NOVEL INSECT INHIBITORY PROTEINS

§103 §112

DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after 16 March 2013, is being examined under the first-inventor-to-file provisions of the AIA . Election/Restrictions A restriction requirement was posted on 3 August 2026. Applicant's elected SEQ ID NO:12 with its two coding sequences, SEQ ID NO:11 and SEQ ID NO:51 in the reply filed on 19 August 2026. Applicant elected without traverse. The requirement is deemed proper and is therefore made FINAL. Claims 1-29 as amended on 29 May 2025 are examined herein. Examiner’s Notes & Claim Interpretation Citations to Applicant’s specification are abbreviated herein “Spec.” Occasionally, “SIN:” is used as an abbreviation “SEQ ID NO:” herein. Claim 1 in part (c) requires hybridization under stringent conditions. The specification defines such conditions at the bottom of page 51. Claim 1 in line 1 recites the limitation “recombinant” and this requires two elements: a promoter and a coding sequence, which are heterologous to each other. Claim Objections Claims 1 and 26-27 are objected to because of the following informality. Claim 1 is objected to because in part (b)(ii) the word “identity” is missing and should follow the % sign. Also in claims 26 and 27. Appropriate correction is requested. Improper Markush Group Claims 1-29 are rejected on the basis that they contain an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a "single structural similarity" and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a "single structural similarity" and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117. The Markush groupings in, for example, claim 1 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use as seen in the following analysis. For example when SEQ ID NO:12 is searched against the Office databases containing the other sequence of this application, SEQ ID NO:109 is less than 60% sequence identical. Paragraph 0174 teaches that SEQ ID NO:12 was identified Brevibacillus laterosporus strain DSC005973. Applicant identified is as TIC7042. The various proteins of the application have different activities. See for example, Tables 4 and 5 on page 59. In paragraph Applicant notes that “Mortality caused by TIC7042 against WCR was very high.” Applicant teachings are that such a diverse group of sequences will function differently with distinct pesticidal activity, e.g. when expressed transgenically in a plant. Therefore the species of the Markush group lack both a substantial structural feature and a common use that flows from the substantial structural feature To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use. Claims depending on the claims reciting an improper Markush group are included in this rejection. Also, this is a divisional application from a family with four issued U.S. Patents each of which focus on one or two amino acid sequences. U.S. Patent Nos. 12,404,520; 11,981,908; 11,225,672; and 10,465,205. Amending the claims to recite only the elected species and/or with the rejoined sequences would obviate the rejection. Claim Rejections - 35 USC§ 112(b) The following is a quotation of 35 U.S.C. 112(b): (B) CONCLUSION.-The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 5. Claim 23 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. Claim 23 is rejected because, in the middle of a large Markush group, it recites the limitation "and the like." The preceding members of the Markush group appear to encompass many different forms of compositions including, for example, "corn flakes." As an example, since corn flakes are a well-known cereal, does the claim encompass other cereals with no corn element? That cannot be determined by the scope of the claim. See MPEP § 2173.05(d), e.g., Ex parte Caldwell, 1906 D.C. 58 (Comm'r Pat. 1906). Also, a broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) is considered indefinite, since the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). Note the explanation given by the Board of Patent Appeals and Interferences in Ex parte Wu, 10 USPQ2d 2031, 2033 (Bd. Pat. App. & Inter. 1989), as to where broad language is followed by "such as" and then narrow language. The Board stated that this can render a claim indefinite by raising a question or doubt as to whether the feature introduced by such language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. Note also, for example, the decisions of Ex parte Steigewald, 131 USPQ 74 (Bd. App. 1961 ); Ex parte Hall, 83 USPQ 38 (Bd. App. 1948); and Ex parte Hasche, 86 USPQ 481 (Bd. App. 1949). Therefore the metes and bounds of the claim cannot be determined. 35 USC § 112(a) based Claim Rejections The following is a quotation of 35 U.S.C. 112(a): The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-29 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. The Federal Circuit held that a written description of an invention "’requires a precise definition, such as by structure, formula [or] chemical name,’ of the claimed subject matter sufficient to distinguish it from other materials." Regents of the Univ. of Cal. v. Eli Lilly & Co., 119 F.3d 1559, 1568, 43 USPQ2d 1398, 1405 (Fed. Cir. 1997) (quoting Fiers v. Revel, 984 F.2d 1164, 1171, 25 USPQ2d 1601, 1606 (Fed. Cir. 1993)). The court also stated "naming a type of material generally known to exist, in the absence of knowledge as to what that material consists of is not a description of that material." Id., 119 F.3d at 1568, 43 USPQ2d at 1406. The court held that “[a] description of a genus of cDNAs may be achieved by means of a recitation of a representative number of cDNAs, defined by nucleotide sequence, falling within the scope of the genus or of a recitation of structural features common to members of the genus, which features constitute a substantial portion of the genus.” Id., 119 F. 3d at 1569, 43 USPQ2d at 1406. Claim 1, after amendment, recites numerous amino acid sequences encoded by the nucleic acid molecule recited in line 1. Claim 1 also reads on variants at varying degrees of sequence identity. For example, part (b)(i) recites 75% and each subpart of (b) requires a higher degree of sequence identity. Claim 26 is similar. Claim 1, part (a) starting at line 4 of the claim through the end of part (a) recites a Markush Group of sequences requiring 100% sequence identity. The subparts of part (b) recite various subgroups of SEQ ID NOs at varying degree of sequence identity. Focusing on SEQ ID NO:12, part (v) requires 93% sequence identity. Dependent claim 2 recites various characteristics of DNA vectors. Dependent claims 3-7 recite various host cells. Dependent claims 8-11 recite various insect toxicities. Dependent claims 12-15 and 25 recite various embodiments of the claimed invention featuring plants and/or plant parts. Dependent claims 16-20 and 21 recite various compositions which may have additional toxin proteins (e.g. claim 20 recites Cry proteins). Dependent claims 22-23 encompass commodity products. Dependent claim 24 is a method of producing a seed. Independent claim 26 is a method of controlling an insect pest using a polypeptide of the genus using the structure recited in claim 1 Claims 27-29 are drawn to detecting the polypeptide or the encoding polynucleotide. The claimed genus includes not only the variants discussed about, but the additionally genera captured by the ‘stringent hybridization’ limitation. It expands the claimed genus. Applicant’s claims read on a large genus of variants SEQ ID NO:12 as well as the other recited sequences and other genes/proteins captured by the ‘stringent hybridization’ limitation. See, for example, the rejection under 35 USC 103 infra. This is discussed further in the written description rejection below. Applicant isolated SEQ ID NO:12 from B. laterosporus strain DSC005973. Spec., para 0174. Applicant defined is as the TIC7042 protein. Id. In Table 1 it is sequence is compared to other proteins of the specification. Id., p. 40. Bioassay results are shown in Tables 4 and 5. Id., p. 59. See also paragraph 0222. Especially, “Mortality caused by TIC7042 against WCR was very high.” In Example 5, beginning on page 63, Applicant describes plant-optimized coding sequences. More results are in Example 5, beginning on page 68. Chimeric proteins in Example 12, page 74 et seq. Although not B. thuringiensis proteins, it is reasonable to apply that extensive art in evaluating the claimed proteins. For example, each delta-endotoxin only has activity against one or few insect species. de Maagd et al. (1999) Appl Environ Microbial 65:4369-74, 4369 (col. 1, para. 1 ). Even conservative substitutions in non-conserved regions can have unexpected effects on protein function. Id., Figs. 2 & 3. Even a single amino acid substitution in a delta endotoxin may alter its insecticidal specificity, and toxicity must be determined empirically. Tounsi et al. (2003) J Appl Microbial 95:23-28, 27. For example, a conservative substitution of a lysine for an arginine in a ry11 A protein eliminated toxicity to A. aegyptii. Angsuthanasombat et al. (2001) J Biochem Mal Biol 34:402-07, 405 (para. spanning cols. 1-2). Additionally, the protein art in general describes that minor changes to a polypeptide's sequence can abolish activity. Olsen et al. reviewed the amino acid backbone changes in three mutants of NAC transcription factors that abolished activity; two were found to be single amino acid substitutions and the third was a dipeptide insertion. Olsen et al. (2005) Trends Plant Sci 10(2):79-87, 84. All of these mutated polypeptides obviously have a high degree of sequence identity to the native polypeptide. Similarly, it is well-known in the prior art that minor sequence variations in pesticidal proteins can change the activity of the toxins. Pardo-Lopez et al. teaches that although Cry proteins have been extensively studied by site-targeted mutagenesis, most of the tested mutations adversely affect the protein’s toxicity. Pardo-Lopez et al. (2009) Peptides 30:589-95, 591-92. Returning to Applicant’s specification, the recited SEQ ID NO:12 amino acid sequence is described in the specification at paragraph 0174. Tables 4 and 5 (page 59) compare this protein to others taught by Applicant’s specification. SEQ ID NO:12’s SEQ ID NO:51 is a molecule with plant-enhanced coding sequence. For example, SEQ ID NO:51 is listed in Table 6 (pp. 63-64). SEQ ID NO:12, for example, is 1,266 amino acids in length. If the first approximately 93% amino acids were held constant, and the remaining 88 (approximately 7%) were varied, this would result in 8820 different variants. However, that is only a small fraction of the number claimed, because different regions could be held constant. Guo et al. describes that while proteins are fairly tolerant to mutations resulting in single amino acid changes, increasing the number of substitutions additively increases the probability that the protein will be inactivated. Guo et al. (2004) Proc Natl Acad Sci USA 101:9205-10, 9209 (rt. col., para. 2). Thus, according to Guo et al., changing up to 88 amino acids in SEQ ID NO:12 has a high likelihood of inactivating the protein. Further, in the delta-endotoxin art, however, there are known to be extensive functional interactions between the three domains of delta-endotoxins, and it is known that more than one domain is involved in toxin specificity and binding. Aronson & Shai (2001) FEMS Microbial Lett 195:1-8, 7 (para. spanning cols. 1-2). Domains II and Ill are involved in insect specificity (de Maagd et al. (2001) Trends Genet 17:193-99, 194 (col. 2, para. 3)), and Domains I and II have co-evolved towards certain specificities. Id., p. 196 (col. 1, para. 2) & p. 197 (col. 1, para. 4). de Maagd et al concludes that the determination of insect specificity of endotoxins is still not understood. Id., p. 198 (col. 2, para. 2). In summary, in contrast to the scope of the claimed genus of polypeptide variants, Applicant only describes the sequences in the application themselves. Even though many of these sequences show sequence similarity, they are not a representative number in comparison to the size of the genus claimed. Instead of a representative number of species, however, Applicant may also satisfy the written description requirement by describing structural features that are necessary and/or sufficient for the claimed invention. In Univ. Calif. v. Lilly, the Federal Circuit discussed the application of the written description requirement to inventions in the field of biotechnology. The court held that "[a] description of a genus of cDNAs may be achieved by means of a recitation of a representative number of cDNAs, defined by nucleotide sequence, falling within the scope of the genus or of a recitation of structural features common to members of the genus, which features constitute a substantial portion of the genus." See Univ. Calif. v. Eli Lilly and Co., 119 F. 3d 1559, 43 USPQ2d 1398, 1406 (Fed. Cir. 1997). Applicant does not provide any analysis of structures of SEQ ID NO:12 that are necessary and sufficient for its particular activity. Returning to the hybridization limitation, Fourgoux-Nicol et al. teaches that substantially non-sequence-identical genes, in terms of overall sequence identity, can be identified by hybridization (e.g., Fig. 2, p. 862) under hybridization conditions (6xSSC at 65°C (page 860) of similar stringency as Applicant's. Fourgoux-Nicol et al. (1999) Plant Mal Biol 40:857-72. Thus the hybridization limitation of claim 1 also encompasses a large genus. Additionally, the US PTO's training materials for written description, published 25 March 2008, states that claims drawn to the genus of nucleic acids that hybridize to a stated nucleic acid fail to satisfy the written description requirement. The reasoning is that, in part, "without a recognized correlation between structure and function, those of ordinary skill in the art would not be able to identify without further testing which of those nucleic acids that hybridize to [the sequence in the example] would also encode", e.g., a polypeptide with the same activity as SEQ ID NO:12. Written Description Training Materials (2008) p. 22. The hybridization limitation is directed at a function that is not necessarily related to the claimed activity. The instant specification fails to adequately describe the claimed genera. Applicant has not described a representative number polypeptides falling within the claims, nor has the specification described structures necessary and/or sufficient for activity in the instant invention to allow one skilled the art to envision the claimed genera, and thus the specification fails to provide an adequate written description of the claimed invention. Given the lack of written description in the specification, one of skill in the art would not recognize that Applicant was in possession of the genera as broadly as claimed. Dependent claims are included in this rejection because none provide limitations obviating this rejection. Claims 1-29 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claims contain subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the full scope of the invention. The Federal Circuit in In re Wands lists eight considerations for determining whether or not undue experimentation would be necessary to practice an invention. In re Wands, 858 F2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988). These factors are: the quantity of experimentation necessary, the amount of direction or guidance presented, the presence or absence of working examples of the invention, the nature of the invention, the state of the prior art, the relative skill of those in the art, the predictability or unpredictability of the art, and the breadth of the claims. Id. Biotechnology is generally held to be an unpredictable art. In re Vaeck, 947 F.2d 488, 496, 20 U.S.P.Q.2d 1438, 1445 (Fed. Cir. 1991 ). The scope of the claims and the extent of the claimed genera is set forth supra in the rejection under the written description requirement and is incorporated by reference here. Again, the art teaches that minor sequence variations in pesticidal proteins can change the activity of the toxins. Pardo-Lopez et al. teaches that although Cry proteins have been extensively studied by site-targeted mutagenesis, most of the tested mutations adversely affect the protein’s toxicity. Pardo-Lopez et al. (2009) Peptides 30:589-95, 591-92. A more thorough review of the teachings in Applicant’s specification and the teachings of the art is above in the written description rejection. That is incorporated by reference there. One of skill in the art, after reading the specification, would be uncertain as to both how to make and how to use the invention as broadly as claimed. One of skill in the art would find it difficult to predict which of the myriad of possibilities would succeed without undue experimentation. Although testing individual sequences can be routine, Applicant has provided no guidance as to how to proceed. Given the claim breadth regarding variant sequences, combined with the unpredictability in the art, and lack of guidance as discussed above, undue experimentation is required to practice Applicant’s invention. Therefore one skilled in the art would be forced to make and test numerous nucleic acids encoding polypeptides related to the ones used in the instant working example with no guidance as to which ones could be used in the instant invention. Thus Applicant’s claimed invention would require undue trial and error experimentation with no reasonable expectation of success. Therefore the specification is not enabled throughout the broad scope of the claims. Dependent claims are included in this rejection because none provide further limitations obviating this rejection. 35 USC § 103-based Claim Rejections In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: § 103. Conditions for patentability; non-obvious subject matter A patent for a claimed invention may not be obtained, . . . . if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims oinse are rejected under 35 U.S.C. 103 as being unpatentable over U.S. Patent Publication No. 2011/0030096 A1; Sampson et al. in view of Larson et al. The factual inquiries set forth in Graham v. John Deere Co. of Kansas City, 383 U.S. 1, 17-18, 148 USPQ 459, 467 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows: a. Determining the scope and contents of the prior art. b. Ascertaining the differences between the prior art and the claims at issue. c. Resolving the level of ordinary skill in the pertinent art. d. Considering objective evidence present in the application indicating obviousness or nonobviousness. As seen in the alignment below, Sampson et al. teaches a coding sequence for a pesticidal protein that is 90.0% identical to the instant coding sequence for the protein SEQ ID NO:12 which is SEQ ID NO:11. An ordinary artisan would interpret this high degree of sequence identity as falling within the scope of part (c) with the two coding sequences being predicted to hybridize under high stringency. See Larson et al. (1990) J Biol Chem 265(12):7055-61 (p. 7056, col. 2, end of smaller print “high stringency” with 82% sequence identity (p. 7057, col. 1, end of 1st full para.)). Both the instant application and Sampson et al. relate to the use of pesticidal proteins to control pest damage to plants. It would have been prima facie obvious to one of ordinary skill in the art as of the effective filing date of the claimed invention to practice the teachings of Sampson et al. Given the level of skill in the art as of the effective filing date of the claimed invention at the time of Applicants' invention, one of ordinary skill in the art would have had a reasonable expectation of success as all steps were routine. Sampson et al.’s claim 1 including its SEQ ID NO:18, mirrors instant claim 1. Sampson et al. claim or para. instant claim 1; nucleic acid molecule 1 6,8,9; express in a plant 2 7,8; host cells 3,6 7+para. 0004 bacterial host cells 5 including B. thuringiensis 10; plants 7,25, 19; insect types + para. 0096 8-11 10; plant parts 12,13,14,15 Abstract 16 para. 0052, 0005 17,18,19,20 para. 0069 21 para. 0082, 0098 22,23 para. 0011 24 para. 0097 26 para. 0035 27,28 para. 0075 29 RESULT 4 US-12-846-900A-18 (NOTE: this sequence has 1 duplicate in the database searched. See complete list at the end of this report) Sequence 18, US/12846900A Publication No. US20110030096A1 GENERAL INFORMATION APPLICANT: Kimberly Sampson APPLICANT: Daniel J. Tomso APPLICANT: Rong Guo TITLE OF INVENTION: AXMI-192 FAMILY OF PESTICIDAL GENES AND TITLE OF INVENTION: METHODS FOR THEIR USE FILE REFERENCE: APA067 US01 CURRENT APPLICATION NUMBER: US/12/846,900A CURRENT FILING DATE: 2010-10-12 PRIOR APPLICATION NUMBER: 61/230,659 PRIOR FILING DATE: 2009-07-31 NUMBER OF SEQ ID NOS: 70 SEQ ID NO 18 LENGTH: 3768 TYPE: DNA ORGANISM: Brevibacillus laterosporus Query Match 90.9%; Score 3455.4; Length 3768; Best Local Similarity 95.2%; Matches 3612; Conservative 0; Mismatches 141; Indels 42; Gaps 3; Qy 4 AATCAGAATCAAAATAAAAATGAAATGCAAATCATAGAACCTTCAAGTGATTCTTTTCTT 63 |||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| Db 16 AATCAGAATCAAAATAAAAATGAACTGCAAATCATAGAACCTTCAAGCGATTCTTTTCTT 75 Qy 64 TATAGTCACAACAATTATCCGTATGCTACTGATCCAGATACAATATTAAAAGGTAGGAAT 123 |||||||||||||||||||||||||| ||||||||| ||||| ||||| ||||||||||| Db 76 TATAGTCACAACAATTATCCGTATGCCACTGATCCAAATACAGTATTACAAGGTAGGAAT 135 Qy 124 TATAAAGAGTGGCTAAATATGTGTACAGATACAGACGATTCACGAAGTCCCGAAGCTGCT 183 || |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| Db 136 TACAAAGAGTGGCTAAACATGTGTACAGGTACAGACGATTCACGAAGTCCCGAAGCTGCT 195 Qy 184 TCTACTGCAAGATCAGCTATTTCTGTTGCGATTACTATAAGCACCACAATTCTTGGCTTA 243 |||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| Db 196 TCTACTGCAAAATCAGCTATTTCAGTTGCGATTACTATAAGCACCACAATTCTTGGCTTA 255 Qy 244 CTAGGTGTTCCGTTTGCATCTCAAATTGGAGCATTTTATAACTTCGTATTGAATACGGTA 303 |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| Db 256 CTAGGTGTTCCGTTTGCATCTCAAATCGGGGCATTTTATAACTTCGTATTGAATACGGTT 315 Qy 304 TGGCCTCAGGGAAATAACCAATGGGAAGAGTTCATGAGACATGTAGAAAATCTCATAAAC 363 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Db 316 TGGCCTCAGGGAAATAACCAATGGGAAGAGTTCATGAGACATGTAGAAGATCTCATAAAC 375 Qy 364 GAACGAATAGCTGATTATGCAAGAGATAAGGCACTTGCAGAATTAACGGGTTTAGGTAAT 423 |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| Db 376 GAACGAATAGCTGATTATGCAAGAAGTAAGGCACTTGCAGAATTAGCGGGTTTAGGTAAT 435 Qy 424 AACTTAAATTTATATAGAGAAGCTTTTGAAGATTGGAGACGAAATCCTACTAGTCAAGAA 483 |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| || Db 436 AACTTAGATTTATATAGAGAGGCTTTTGAAGATTGGAGACGAAATCCTACTAGTCAACAA 495 Qy 484 GCTAAAACCCGTGTAATAGATAGATTCCGTATACTAGATGGTTTATTTGAAACATATATG 543 |||||||||||||||||||| ||||| ||||||||||||||| | |||||| ||||||| Db 496 GCTAAAACCCGTGTAATAGAAAGATTTCGTATACTAGATGGTCTTTTTGAACAATATATG 555 Qy 544 CCTTCATTTGCAGTACGAAATTTTGAAGTACAATTATTAACAGTGTATGCATCCGCTGCA 603 || ||||||||||||| | |||| ||||||||||||||||||||||||||||||||||| Db 556 CCATCATTTGCAGTACAAGGTTTTCAAGTACAATTATTAACAGTGTATGCATCCGCTGCA 615 Qy 604 AATATCCATTTATTTTTATTAAGAGATAGCTCTATTTACGGTTTGGATTGGGGATTAAGT 663 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 616 AATATCCATTTATTTTTATTAAGAGATAGCTCTATTTACGGTTTGGATTGGGGATTAAGT 675 Qy 664 CAAACTAATGTTAACGAAAATTACAATCGCCAAATAAGGCACGCCGCAACGTATGCAAAT 723 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 676 CAAACTAATGTTAACGAAAATTACAATCGCCAAATAAGGCACGCCGCAACGTATGCAAAT 735 Qy 724 CATTGTACAACTTGGTATCAAACTGGTTTACAAAGATTGCAAGGTACCAATGCTACCAGT 783 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 736 CATTGTACAACTTGGTATCAAACTGGTTTACAAAGATTGCAAGGTACCAATGCTACCAGT 795 Qy 784 TGGGTCGCTTATAATAGATTTAGAAGAGAAATGACGTTAACAGTATTAGATATTTGTTCA 843 |||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||| Db 796 TGGGTCGCTTATAATAGATTTAGAAGGGAAATGACATTAACAGTATTAGATATTAGTTCA 855 Qy 844 TTATTTTCAAATTATGATTATCGTAGTTATCCAACAGAGGTAAAGGGAGAGCTTACGAGA 903 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Db 856 TTATTTTCAAATTATGATTATCGTAGTTATCCAACAGAGGTAAGGGGAGAGCTTACGAGA 915 Qy 904 GAAATTTATACGGATCCAGTAGGTAGAAACTGGCAGAATGTTGCACCATCATTCGCTGAA 963 |||||||||||||| |||||||||||||||||||||||| |||||||||||||||| || Db 916 GAAATTTATACGGACCCAGTAGGTAGAAACTGGCAGAATAGTGCACCATCATTCGCTCAA 975 Qy 964 ATAGAAAATCTAACAATTAGGGCACCAAGAACCGTTACTTGGTTAAATTCAACAAGAATT 1023 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Db 976 ATAGAAAATCTAGCAATTAGGGCACCAAGAACCGTTACTTGGTTAAATTCAACAAGAATT 1035 Qy 1024 TTTACAGGGACTTTGACAGGCTGGAGTGGTTCTAACAGATATTGGGCAGCTCACATGCAA 1083 | ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| Db 1036 TCTACAGGGACCTTGCAGGGCTGGAGTGGTTCTAACAGATATTGGGCAGCTCACATGCAA 1095 Qy 1084 AACTTTTCAGAAACCAATTCAGGAAATATAGGATTTGACGGTCCTCAATATGGGTCGACG 1143 |||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| Db 1096 AACTTTTCAGAAACCAATTCAGGAAATATACGATTTGACGGTCCTCTATATGGGTCGACG 1155 Qy 1144 GTAGGTACTATTCATCGTACTGATGATTACGATATGGTGAATCGAGATATTTACACCATT 1203 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Db 1156 GTAGGTACTATTCATCGTACTGATGATTACGATATGGGGAATCGAGATATTTACACCATT 1215 Qy 1204 ACTTCACAAGCTGTTGCCGCCCTTTGGCCAACTGGTCAAACTGTGTTGGGAGTCGCTTCG 1263 |||||| ||| ||||||| |||||||| |||||||||||||||||||||||||||||||| Db 1216 ACTTCAGAAGTTGTTGCCTCCCTTTGGGCAACTGGTCAAACTGTGTTGGGAGTCGCTTCG 1275 Qy 1264 ACTAGATTTACTTTAAGAAACCTTAACAATAATTCTACAGAGGCGCTGGTGTATGAGAAC 1323 ||||||||||||||||||| ||| ||||||| |||| |||||||||||||||||||| Db 1276 GCTAGATTTACTTTAAGAAATCTTTTCAATAATCTTACACAGGCGCTGGTGTATGAGAAC 1335 Qy 1324 GCAATAAGTTCAAGTTTTGTTAGTTCAACTTTAACTCATGAATTACCTGGAGAAAACTCA 1383 ||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| Db 1336 CCAATAAGTTCAAGTTTTAATAGGTCAACTTTAACTCATGAATTACCTGGAGAAAACTCA 1395 Qy 1384 GATAGGCCAACTTCTAGCGACTATAGTCATAGACTATCGAGTATCACAGGTTTTCGAGCT 1443 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1396 GATAGGCCAACTTCTAGCGACTATAGTCATAGACTATCGAGTATCACAGGTTTTCGAGCT 1455 Qy 1444 GGAGCTAATGGAACGGTCCCAGTGTTTGGTTGGACATCTGCAACTGTTGATCGTAACAAT 1503 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1456 GGAGCTAATGGAACGGTCCCAGTGTTTGGTTGGACATCTGCAACTGTTGATCGTAACAAT 1515 Qy 1504 ATAATTGAGCAAAACAAAATAACACAATTCCCAGGTGTTAAGTCACACACTCTCAACAAT 1563 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Db 1516 ATAATTGAGCGAAACAAAATAACACAATTCCCAGGTGTTAAGTCACACACTCTCAACAAT 1575 Qy 1564 TGTCAAGTAGTTAGGGGTACTGGATTTACAGGAGGAGACTGGTTGAGACCAAATAATAAT 1623 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1576 TGTCAAGTAGTTAGGGGTACTGGATTTACAGGAGGAGACTGGTTGAGACCAAATAATAAT 1635 Qy 1624 GGTACATTTAGACTAACTATTACTTCATTCTCCAGCCAATCTTACCGAATTCGCTTACGT 1683 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Db 1636 GGTACATTTAGACTAACTATTACTTCATTCTCCAGTCAATCTTACCGAATTCGCTTACGT 1695 Qy 1684 TATGCTACTTCAGTAGGGAATACTTCTTTAGTTATATCTTCTTCTGATGCAGGTATTTCT 1743 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Db 1696 TATGCTACTTCAGTAGGGAATACTTCTTTAGTTATATCTTCTTCTGATGGAGGTATTTCT 1755 Qy 1744 TCCACAACAATTCCGCTTACCTCAACAATAACATCACTGCCACAAACTGTACCATACCAA 1803 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1756 TCCACAACAATTCCGCTTACCTCAACAATAACATCACTGCCACAAACTGTACCATACCAG 1815 Qy 1804 GCTTTTAGGGTTGTAGATTTACCTATTACTTTTACAACACCTACTACCCAAAGAAATTAT 1863 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1816 GCTTTTAGGGTTGTAGATTTACCTATTACTTTTACAACACCTACTACCCAAAGAAATTAT 1875 Qy 1864 ACGTTTGATTTCCGTCTCCAAAATCCATCAAACGCAAATGTATTCATTGATAGATTTGAA 1923 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Db 1876 ACGTTTGATTTCCGTCTCCAAAATCCATCAAACGCAAATGTATTCATTGATAGAATTGAA 1935 Qy 1924 TTTGTTCCAATTGGGGGTTCTTTGTCTGAGTATGAAACCAAACATCAGCTAGAAAAAGCA 1983 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1936 TTTGTTCCAATTGGGGGTTCTTTGTCTGAGTATGAAACCAAACATCAGCTAGAAAAAGCA 1995 Qy 1984 AGGAAAGCGGTGAACGATTTGTTTACCAATGAATCGAAAAATGTGTTAAAAAAAGACACG 2043 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1996 AGGAAAGCGGTGAACGATTTGTTTACCAATGAATCGAAAAATGTGTTAAAAAAAGACACG 2055 Qy 2044 ACCGATTATGATATAGATCAAGCTGCAAACTTGGTAGAATGTGTATCTGATGAATGTGCA 2103 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2056 ACCGATTATGATATAGATCAAGCTGCAAACTTGGTAGAATGTGTATCTGATGAATGTGCA 2115 Qy 2104 AATGCTAAAATGATCCTATTAGATGAAGTAAAATATGCGAAACAACTTAGCGAAGCCCGC 2163 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2116 AATGCTAAAATGATCCTATTAGATGAAGTAAAATATGCGAAACAACTTAGCGAAGCCCGC 2175 Qy 2164 AATCTACTTCTAAATGGTAATTTTGAATACCAAGATAGAGATGGGGAGAATCCATGGAAA 2223 |||||||||||||||||||||||||| || |||||||||||| ||||||||||||||| Db 2176 AATCTACTTCTAAATGGTAATTTTGATAACATAGATAGAGATGGTGAGAATCCATGGAAA 2235 Qy 2224 ACAAGTCCCAATGTTACCATCCAAGAGAATAACCCCATTTTTAAAGGCCGCTATCTCAGT 2283 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 2236 ACAAGTCCCAATGTTACCATCCAAGAGAATAACCCCATTTTTAAAGGCCGCTATCTTAGT 2295 Qy 2284 ATGTCAGGTGCGAACAATATCGAGGCAACCAATGAGATATTTCCCACTTATGTATACCAA 2343 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Db 2296 ATGTCAGGTGCGAACAATATCGAGGCAACCAATGAGATATTTCCCACTTATGCATACCAA 2355 Qy 2344 AAAATTGATGAATCCAAATTAAAACCTTATACCCGTTATAAAGTTCGAGGTTTTGTTGGA 2403 ||||| |||||| | ||||||||||| ||||| ||||||||||||||||| ||||||||| Db 2356 AAAATAGATGAAGCAAAATTAAAACCCTATACGCGTTATAAAGTTCGAGGGTTTGTTGGA 2415 Qy 2404 AATAGTAAAGATTTAGAATTATTGGTTACACGGTATGATGAAGAAGTAGATGCGATTTTA 2463 ||||||||||||||||| || |||||||||||||||||||||||||||||||| |||||| Db 2416 AATAGTAAAGATTTAGAGTTGTTGGTTACACGGTATGATGAAGAAGTAGATGCAATTTTA 2475 Qy 2464 AATGTATCAAATGATATACCACATGCTCCGCCACCTTTCTGCGGTGAATTTGATCGATGC 2523 |||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| Db 2476 AATGTACCAAATGATATACCACATGCTCCGCCACCTTTTTGCGGTGAATTTGATCGATGC 2535 Qy 2524 AAGCCGCATTCTTATCCTCCTATTAATCCAGAATGTCACCATGATGTAATAAATAACATT 2583 || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Db 2536 AACCCGCATTCTTATCCTCCTATGAATCCAGAATGTCACCATGATGTAATAAATAACATT 2595 Qy 2584 GAAATATCCTCTCCTTGCCAACACAATAAGATGGTAGATAGCGCTGATATATCTTATCGC 2643 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Db 2596 GAAATATCCTCTCCTTGCCAACACAATAAGATGGTAGATAACGCTGATATATCTTATCGC 2655 Qy 2644 CATAGCCGAATAAGTAAAAAACATGGCATTTGTCATGAATCTCATCATTTTGAATTCCAT 2703 ||||||| |||||||||||||||||||||||||||||||||||| ||||||||| Db 2656 CATAGCC------ATAAAAAACATGGCATTTGTCATGAATCTCATCATTTCGAATTCCAT 2709 Qy 2704 ATTGATACAGGGAAAATCGATTTGGTCGAAAATTTGGGAATTTGGGTTATATTTAAAATA 2763 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2710 ATTGATACAGGGAAAATCGATTTGGTCGAAAATTTGGGAATTTGGGTTATATTTAAAATA 2769 Qy 2764 TGTTCCACAGATGGTTACGCAACATTAGATAATTTGGAAGTTATTGAAGAGGGTCCTTTA 2823 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Db 2770 TGTTCCACAGATGGTTACGCAACATTAGATAATTTGGAAGTTATTGAAGAGCGTCCTTTA 2829 Qy 2824 GGAGCCGAATCCTTAGAACGTGTGAAAAGAAGAGAAAAGAAATGGAAACATCACATGGAA 2883 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Db 2830 GGAGCCGAATCATTAGAACGTGTGAAAAGAAGAGAAAAGAAATGGAAACATCACATGGAA 2889 Qy 2884 CACAAATGTTCAGAAACTAAACATGCATATCATGCCGCAAAACAAGCGGTGGTGGCGTTA 2943 ||||| |||||||||||||||| |||||||||||| |||||||||||| |||||| |||| Db 2890 CACAAGTGTTCAGAAACTAAACTTGCATATCATGCTGCAAAACAAGCGCTGGTGGGGTTA 2949 Qy 2944 TTCACCAACTCTAAATATGATAGATTAAAGTTCGAAACAACCATATCCAATATTCTTTTT 3003 ||||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||| Db 2950 TTCACAAACACTGAATATGATAGATTAAAGTTCGAAACAACCATATCCAATATTCTTTTT 3009 Qy 3004 GCTGATTATCTCGTGCAGTCAATTCCGTATGTATATAATAAATGGTTACCAGGTGTTCCA 3063 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Db 3010 GCTGATTATCTCGTGCAGTCAATTCCGTATGTATATAATAAATGGTTACCAGATGTTCCA 3069 Qy 3064 GGTATGAATTACGATATCTATACAGAATTAAAAAATCTGTTTACGGGAGCTTTCAATCTA 3123 |||||||||| ||| ||||||||||||||||||||||||| |||||||||||||||| || Db 3070 GGTATGAATTTCGAGATCTATACAGAATTAAAAAATCTGTATACGGGAGCTTTCAATTTA 3129 Qy 3124 TATGATCAGCGAAATATTATAAAAAATGGAGACTTTAATCGTGGGCTCATGCATTGGCAT 3183 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Db 3130 TATGATCAGCGAAATATTATAAAAAATGGAGACTTTAATCGCGGGCTCATGCATTGGCAT 3189 Qy 3184 GCGACACCTCATGCAAGAGTAGAGCAAATAATAGATAATAGGTCTGTGCTAGTGCTTCCA 3243 |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| Db 3190 GCGACACCTCATGCAAGAGTAGAGCA---AATAGATAATAGGTCTGTGCTGGTGCTTCCA 3246 Qy 3244 AATTATGCTGCCAATGTTTCACAAGAGGTTTGTTTAGAACACAATCGTGGTTATGTATTA 3303 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3247 AATTATGCTGCCAATGTTTCACAAGAGGTTTGTTTAGAACACAATCGTGGTTATGTATTA 3306 Qy 3304 CGTGTAACGGCGAAAAAAGAAGGCCCTGGAATTGGATATGTTACATTCAGTGATTGTGCA 3363 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 3307 CGTGTAACGGCGAAAAAAGAAGGCCCTGGAATTGGATATATTACATTCAGTGATTGTGCA 3366 Qy 3364 AATCATATAGAAAAGCTTACATTTACTTCTTGCGATTATGGTACAAACGTAGTGCCATAT 3423 ||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||| ||| Db 3367 AATAATATAGAAAAGCTGACATTTACTTCTTGCGATTATGGTACAAACGAAGTGCCGTAT 3426 Qy 3424 GAACAATCTAATTATCCTACAGACGGAGTACCATATGGACAACATGGTTGTAATATAGAC 3483 || |||||||||||||||||||||||||| |||| ||||| |||||||||||||||||| Db 3427 GAGCAATCTAATTATCCTACAGACGGAGTTTCATACGGACACCATGGTTGTAATATAGAC 3486 Qy 3484 GGAGTACCGTATGAACAATCCGGTTATCGTACAGACGGAGTACCGTACGAACTTGGTCAT 3543 ||||| ||| ||| |||| ||||||||||||||| Db 3487 AGAGTAAGGTACGAAGAATCTGGTTATCGTACAGAC------------------------ 3522 Qy 3544 CGTACAGATGGAGTACCGTACGAACAATCTGGTTATCGTACAGACGGAGTACCATGCGAA 3603 || ||||||||||||||||||||||||||| ||||||||||| | | |||| Db 3523 ---------GGTGTACCGTACGAACAATCTGGTTATCGTGCAGACGGAGTATCGTACGAA 3573 Qy 3604 CAACATGGTTGTCATACAGACGGACTACCACACATACAACATGGTTGTCGTACAGACAGA 3663 ||||||||||||||||| |||||| ||||| ||| |||||||||||||||||| |||||| Db 3574 CAACATGGTTGTCATACCGACGGAGTACCATACAAACAACATGGTTGTCGTACGGACAGA 3633 Qy 3664 TCAAGAGATGAACTACTTGGTTATGTGACAAAAACGATTGATGTATTCCCTAATACAGAT 3723 ||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||| ||| Db 3634 TCAAGAGATGAACAACTTGGTTACGTGACAAAAACGATTGATGTATTCCCTGATACTGAT 3693 Qy 3724 AAAGTACGTATCGACATTGGAGAAACCGAAGGTACTTTTAAAGTAGAAAGTGTAGAACTG 3783 ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| Db 3694 AAAGTACGTATCGACATTGGAGAAACCGAAGGTACCTTTAAAGTAGAAAGTGTGGAACTG 3753 Qy 3784 ATTTGTATGGAAGAG 3798 ||||||||||||||| Db 3754 ATTTGTATGGAAGAG 3768 Allowable Subject Matter The polypeptide sequence of SEQ ID NO:12 itself appears to be free of the prior art of record. The closest match observed is one of the polypeptides, SEQ ID NO:46, of the above-referenced Sampson et al. patent family. It is 92.8% sequence identical, thus falling just outside of the scope of the claimed variants of SEQ ID NO:12 (93% identical). Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUSSELL T BOGGS whose telephone number is (571)272-2805. The examiner can normally be reached Monday - Friday, 0800 to 1830 Mtn. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at 571-270-0708. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /RUSSELL T BOGGS/Examiner, Art Unit 1663