Prosecution Insights
Last updated: July 17, 2026
Application No. 19/209,251

TISSUE-SPECIFIC PROMOTER AND USES THEREOF

Non-Final OA §101§102§103§112
Filed
May 15, 2025
Priority
May 23, 2024 — RE 10-2024-0066925
Examiner
JOHNSON, EMILY KATHARINE
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITY OF SEOUL INDUSTRY COOPERATION FOUNDATION
OA Round
1 (Non-Final)
100%
Grant Probability
Favorable
1-2
OA Rounds
1y 7m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 100% — above average
100%
Career Allowance Rate
3 granted / 3 resolved
+40.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 9m
Avg Prosecution
20 currently pending
Career history
27
Total Applications
across all art units

Statute-Specific Performance

§101
3.0%
-37.0% vs TC avg
§103
62.7%
+22.7% vs TC avg
§102
19.4%
-20.6% vs TC avg
§112
9.0%
-31.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 3 resolved cases

Office Action

§101 §102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Applicant’s claim for the benefit of a prior-filed application no. KR10-2024-0066925 filed May 23rd, 2024, under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Examiner notes that a translation of the certified copy is not provided. A translation of the certified copy is required to perfect the claim for foreign benefit. Thus, the current effective filing date for the instant application is May 15th, 2025. Information Disclosure Statement The information disclosure statements (IDSs) submitted on May 15th, 2025, and March 13th, 2026, were considered, initialed, and attached hereto. A signed copy of the list of references cited is included with this Office Action. Status of Claims Claims 1-7 filed May 15th 2025 are pending and examined herein. Claim Objections In claims 4 and 7, “SlIAA9” is used as abbreviation. It is suggested to insert a definition for SlIAA9 without bringing in new matter, immediately before the first appearance of “SlIAA9” in claim 4; and to enclose the appearance of “SlIAA9” in parentheses (in claim 4 only). Claim Interpretation The recitation of “foreign gene” in claims 5-7 is taken to mean any gene that is desired to be expressed in a plant and may be positioned downstream of the promoter in a recombinant plant expression vector, as defined in the instant specification [pg. 13, ¶37]. By the broadest reasonable interpretation, the “foreign gene” may be any gene introduced into the vector, including, but not limited to a gene native to the plant. The recitation of “useful products” is not defined in the instant specification, other than exemplary products [¶24]. Under broadest reasonable interpretation, a gene involved in production of useful products may merely be one used to produce transgenic lines for research. The recitation of “internal tissue” in claim 1 is not defined in the instant specification. This is taken to mean any tissue inside of a plant including any type of vascular tissue, such as xylem or phloem, or ground tissue, such as parenchyma, collenchyma, or sclerenchyma. Regarding claims 4 and 7, it is understood that the comparison of a gene encoding a protein which inhibits expression of SlIAA9, a parthenocarpy-related gene to that of a wild-type, is the same as that which has had its function inactivated compared to that of a wild-type SlIAA9 protein. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claim 5-6 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a product of nature without significantly more. The claims recite a method for producing a transgenic plant that specifically expresses a foreign gene in a fruit and wherein the foreign gene is a gene involved in the production of useful products. Broadest Reasonable Interpretation Claim 5 recites a method for producing a transgenic plant that specifically expresses a foreign gene in a fruit comprising inserting the foreign gene into a recombinant vector comprising a promoter comprising the nucleotide sequence of SEQ ID NO: 1; and transforming a plant with the recombinant vector into which the foreign gene has been inserted. Claim 6 specifies that the foreign gene is a gene involved in the production of useful products. Examiner has interpreted “foreign gene” to mean any gene, including that of the native plant (see claim interpretation above). Further “useful products” may be any product deemed useful in any way, including that of a natural plant. For example, tomatoes produce useful fruit for human consumption. Thus, the method for producing a transgenic plant expressing a foreign gene may be indistinguishable from that of a plant found in nature as the gene can be a native gene. The plant may be used for a useful product, such as animal food. Step 1: Whether the claim is to a statutory category Under Step 1 of the subject matter eligibility test for products and processes, it must be determined if the claim is to a process, machine, manufacture or a composition of matter. In the instant case, claim 5 and 6 are directed to a process. The claims are therefore directed to a statutory category, a product, and according to the broadest reasonable interpretation, it is also a natural product. Step 2A: ‘Directed to a judicial exception’ analysis: Prong One: Does the claim recite an abstract idea, law of nature, or natural phenomenon? Markedly different characteristics can be expressed as the product's structure, function, and/or other properties. Non-limiting examples of characteristics that can determine the presence of a marked difference include biological or pharmacological functions or activities; chemical and physical properties; phenotype, including functional and structural characteristics; and structure and form, whether chemical, genetic, or physical. The Examiner has interpreted the method for producing a transgenic plant that expresses any foreign gene as any plant that expresses a native gene and can be used for useful products, such as food. A plant such as this occurs in nature. Furthermore, Applicant has not provided evidence of a markedly different characteristic of the produced plant and the naturally-occurring counterparts. As such, claims 5 and 6 recite a judicial exception. Under Revised Step 2A, prong 1 of the analysis (determining the Judicial Exceptions), it must be determined if the claim is directed to a law of nature, a natural phenomenon (product of nature) or an abstract idea. In the instant case, the formulation is a naturally occurring product (mixture of cell aggregates and cell aggregate). Because the products are the same as a product of nature, it falls within a judicial exception. Prong Two: Does the claim recite additional elements that integrate the judicial exception into a practical application? Under Step 2A, prong 2 of the analysis, it must be determined whether the claim recites additional elements that integrate the judicial exception into a practical application. In the instant case, the claims fail to recite any additional elements that integrate the judicial into a practical application, and therefore the claims remain directed to a judicial exception invoking further analysis under step 2B. Step 2B: ‘Significantly more’ analysis: Under Step 2B, it must be determined if the claim recites additional elements that amount to significantly more than the judicial exception. In the instant case, claims 5 and 6 fail to recite any additional elements that amount to significantly more than the judicial exception. The term “transgenic” is neither defined in the instant specification nor linked to any structural features that would distinguish the plant from one that is naturally occurring. Therefore, the claims as a whole do not amount to significantly more than the exception. Therefore, claims 5 and 6 are directed to subject matter that is not patent-eligible and are, as a result, rejected under 35 U.S.C. 101. Claim Rejections - 35 USC § 112(a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Scope of Enablement Claims 1-3 and 5-7 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a recombinant vector comprising a promoter that comprises SEQ ID NO: 1 and further comprises a SlIAA9 gene and method for producing a transgenic tomato plant using said vector, does not reasonably provide enablement for a recombinant vector or method for producing any transgenic plant that comprises SEQ ID NO: 1 and any additional foreign gene. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make or use the invention commensurate in scope with these claims. In re Wands lists a number of factors for determining whether or not undue experimentation would be required by one skilled in the art to make and/or use the invention. These factors are: (1) the quantity of experimentation necessary; (2) the amount of direction or guidance presented; (3) the presence or absence of working examples of the invention; (4) the nature of the invention; (5) the state of the prior art; (6) the relative skill of those in the art; (7) the predictability or unpredictability of the art; (8) the breadth of the claim. In re Wands, 858 F.2d 731, 8 USPQ2d 1400 (Fed. Cir. 1988). The claims are broadly directed to a recombinant vector comprising a promoter comprising SEQ ID NO: 1 and any additional gene, as well as a method for producing a transgenic plant that specifically expresses a foreign gene in a fruit or axillary meristem thereof comprising said recombinant vector. The nature of the invention is drawn to a recombinant vector comprising a promoter comprising the nucleotide sequence of SEQ ID NO: 1, as well as a SlIAA9 gene/foreign gene (SEQ ID NO: 4) inserted into the recombinant vector. The method is for producing a transgenic tomato plant that specifically expresses the recombinant vector with the promoter comprising SEQ ID NO: 1 and the SlIAA9 gene. Applicant teaches: A recombinant vector comprising a promoter created from SlMBP3 (Solyco06g064840) further comprising a SlIAA9 amplicon (SEQ ID NO: 4) as the gene/foreign gene transformed by Agrobacterium-mediated transformation into a dwarf cultivar of tomato. SlMBP3 (promoter comprising the nucleotide sequence of SEQ ID NO:1) expressed over the whole developmental course in ovary/fruit tissue. Applicant does not teach: A recombinant vector comprising any gene encoding a protein which inhibits expression of SlIAA9. A method for producing any transgenic plant that specifically comprises or expresses any gene or foreign gene for a “useful product”. The Applicant provides Examples 1-5 detailing transformation of Micro-Tom, a dwarf cultivar of tomato, DNA and RNA extraction, vector construction using promoter fragments of SlMBP3 (Solyc06g064840) and SlIAA9 (Solyc04g076850) amplicon, qRT-PCR for gene expression levels, GUS staining assay for analysis of the promoter activity of SlMBP3, and RNA interference lines with the construct containing the SlMBP3 promoter and SlIAA9 interference. Native promoters have been historically used to modulate transgene expression but come with limitations. Indiscriminate or leaky expression can generate off-target phenotypes and compromise the fitness of the host (Yaschenko, A. et al. 2026. “Synthetic promoter design in plants: integration of computational and experimental approaches.” Front. Plant Sci. 17:1768521. doi: 10.3389/fpls.2026.1768521) [pg. 2, col. 2, ¶1]. Natural tissue-specific promoters are often expressed in several parts of the plant and may possess leaky activity. Additionally, promoter activity can vary across genetic background or species due to availability and concentration of endogenous TFs and the local chromatin in various host organism tissues, making it challenging to target genes in desired expression patterns. The Applicant has not provided sufficient working examples or prophetic examples of a representative number of plant species transformed with the tissue specific promoter comprising the native tomato SlMBP3 sequence. As there is great variability in the broad claim of “a method for producing a transgenic plant”, particularly with the use of a native tomato tissue-specific promoter, the instant disclosure fails to provide sufficient guidance for how to make and/or use the invention as claimed. Further, the gene or foreign gene enabled in the recombinant vector and method for producing a transgenic tomato plant in the instant disclosure is that of the fusion construct of SlMBP3 promoter and SlIAA9 interference transformed into a tomato plant (P19-SlIAA91 line) [¶80]. The broad claim of any gene involved in the production of “useful products” of claim 3, a gene encoding a protein which inhibits expression of SlIAA9 of claims 4 and 7, or a foreign gene of claims 5 and 6, involve a broad scope of applicable genes, the structure and function of which are not disclosed in the instant disclosure. The Applicant only provides a working example for RNAi of SlIAA9, and not any gene encoding a protein which inhibits expression of SlIAA9. IAA9 is a protein belonging to the Aux/IAA9 family of proteins, a major class of auxin-responsive genes (Luo, J. et al. 2018. “Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function.” Int. Jour. of Mol. Sci. 19:259) [Abstract]. IAA9 controls multiple processes mediated by auxin signaling, such as apical dominance, leaf morphogenesis, flower organ development, and fruit set and development [pg. 9, ¶1]. The Aux/IAA proteins are well-known as the early auxin response proteins and participate in auxin signaling with ARF, T1R1/AFB receptors, MPK, and DELLA proteins [pg. 1, ¶1; pg. 2, ¶1]. Thus, a wide array of protein interactions related to IAA9 protein activity occur that could alter SlIAA9 expression. A sufficient number of working or prophetic examples are not provided to remedy the unpredictability of the large scope of genes encoding proteins which may inhibit expression of SlIAA9. Adequate direction was not provided beyond the RNAi lines for inactivation of a SlIAA9 gene created in the examples. Undue experimentation would be required to determine which gene effectively inhibits expression of SlIAA9 without significant off-types or impacts to plant function. The broad claim of a gene involved in the production of “useful products” is also not properly enabled as a “useful product” was not defined in the instant disclosure. Thus, this gene could be any gene as one could interpret any gene to be “useful” in the context of creating a transgenic plant. The Applicant is not enabled to the breadth of genes involved in the production of “useful products”. The instant disclosure does not adequately enable a method for producing any transgenic plant or the use of any gene encoding a protein which inhibits expression of a SlIAA9, and fails to provide one of ordinary skill in the art with sufficient guidance as to how to make or use the invention as claimed. Therefore, given the breadth of the claims, the lack of guidance and working examples, the unpredictability in the art, and the state of the art as detailed above, undue experimentation would be required to make and use the claimed invention, and the invention is thus not enabled throughout the broad scope of the claims. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-3 and 5-6 are rejected under 35 U.S.C. 103 as being unpatentable over Huang, B. et al. (2021). "Interaction of two MADS-box genes leads to growth phenotype divergence of all-flesh type of tomatoes." Nature Communications. 12:6892. https://doi.org/10.1038/s41467-021-27117-7 (as cited in IDS filed 03/13/2026), in view of GenBank: AC216645.2, Solanum lycopersicum chromosome 6 clone C06HBa0026E06, complete sequence, published 01/24/2008 (as cited in IDS filed 03/13/2026). Claim 1 recites a promoter that is specifically expressed in an internal tissue of a fruit of a plant or in an axillary meristem of the plant, the promoter comprising the nucleotide sequence of SEQ ID NO: 1. Claim 2 recites a recombinant vector comprising the promoter of claim 1. Claim 3 recites the recombinant vector of claim 2, further comprising, downstream of the promoter, a gene involved in production of useful products. Claim 5 recites a method for producing a transgenic plant that specifically expresses a foreign gene in a fruit or axillary meristem thereof, the method comprising steps of: inserting the foreign gene into a recombinant vector comprising a promoter comprising the nucleotide sequence of SEQ ID NO: 1; and transforming a plant with the recombinant vector into which the foreign gene has been inserted. Claim 6 recites the method of claim 5, wherein the foreign gene is a gene involved in production of useful products. Regarding claim 1, Huang teaches that control of tomato textural traits can be achieved through MADS-box gene regulation for commercial use [Abstract]. Huang teaches that highly sought All-flesh tomato cultivars are devoid of locular gel and exhibit desired firmness and improved postharvest storage qualities. SlMBP3, in particular, is a master regulator of locular tissue in tomato fruit, influencing locule gel formation by controlling cell cycle and cell expansion genes. SlMBP3 and its closest homolog, SlAGL11, belong to the class D MADS-box family [pg. 2, col. 2, ¶2]. Huang teaches the development of SlMBP3 overexpression lines, the SlMBP3 CDS driven by its native SlMBP3 native promoter or CaMV 35S [pg. 2, col. 2, ¶2]. In situ studies revealed that SlMBP3 expression starts prior to flower pollination and fruit set, and then becomes highest in the locular tissue as it differentiates into a gel and also in the seeds and funiculus throughout fruit development (Fig. 4a) [pg. 4, col. 2, ¶4]. Huang teaches that SlMBP3 displayed consistent expression in the placenta of auxin-induced parthenocarpic fruit (i.e., a promoter that is specifically expressed in an internal tissue of a fruit) (Fig. 4b). These distinctive expression patterns are indicative of specific roles for SlAGL11 and SlMBP3 in seed development and placental tissue differentiation, respectively [pg. 5, col. 1, ¶1]. Use of native, tissue-specific promoters is well known in the art for localization of expression1. Although native promoters can be constrained by their limited strength, Huang teaches that complementation of the SlMBP3-KO lines with either the SlMBP3 CDS driven by its native promoter (proSlMBP3::SlMBP3) or by the CaMV-35S promoter (35S::SlMBP3) resulted in the recovery of a jelly locular tissue exhibiting weak toluidine blue staining pg. 4, col. 2, ¶2]. Regarding claims 2 and 5, Huang teaches that transgenic plants were generated by Agrobacterium-mediated transformation (i.e., a method for producing a transgenic plant) [pg. 12, col. 2, ¶4]. Huang teaches ProSlMBP3 and ProSlAGL11 GUS constructs obtained after amplification of 2,7 kb SlMBP3 promoter fragment and 1,6 kb SlAGL11 promoter fragment, respectively, from tomato genomic DNA and insertion into the pMDC162 vector using the Gateway site-specific recombinational cloning protocols (i.e., a recombinant vector comprising the promoter). As the GUS reporter gene is found in the bacterium E. coli, and used as a visual marker after transformation, this is taken to read on “foreign gene” (i.e., inserting a foreign gene into a recombinant vector comprising a promoter). The pSlMBP3::SlMBP3 construct was built using Golden braid ligation technology [pg. 12, col. 2, 4]. First, domestication steps have been performed as follows, DNA fragments containing the 2,7 kb promoter region of SlMBP3 and the full length CDS of SlMBP3 were amplified and cloned into pUPD2 vectors using the BsmBI restriction enzyme. In step two, the domesticated pSlMBP3, SlMBP3, and Nos terminator part was cloned into pDGBalpha2 vector (SlMBP3-alpha2 vector) using BsaI restriction enzyme. Then, the final construct, containing the Kanamycin resistance gene, was obtained by mixing the SlMBP3-alpha2 vector and Tnos:nptII: Pnos-pDBGalpha1R, into final vector Omega-1 using BsmBI enzyme. Transgenic lines were created from the transgenic plants (i.e., transforming a plant with the recombinant vector into which the foreign gene has been inserted). Regarding claims 3 and 6, Huang teaches that the transgenic plants comprising the foreign gene (GUS reporter gene) were used for GUS staining and assays (i.e., wherein the foreign gene is involved in production of useful products) [pg. 12, col. 2, ¶5]. Given the broadness of “useful products” (see claim interpretation above), the use of the GUS reporter gene indirectly in the development of commercially applicable tomato fruits is taken to read on “wherein the foreign gene is involved in production of useful products.” Additionally, the “wherein” clause of claim 6 provides no patentable weight, as the characteristics (“wherein the foreign gene is a gene involved in production of useful products”) are a direct result of the structure of the foreign gene of the independent claim, absent evidence to the contrary. The discovery of a new use for an old structure based on unknown properties of the structure might be patentable to the discoverer as a process of using. In re Hack, 245 F.2d 246, 248, 114 USPQ 161, 163 (CCPA 1957). However, when the claim recites using an old composition or structure and the "use" is directed to a result or property of that composition or structure, then the claim is anticipated. In re May, 574 F.2d 1082, 1090, 197 USPQ 601, 607 (CCPA 1978) and In re Tomlinson, 363 F.2d 928, 150 USPQ 623 (CCPA 1966). See M.P.E.P. § 2112.02. Huang does not explicitly teach that the promoter comprises the nucleotide sequence of SEQ ID NO:1, however, an NCBI BLAST search revealed GenBank: AC216645.2, Solanum lycopersicum chromosome 6 clone C06HBa0026E06, complete sequence, with 100% sequence match to SEQ ID NO: 1 of the instant application (see alignment below). Score Expect Identities Gaps Strand 3694 bits(2000) 0.0 2000/2000(100%) 0/2000(0%) Plus/Minus Query 1 ATGCAAATAATATAATATGGAAGGTGTGGGTGTAAGGGTGAGATGGAGTGTGTTGAATGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 25266 ATGCAAATAATATAATATGGAAGGTGTGGGTGTAAGGGTGAGATGGAGTGTGTTGAATGA 25207 Query 61 TGGAATGAAATACAAACTTACAAAATTTTTATTATTTTCTACTTTCAGAAATCAtttttt 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 25206 TGGAATGAAATACAAACTTACAAAATTTTTATTATTTTCTACTTTCAGAAATCATTTTTT 25147 Query 121 ttattttttatttttACAAGAAAAGCCATTCTTTATTGTTAAATTATCTTCCTTTTTTGa 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 25146 TTATTTTTTATTTTTACAAGAAAAGCCATTCTTTATTGTTAAATTATCTTCCTTTTTTGA 25087 Query 181 aaaaaaaGATATTGACCAATTTAACATTAAAATTACAGAAAAACACAATCATGTTGCGAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 25086 AAAAAAAGATATTGACCAATTTAACATTAAAATTACAGAAAAACACAATCATGTTGCGAT 25027 Query 241 AATAGAATTGCATAATTCTGTCTTAATTAAGTATAAATCAGCTGACTGAATTCTATGTGG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 25026 AATAGAATTGCATAATTCTGTCTTAATTAAGTATAAATCAGCTGACTGAATTCTATGTGG 24967 Query 301 AACTCAACAAATCAACCCTAACTTTCATTTCAACGTGCGGTTTCACAAAACCCTAAAAAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24966 AACTCAACAAATCAACCCTAACTTTCATTTCAACGTGCGGTTTCACAAAACCCTAAAAAA 24907 Query 361 GTTAAATCTTCACTTTATCTATCAATTGACACTCCATAACGGATTTAGAATTTTAATTCC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24906 GTTAAATCTTCACTTTATCTATCAATTGACACTCCATAACGGATTTAGAATTTTAATTCC 24847 Query 421 ATGAGTTAAGCATTTCTAGATGTTTAGTATTGAGTCAATTATATGTTTGAAGTTATAATT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24846 ATGAGTTAAGCATTTCTAGATGTTTAGTATTGAGTCAATTATATGTTTGAAGTTATAATT 24787 Query 481 CATGTAACTTTGCCTATGAATTTATGCTTCATCAGAAGTTATGATTTCAATTAAACTTGT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24786 CATGTAACTTTGCCTATGAATTTATGCTTCATCAGAAGTTATGATTTCAATTAAACTTGT 24727 Query 541 ATCCTTCCCTATAGATATGATATGAATTTATATCATCGAGTTAAATTACTTCAAGTTTGA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24726 ATCCTTCCCTATAGATATGATATGAATTTATATCATCGAGTTAAATTACTTCAAGTTTGA 24667 Query 601 CGGAAATATTATTCTTAAATTTCAAACAAGTTGATATTGATTATATGAATTTTTACCATG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24666 CGGAAATATTATTCTTAAATTTCAAACAAGTTGATATTGATTATATGAATTTTTACCATG 24607 Query 661 AATTCAGAAGTAGAATTAATATCTATGTTTTTCTTAATTAAACAAAATTAGAGCCCGTTT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24606 AATTCAGAAGTAGAATTAATATCTATGTTTTTCTTAATTAAACAAAATTAGAGCCCGTTT 24547 Query 721 GAATAGGTTTAGTAGTCGGTCAAACCTACTTTTAAATCAATTTTTGACTTCTGAAAGTGT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24546 GAATAGGTTTAGTAGTCGGTCAAACCTACTTTTAAATCAATTTTTGACTTCTGAAAGTGT 24487 Query 781 TAGGCAAATATaaaaagtaactaaaataagttacgaagtgtctgacaaagtaaaaaatga 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24486 TAGGCAAATATAAAAAGTAACTAAAATAAGTTACGAAGTGTCTGACAAAGTAAAAAATGA 24427 Query 841 ctcaaaacaaataaaaaatgatttaaaataagtcaaaaaccaaaaGTAGATCCCCTATTA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24426 CTCAAAACAAATAAAAAATGATTTAAAATAAGTCAAAAACCAAAAGTAGATCCCCTATTA 24367 Query 901 Ctttttattttttgacttaaaagtcatttcattttgattttttatttttaatttaaaagc 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24366 CTTTTTATTTTTTGACTTAAAAGTCATTTCATTTTGATTTTTTATTTTTAATTTAAAAGC 24307 Query 961 tatttttttaAGCCAATCCAGACGGTCTCTTAATATACAGGTCAAACCTCATTAAATAAA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24306 TATTTTTTTAAGCCAATCCAGACGGTCTCTTAATATACAGGTCAAACCTCATTAAATAAA 24247 Query 1021 ATTTAAATATTTGAAAGAAAAGTTTGAGAGATTTTAAACAGCACAAGGGGCATATTAGTC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24246 ATTTAAATATTTGAAAGAAAAGTTTGAGAGATTTTAAACAGCACAAGGGGCATATTAGTC 24187 Query 1081 AAGAAGAAACAAAAATAACACGCTTTGCAATAATTGGTGAAATTTTAGTCTGCAATAAAC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24186 AAGAAGAAACAAAAATAACACGCTTTGCAATAATTGGTGAAATTTTAGTCTGCAATAAAC 24127 Query 1141 AATCCCATAACATCACGTCTGGTTTATATCTGGAAAAAAGCCATTTGAATGTCATTTTCT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24126 AATCCCATAACATCACGTCTGGTTTATATCTGGAAAAAAGCCATTTGAATGTCATTTTCT 24067 Query 1201 TGGCCAGCCATCTCTATTATCTCTCTTCACTTTAATTTTGAGTGATACTTTCTTCGTCCA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24066 TGGCCAGCCATCTCTATTATCTCTCTTCACTTTAATTTTGAGTGATACTTTCTTCGTCCA 24007 Query 1261 TCCGACTCAACACACATCTTTTAAGAAATAATAAATTCGAAGAGTAATTTTATTATATAT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 24006 TCCGACTCAACACACATCTTTTAAGAAATAATAAATTCGAAGAGTAATTTTATTATATAT 23947 Query 1321 CATCAGTCACCCCTATTGGTAACACGTCATCTAAATATTAAAAAGTAAATAAAATGGTAA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 23946 CATCAGTCACCCCTATTGGTAACACGTCATCTAAATATTAAAAAGTAAATAAAATGGTAA 23887 Query 1381 AACATCTCTTGTGTTTTTCAAATTGAATAATTATTTTTAGTATAGTAAACAAGTAAAAAT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 23886 AACATCTCTTGTGTTTTTCAAATTGAATAATTATTTTTAGTATAGTAAACAAGTAAAAAT 23827 Query 1441 AGTCGTAGCTAGGGATAAAGTTAGGGTAAGTAGGGATATAATATAAAAAGAAAGAAAAGC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 23826 AGTCGTAGCTAGGGATAAAGTTAGGGTAAGTAGGGATATAATATAAAAAGAAAGAAAAGC 23767 Query 1501 ATATAAGTATTATGTTTTTTCTTCATTGATCAGTGTACAAATAAGAAGTCTTTGGAAGTT 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 23766 ATATAAGTATTATGTTTTTTCTTCATTGATCAGTGTACAAATAAGAAGTCTTTGGAAGTT 23707 Query 1561 GTGTGAGTTTTCAGAAAGCCTTTGAAGTTCGCCGGAAAATAGCAATATTTTCAATTCAAG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 23706 GTGTGAGTTTTCAGAAAGCCTTTGAAGTTCGCCGGAAAATAGCAATATTTTCAATTCAAG 23647 Query 1621 CCAATCAGGTCTATTACGTTGATATTTTACATAGCATCAAATTTTAGAAAGaaaaaaaTA 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 23646 CCAATCAGGTCTATTACGTTGATATTTTACATAGCATCAAATTTTAGAAAGAAAAAAATA 23587 Query 1681 TATGAAAAAACTTAAATTTCCCATTCTTCCATGCAttttttaaatttttttttttttGCA 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 23586 TATGAAAAAACTTAAATTTCCCATTCTTCCATGCATTTTTTAAATTTTTTTTTTTTTGCA 23527 Query 1741 GATTCTGAAATGTTTCTCTCTGTGTTCATTATGACAAAATTAATTTGTGTTTCGTGTGGA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 23526 GATTCTGAAATGTTTCTCTCTGTGTTCATTATGACAAAATTAATTTGTGTTTCGTGTGGA 23467 Query 1801 ACTAAGTCAAGCTTTAGATCTATCTGCAAATTACATAGGTTATAGAAATATGAAAGATTT 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 23466 ACTAAGTCAAGCTTTAGATCTATCTGCAAATTACATAGGTTATAGAAATATGAAAGATTT 23407 Query 1861 CATTTTTATATCTATCAAGCGCGTGCAttttttttttCTTTTAATCTTTCACTTATTTGA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 23406 CATTTTTATATCTATCAAGCGCGTGCATTTTTTTTTTCTTTTAATCTTTCACTTATTTGA 23347 Query 1921 AAGGGAAGGGTGCTTACTATCTGAGTAACCTCCTCTTGTCACGGAAATTTTGGTTGATCA 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 23346 AAGGGAAGGGTGCTTACTATCTGAGTAACCTCCTCTTGTCACGGAAATTTTGGTTGATCA 23287 Query 1981 ATAAAAGATCTCCTTGAAAC 2000 |||||||||||||||||||| Sbjct 23286 ATAAAAGATCTCCTTGAAAC 23267 Although Huang does not explicitly disclose the 2.7 kb SlMBP3 promoter fragment, according to a NCBI gene search, the SlMBP3 gene is associated with the 6th chromosome (see SlMBP3 localization to the 6th chromosome below). A person skilled in the art could have selected and applied the promoter sequence through routine experimentation. It would have been prima facie obvious to one of ordinary skill in the art at the time of filing to use GenBank: AC216645.2 as an obvious variant in the development of the SlMBP3 native promoter as Huang teaches that the native promoter can provide direct targeting to locular tissue, seeds, and placenta tissue. One would have reasonable expectation of success given that Huang demonstrated complementation of the SlMBP3-KO lines with either the SlMBP3 CDS driven by its native promoter (proSlMBP3::SlMBP3) or by the CaMV-35S promoter (35S::SlMBP3) resulted in the recovery of a jelly locular tissue exhibiting weak toluidine blue staining pg. 4, col. 2, ¶2]. One would be motivated to try this sequence as a promoter as Huang teaches that the study performed with the native SlMBP3 promoter (proSlMBP3::SlMBP3) provides insight into breeding strategies for designing tomato varieties better suited for different commercial needs, such as tomato processing, shelf life extension and reduction of waste [pg. 12, col. 1, ¶1]. PNG media_image1.png 521 976 media_image1.png Greyscale Claims 4 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Huang and GenBank: AC216645.2 as applied to claims 1-3 and 5-6 above, and further in view of Kim, J. et al. (2019). “Genetic engineering of parthenocarpic tomato plants using transient SlIAA9 knockdown by novel tissue-specific promoters.” Nature Research. 9:18871 (as cited in IDS filed 03/13/2026). Examiner notes that the second reference appears to have common inventors J-Seong Kim and Jeongeun Lee. Based on the disclosure with prior public availability date, this reference constitutes prior art under 35 USC § 102(a)(1) and is does not qualify for an exception under 35 USC § 102(b)(A) as the disclosure was outside of the grace period. Claim 4 recites the recombinant vector of claim 2, further comprising, downstream of the promoter, a gene encoding a protein which inhibits expression of SlIAA9, a parthenocarpy- related gene, compared to that of wild type or whose function has been inactivated compared to that of a wild type SlIAA9 protein. Claim 7 recites the method of claim 5, wherein the foreign gene is a gene encoding a protein which inhibits expression of SlIAA9, a parthenocarpy-related gene, compared to that of wild type or whose function has been inactivated compared to that of a wild type SlIAA9 protein. As detailed above, Huang teaches the development of SlMBP3 overexpression lines, the SlMBP3 CDS driven by its native SlMBP3 native promoter or CaMV 35S [pg. 2, col. 2, 2]. SlMBP3 expression starts prior to flower pollination and fruit set, and then becomes highest in the locular tissue as it differentiates into a gel and also in the seeds, funiculus, and placenta [pg. 4, col. 2, ¶4; Fig. 4a & b], thus, the promoter would logically be expressed in an internal tissue. Huang teaches a recombinant vector comprising the promoter, as well as methods for producing a transgenic plant expressing a foreign gene (GUS reporter gene) transformed with the recombinant vector. Huang does not teach that the promoter comprises the nucleotide sequence of SEQ ID NO: 1, however, an NCBI BLST search revealed GenBank: AC216645.2, Solanum lycopersicum chromosome 6 clone C06HBa0026E06, with 100% sequence match to SEQ ID NO: 1 of the instant application. As the SlMBP3 gene is associated with the 6th chromosome and AC216645.2 is a known sequence of chromosome 6, AC216645.2 is an obvious variant for the development of the SlMBP3 native promoter. One would have reasonable expectation of success and motivation to try given that Huang demonstrated complementation of the SlMBP3-KO lines with either the SlMBP3 CDS driven by its native promoter (proSlMBP3::SlMBP3) or by the CaMV-35S promoter (35S::SlMBP3) resulted in the recovery of a jelly locular tissue exhibiting weak toluidine blue staining pg. 4, col. 2, ¶2], and Huang teaches that the native SlMBP3 promoter (proSlMBP3::SlMBP3) provides insight into breeding strategies for designing tomato varieties better suited for different commercial needs, such as tomato processing, shelf life extension and reduction of waste [pg. 12, col. 1, ¶1]. Huang and GenBank: AC216645.2 do not explicitly teach the recombinant vector or the method for producing a transgenic plant further comprising a foreign gene encoding a protein which inhibits expression of SiIAA9, a parthenocarpy-related gene, compared to that of a wild-type, or whose function has been inactivated compared to that of a wild-type SlIAA9 protein. However, Kim teaches parthenocarpic transgenic tomato plants without unwanted vegetative phenotypes using downregulation of SlIAA9 [Abstract]. Kim teaches that parthenocarpy, seedless fruit formation without fertilization, can offer improved fruit set and substitute for artificial pollination [pg. 1, ¶2]. Kim additionally teaches that it can provide advantages to the tomato industry, such as the production of paste and juice without seeds. Fruit initiation is caused by a chain of auxin responsive gene activation by downregulation of the Aux/IAA function [pg. 1, ¶3]. Kim teaches that downregulation of transcription factor SlIAA9 activates parthenocarpic fruit set in Micro-Tom. Kim teaches that the promoter controls where and when the gene is expressed and, although ubiquitous promoters like CaMV 35 S are widely used, they can cause unwanted phenotypes [pg. 2, ¶1-2]. Thus, tissue specific promoter are being used more frequently to target seeds, roots, pollen and petals, etc. Previously developed parthenocarpic tomatoes have been developed using a placental/ovule-specific DefH9 promoter and an iaaM gene, and Kim further teaches recombinant vector construction and transgenic plant lines with novel, specific promoters and a SlIAA9-RNAi construct with a vegetative phenotype similar to the wild-type (i.e., a recombinant vector comprising a gene encoding a protein which inhibits expression of SlIAA9, a parthenocarpy-related gene, compare to that of wild-type; a method for producing a transgenic plant that specifically expresses a foreign gene in a fruit, wherein the foreign gene is a gene encoding a protein which inhibits expression of SlIAA9) [pg. 3, ¶2-3]. As placental/ovule-specific promoters have been demonstrated to be successful in generating parthenocarpic tomatoes, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to use the native SlMBP3 promoter (as taught by Huang and GenBank: AC216645.2) to target placental or seed specific tissues with the SlIAA9 gene as the foreign gene. One would have been motivated to use such a combination because Kim teaches further success with the two native ovule specific promoters in facultative parthenocarpic fruit formation without abnormal vegetative phenotype in transgenic tomato lines than was previously demonstrated with the DefH9 promoter. It would be obvious to try another tissue-specific native promoter targeting placental or seed tissue for parthenocarpic tomato development to further prevent unwanted vegetative phenotypes in the interest of the breeding industry. One would have reasonable expectation of success as both Kim and Huang teach methodology for developing and implementing native promoters in transgenic tomato lines, and the chromosome on which SlMBP3 is localized was previously sequenced. Conclusion No claims allowed. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to EMILY K. JOHNSON whose telephone number is (571)272-5761. The examiner can normally be reached Monday - Friday 7:30 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EMILY K JOHNSON/Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662 1 Villao-Uzho L. et al. (2023, “Plant Promoters: Their Identification, Characterization, and Role in Gene Regulation.” Genes (Basel). 14(6):1226. doi: 10.3390/genes14061226) teaches that tissue specific promoters can direct gene expression in a particular tissue [pg. 4, ¶1-2]. Native genes in particular present a high specificity guaranteeing correct genetic transformation and providing more efficient crops.
Read full office action

Prosecution Timeline

May 15, 2025
Application Filed
Jul 08, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
100%
Grant Probability
99%
With Interview (+0.0%)
2y 9m (~1y 7m remaining)
Median Time to Grant
Low
PTA Risk
Based on 3 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month