (circles) to the instantly claimed targeting group, GLS-15. (NAG37)s and GLS-15 comprise different “branch points” and “linker” moieties (pg. 34). See Fig. E which highlights these differences (dashed circles).
FIGURE D
PNG
media_image2.png
720
960
media_image2.png
Greyscale
FIGURE E
PNG
media_image3.png
720
960
media_image3.png
Greyscale
Li also teaches additional linker groups, having the following structure, in which “V” consists of “piperidine” (pg. 41, lines 11-21). Piperidine is a six-membered ring consisting of five methylene bridges (-CH2-) and one amine bridge (-NH-). The structure below, in which V is piperidine, is substantially identical to the linker of GLS-15.
PNG
media_image4.png
146
262
media_image4.png
Greyscale
Li teaches additional branch points, including branch points which are substantially identical to that of GLS-15 (pg. 43-49; Structures 201-208). The branch point structure of GLS-15 comprises two nitrogen, separated by three methylene, wherein one nitrogen (bottom in Fig. F above) is connected to two tethers, and the other nitrogen (top in Fig. F above) is connected to a tether and the linker. (NAG27)s branch point structure comprises two carbons, separated by an amide and two methylene, wherein one carbon is attached to two tethers, and the other carbon is attached to a tether and the linker. As another example, the branch point structure of Li’s Structure 1010a (pg. 72) comprises a nitrogen and a carbon separated by a carbonyl and two methylene, in which the nitrogen is attached to two tethers, and the carbon is attached to a tether and an amide-containing linker. Taken together, Li teaches GalNAc-comprising targeting groups which, with the exception of the exact branch point and linker structure, meet the structural elements of GLS-15.
MPEP 2144.09(I) states that “A prima facie case of obviousness may be made when chemical compounds have very close structural similarities and similar utilities. “An obviousness rejection based on similarity in chemical structure and function entails the motivation of one skilled in the art to make a claimed compound, in the expectation that compounds similar in structure will have similar properties.” In re Payne, 606 F.2d 303, 313, 203 USPQ 245, 254 (CCPA 1979).”
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the linker and branch point structures of the targeting group disclosed by Li to make the targeting group “GLS-15,” and attached the resulting group to the 5’ end of the sense strand of the dsRNA agent via a phosphorothioate linkage. GLS-15 has very close structural similarities to the GalNAc-containing targeting groups of Li, including identical targeting moieties and tethers, and as described immediately above, highly similar branch point and linker moieties. GLS-15 also has a substantially identical utility to the targeting groups of Li, i.e., targeting of a dsRNA agent to a desired tissue. As evidenced by Li, it was well within the purview of the skilled artisan to design and synthesize GalNAc-containing targeting groups comprising different, but structurally similar, branch point and linker moieties, and to attach GalNAc targeting groups to the 5’ end of the sense strand via a phosphorothioate linkage. Based on the many branch point and linker examples of Li, the skilled artisan would have predicted that structurally similar branch points and linkers, e.g., those of instant GLS-15, would function similarly (i.e., provide a junction for the tethers and linker, and link the targeting group to the dsRNA agent), and result in a functional GalNAc targeting group for attachment to the dsRNA agent. In an effort to develop inhibitors of LPA expression for use in diseases associated with elevated Lp(a) and atherosclerosis-promoting lipids as described by Brunner ([0008]), the skilled artisan would have been motivated to make additional, structurally and functionally similar GalNAc-containing targeting groups to those of Li, and to attach them to the 5’ end of the sense strand of the dsRNA agent as taught by Brunner and Li.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Application No. 18/730,467
Claims 73-80, 82-83, 87, and 105-106 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 8, 38-39, and 73-76 of co-pending Application No. 18/730,467. Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Co-pending claim 8 recites “The dsRNA agent of claim 1, wherein the dsRNA agent comprises a duplex of sequences selected from the group consisting of: … SEQ ID NO: 889 and 893….”
Co-pending claim 73 recites “The dsRNA agent of claim 1, wherein the dsRNA agent comprises a sense strand comprising the nucleotide sequence of SEQ ID NO: 889 and an antisense strand comprising the nucleotide sequence of SEQ ID NO: 893.”
Based on the sequence listings and specifications (see Table 3), instant and co-pending SEQ ID NOs: 889 and 893 are identical in both nucleobase sequence and chemical modifications applied thereto. It is noted that the parenthetical nucleobase sequences, and lowercase/uppercase/* notation recited in the instant claims (and absent in the co-pending claims) appear to merely describe that which is already provided in the sequence listing for instant SEQ ID NOs: 889 and 893. Finally, the structures in the instant claims are identical to the structures provided in the co-pending specification for the chemical groups “Imann” and “GLS-15.”
Accordingly, the species of co-pending dsRNA agent of claims 8 and 73 anticipates the dsRNA agent of instant claims 73-80, which is generic thereto. The co-pending dsRNA agent of claims 8 and 73 also anticipates the dsRNA agent of instant claim 82. The co-pending dsRNA agent of claim 8 anticipates the dsRNA agent of instant claim 105.
Co-pending claims 38-39 are directed to compositions comprising the dsRNA agent and a pharmaceutically acceptable carrier. These claims anticipate instant claims 83, 87, and 106.
Claims 84, 88-89, and 103-104, and 107-109 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 8, 38-39, and 73-76 of co-pending Application No. 18/730,467 in view of Brunner (Brunner et al., WO 2022/079221 A1, published 21 April 2022, effectively filed 15 October 2021). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
The co-pending claims do not recite that “the composition is packaged in a kit…,” or is “formulated for subcutaneous administration” as required of claims 84, 88-89, and 108-109. The co-pending claims also do not recite that the pharmaceutically acceptable carrier “comprises a sodium salt” as required of instant claims 103-104, and 107.
The teachings of Brunner are described in paragraphs 9-17 above. Brunner also teaches kit packaging (“a kit comprising one or more dsRNAs, vectors, or compositions (e.g., pharmaceutical compositions)… bottles, vials, syringes,” [0162]).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have prepared the co-pending compositions with a sodium salt carrier, or as a formulation for subcutaneous administration, or packaged in a kit in view of Brunner. It would have amounted to preparing known co-pending compositions using well known carriers, formulations, or packaging elements, by known means to yield predictable results. The skilled artisan would have been motivated to prepare the compositions as recited in the instant claims, and have had a reasonable expectation of success, because sodium salt carriers, kit packaging, and formulations for subcutaneous administration were well known as evidenced by Brunner, and such preparations would enable delivery and storage for the intended uses recited in the co-pending claims.
Allowable Subject Matter
A thorough search of the prior art failed to uncover any teaching or suggestion of a dsRNA agent comprising a sense and antisense strand, wherein the sense strand comprises or consists of SEQ ID NO: 889, and the antisense strand comprises or consists of SEQ ID NO: 893. Specifically, the prior art renders obvious the nucleobase sequences of SEQ ID NOs: 889 and 893 (which are identical to the nucleobase sequences of SEQ ID NOs: 117 and 244), and some chemical modifications applied thereto as set forth in the sequence listing (i.e., 2’-OMe, 2’-F, phosphorothioate linkages, GLS-15). However, the prior art does not appear to teach or suggest including “Imann” structures in a dsRNA agent, wherein the “Imann” structures are interpreted as recited in instant claims 82 and 105. The dsRNA agents comprising the sense strand set forth in SEQ ID NO: 889, which comprises an Imann structure at its 3’ end, and at the 5’ end between the GLS-15 and 5’-most nucleotide, are free of the prior art considered during examination.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600