DETAILED ACTION
Receipt of Arguments/Remarks filed on February 27 2026 is acknowledged. Claims 1-81 and 85 were/stand cancelled. Claims 82 and 86 were amended. Claims 82-84 and 86-101 are pending.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
The information disclosure statement (IDS) submitted on February 27 2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Withdrawn Rejections
The amendments to the drawings filed February 27 2026 are sufficient to overcome the objection to the drawings. The replacement drawings are entered.
The amendments filed February 27 2026 are sufficient to overcome the rejection of claims 82-84 and 87-88 under 35 U.S.C. 102(a)(1) or (a)(2) as being anticipated by Deaton et al. (WO2023003922, cited on PTO Form 1449). While Deaton et al. exemplify a antisense strand comprising a nucleobase of at least 15 contiguous nucleotides of SEQ ID NO: 272 which is 21 nucleotides in length, the corresponding sense strand as exemplified is 23 nucleotides in length.
Modified Rejection Based on Amendments in the reply filed on February 27 2026
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 82-84, 86-88, 93, 96 and 99 are rejected under 35 U.S.C. 103 as being unpatentable over Deaton et al. (WO2023003922, cited on PTO Form 1449).
Applicant Claims
The instant application claims a double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises a sense strand and an antisense strand each 21 nucleotides in length, wherein:
the antisense strand comprises a nucleobase sequence of at least 15 contiguous nucleotides of UUAUUAAGAAAGUAUAAGCCAGG (SEQ ID NO: 272) or UUUAUUAAGAAAGUAUAAGCCAG (SEQ ID NO: 273);
the sense strand comprises a nucleobase sequence of at least 15 contiguous nucleotides of UGGCUUAUACUUUCUUAAUAA (SEQ ID NO: 126) or GGCUUAUACUUUCUUAAUAAA (SEQ ID NO: 127);
wherein at least one nucleotide of the dsRNA is a modified nucleotide selected from a 2’- O-methyl modified nucleotide or a 2’-fluoro modified nucleotide; wherein at least one internucleoside linkage is a phosphorothioate linkage; and wherein the dsRNA further comprises a ligand or targeting moiety that comprises at least one N-acetyl-galactosamine (GalNAc).
The instant application claims a pharmaceutical composition comprising the dsRNA and a pharmaceutically acceptable carrier, diluent, excipient or combination thereof.
The instant application claims a method of inhibiting Inhibin Subunit Beta E (INHBE) expression in a cell, the method comprising contacting the cell with the dsRNA and maintaining the cell for a time sufficient to obtain degradation of the mRNA transcript of an INHBE gene, thereby inhibiting expression of the INHBE gene in the cell.
The instant application claims a method of treating a disorder mediated by or associated with Inhibin Subunit Beta E (INHBE) comprising administering to a subject in need of such treatment a therapeutically effective amount of the dsRNA.
Determination of the Scope and Content of the Prior Art
(MPEP §2141.01)
Deaton et al. is directed to metabolic disorder-associated target gene iRNA compositions and methods of use thereof. Table 2 (page 151) shows unmodified sense and antisense strand sequences of INHBE dsRNA Agents. One specific dsRNA taught is AD-1657641 which corresponds to positions 2162-2184 of INHBE. As shown below the sense sequence has 19 contiguous nucleotides of instant SEQ ID No: 126 (Qy):
PNG
media_image1.png
180
680
media_image1.png
Greyscale
And the antisense strand has 21 contiguous nucleotides of SEQ ID NO: 272 (Qy):
PNG
media_image2.png
190
638
media_image2.png
Greyscale
Table 3 shows modified sense and antisense strand sequences of INHBE dsRNA agents including AD-1657641 (which is the same sequence as the unmodified AD-1547641 set forth above) wherein the sense strand has the sequence: cscsuggcUfuAfUfAfcuuucuuaauL96 and the antisense strand has the sequence: asUfsuaaGfaAfAfguauAfaGfccaggscsg (page 156). As established on page 145 this modified sequences include a 2’-O methyl modified phosphorothioate, for example cs, and L96 is a ligand comprising a GalNAc.
Additionally, Deaton et al. claims a double stranded ribonucleic acid (dsRNA) agent for inhibiting expression of a metabolic disorder-associated target gene selected from the group consisting of inhibin subunit beta E (INHBE)…wherein the dsRNA comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of any one of SEQ ID NO: 1…and the antisense strand comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from the corresponding portion of the nucleotide sequence of any one of SEQ ID NO: 2…(claim 1). SEQ ID NO: 1 corresponds to NM_031479.5 Homo sapiens inhibin subunit beta E (INHBE), mRNA whereas SEQ ID NO: 2 is the reverse complement of SEQ ID NO: 1 (page 425-426).The INHBE target gene is expressly claimed (claim 7).
As claimed, all of the nucleotides in the sense and/or antisense strand are modified (claim 25) wherein modifications include 2’-O-methyl modified nucleotide, 2’-fluoromodified nucleotide and phosphorothioate group (claim 26). As claimed the double stranded region is 21-23 nucleotide pairs in length (claim 38).
As claimed the dsRNA agent further comprises a targeting ligand which comprises a GalNAc (claims 72, 74-76).
Claimed is a pharmaceutical composition for inhibiting expression of a metabolic disorder-associated target gene selected grom the group consisting of INHBE comprising the dsRNA agent and a pharmaceutically acceptable carrier (claim 123).
Claimed is a method of inhibiting expression of a metabolic disorder-associated target gene selected from the group consisting of inhibin subunit beta E (INHBE)…in a cell, the method comprising contact the cell with the dsRNA agent or the pharmaceutical composition thereby inhibiting expression of the metabolic disorder-associated target gene in the cell (claim 129; 130). Inhibiting expression decreases metabolic disorder-associated target gene protein level in serum of the subject by at least 50% (claim 144). Treating a subject having a metabolic disorder is claimed (claim 145). Disorders include cardiovascular disease (claim 157). Therapeutic doses taught are from about 0.01 mg/kg to about 50 mg/kg (claim 164).
Ascertainment of the Difference Between Scope the Prior Art and the Claims
(MPEP §2141.02)
While Deaton et al. expressly teaches sequences which fall within the scope claimed, Deaton et al. does not expressly teach a length of 21 nucleotides, the sequences in a pharmaceutical composition or in the method.
Finding of Prima Facie Obviousness Rationale and Motivation
(MPEP §2142-2143)
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to form a dsRNA comprising a sense and antisense strand which is 21 nucleotides in length and differs by no more than 3 nucleotides from SEQ ID NO: 1 and 2 and is modified and conjugated to a ligand. One skilled in the art would have been motivated to form this dsRNA as Deaton et al. expressly claims a dsRNA corresponding to these sequences. As specifically claimed the length is 21, 22 or 23 nucleotides. Therefore, one skilled in the art would have been motivated to form a dsRNA of this length. Regarding the claimed modification, Deaton et al. exemplify sequences with both 2’-O methyl and phosphorothioate rendering the choice of these obvious.
Regarding the instantly claimed sequences:
Instant SEQ ID NO: 126 (Qy) and Deaton et al. SEQ ID No: 1 (Db)
PNG
media_image3.png
188
662
media_image3.png
Greyscale
Instant SEQ ID NO: 127 (Qy) and Deaton et al. SEQ ID NO: 1 (Db)
PNG
media_image4.png
184
620
media_image4.png
Greyscale
Instant SEQ ID NO: 272 (Qy) and Deaton et al. SEQ ID NO: 2 (Db)
PNG
media_image5.png
188
656
media_image5.png
Greyscale
Instant SEQ ID NO: 273 (QY) and Deaton et al. SEQ ID NO: 2 (Db)
PNG
media_image6.png
174
630
media_image6.png
Greyscale
Therefore, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to form instantly claimed SEQ ID No: 126-127 and 272-273 as these are sequences which meet the requirements of dsRNA taught in Deaton et al. One skilled in the art would have been motivated to target this portion of SEQ ID NO: 1 as exemplified compound AD-1657641 targets a similar region. Rendering obvious claims 82-84 and 86-88.
Regarding claim 83, as set forth above, the antisense strand of AD-1657641 has 21 contiguous nucleotides of SEQ ID NO: 272.
Regarding claim 84, as set forth above, the sense strand of AD-1657641 has 19 contiguous nucleotides of SEQ ID No: 126.
Regarding claim 87, as shown in Table 3, the sense and antisense strand both contain at least one modified nucleotide, such as 2’-O methyl modified phosphorothioate.
Regarding claim 88, as shown in Table 3, the sense and antisense strand both contain at least one phosphorothioate linkage.
Regarding claim 93, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention and utilize the dsRNA with a carrier. One skilled in the art would have been motivated to utilize a pharmaceutical composition with a carrier in order to deliver the dsRNA. One skilled in the art would have a reasonable expectation of success as Deaton et al. expressly teaches a pharmaceutical composition with the dsRNA.
Regarding claims 96 and 99, it would have been obvious to one of ordinary skill in the art to contact a cell with the dsRNA. One skilled in the art would have been motivated to contact a cell with the dsRNA in order to inhibit expression of INHBE as taught by Deaton et al. Regarding the claimed “maintaining the cell…for a time sufficient”, the instant specification provides no limiting definition of time sufficient. Deaton et al. teaches inhibiting expression decreases metabolic disorder-associated target gene protein level in serum of the subject by at least 50%. This reads on a time sufficient. Deaton et al. teaches administering therapeutically effective doses and expressly claims dosage amounts which are suitable. Therefore, Deaton et al. teaches the same administering/contacting as claimed.
Claims 89-92, 94-95, 97-98 and 100-101 are rejected under 35 U.S.C. 103 as being unpatentable over Deaton et al. (WO2023003922, cited on PTO Form 1449) as applied to 82-84, 86-88, 93, 96 and 99 above in view of Li et al. (WO2019055633).
Applicant Claims
The instant application claims the ligand or targeting moiety is conjugated to the 5’ end of the sense strand of the dsRNA.
Determination of the Scope and Content of the Prior Art
(MPEP §2141.01)
The teachings of Deaton et al. are set forth above. Deaton et al. teaches suitable ligands are disclosed in WO2019055633 (Li et al.) (page 119).
Ascertainment of the Difference Between Scope the Prior Art and the Claims
(MPEP §2141.02)
While Deaton et al. teaches ligands, Deaton et al. does not teach conjugation to the 5’ end of the sense strand of the dsRNA. However, Deaton et al. directs the reader to Li et al.
Li et al. is directed to RNAi agents and compositions. The RNAi agents contain a targeting ligand which is an N-acetyl-galactosamine (claims 10-12). The targeting ligand can be conjugated to the 5’ and/or 3’ end of the sequence (page 79; 80) with conjugation to the 5’ end of the sense strand specifically taught (page 79; claim 16).
Finding of Prima Facie Obviousness Rationale and Motivation
(MPEP §2142-2143)
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Deaton et al. and Li et al. and conjugate the targeting ligand comprising GalNAc to the 5’ end of the sense strand. One skilled in the art would have been motivated to attach the targeting ligand to the 5’ end as Li et al. suggest that the target ligand can be conjugated to either the 5’ and/or 3’ end. Since there are only two choices one skilled in the art would have a reasonable expectation of success. Furthermore, since Deaton et al. expressly directs the readers’ attention to Li et al. and their teachings on ligand, there is a reasonable expectation of success.
Response to Arguments
Applicants’ arguments filed February 27 2026 have been fully considered but they are not persuasive.
Applicants argue that the Office Action has not articulated a rationale for selecting the specific sequence as claimed from Deaton’s disclosure of SEQ Id NO: 1 and 2 which corresponds to the full sequence of the human INHBE mRNA and its reverse complement. The Office action has not articulated a rational for specifically selecting sequences wherein the sense and the antisense strands are each 21 nucleotides in length. The office has not articulated a rationale for modifying Deaton’s AD-1657641 molecule to arrive at the claimed dsRNA comprising sense and antisense strands that are each 21 nucleotides in length. It is argued that Deaton teaches away from sense and antisense strands that are each 21 nucleotides in length. Deaton discloses that dsRNAs having at least one nucleotide overhang can have superior inhibitor properties. Therefore, a skilled person would not have modified AD-1657641 because doing so would have resulted in a blunt-ended product.
Regarding Applicants’ arguments, the examiner cannot agree that a rationale was not put forth in the previous office action. Firstly, page 5 of the Office action clearly indicates that AD-1657641 anticipated the claimed sequence as the sense and antisense strands met the requirements for the claimed sequence. Since this species is clearly named from a finite list of sequences, it was anticipated. As set forth previously, Deaton et al. teaches that the double stranded region is 21-23 nucleotide pairs in length. Since Deaton et al. expressly claims that the dsRNA can be 21 nucleotide pairs in length, this provides the motivation to make dsRNA of this length. Furthermore, as set forth in the previous office, targeting INHBE is a specific desire of Deaton et al. Deaton et al. teaches that the dsRNA comprises at least 15 contiguous nucleotides differing by no more than 3 nucleotides from SEQ ID No: 1 and SEQ ID NO: 2. Therefore, the express teachings in Deaton et al. result in the obviousness of the instantly claimed sequences. Furthermore, “Disclosure of a multitude of effective combinations does not render any particular formulation less obvious.” Merck & Co. v. Biocraft Laboratories, Inc., 874 F.2d 804, 807 (Fed. Cir. 1989). Thus, while there may be other sequences or lengths equally as obvious does not make the instantly claimed sequence and length any less obvious. It is noted that none of the arguments establish an unexpected effect with regards to the specific sequences claimed. Therefore, it was and still is the examiner’s position that one skilled in the art would have been motivated to target any portion of the INHBE gene as taught by Deaton et al. As commented on by the examiner in the last Office action, as shown in the instant specification, such as paragraph 0138/Table 8, there are 13 compounds tested and the %KD ranges from 64-88. While 100643 which corresponds to sense stand of SEQ ID NO: 127 possesses the highest %KD, it does not appear that this sequence possess a %KD which is of a statistical and practical significance. Any differences between the claimed invention and the prior art may be expected to result in some differences in properties. The issue is whether the properties differ to such an extent that the difference is really unexpected. An unexpected property or result must actually be unexpected and of statistical and practical significance. The burden is on the applicant to establish the results are in fact unexpected, unobvious and of statistical and practical significance. See MPEP 716.02. Therefore, the data in the instant specification does not establish that dsRNA commensurate in scope with the claims possess an unexpected or unobvious effect.
Regarding the purported teaching away, the examiner cannot agree. While Applicants are correct in that Deaton does states that dsRNAs having at least one nucleotide overhang can have superior inhibitory properties relative to their blunt-ended counterparts, Deaton repeatedly indicates throughout their teachings that blunt ended dsRNA can be utilized. Specifically Deaton teaches that the RNAi agents of the invention include RNAi agents with no overhang at either end (page 34-35 bridging paragraph; page 76, and page 86) and even specifically teaches a double ended bluntmer of 21 nt in length (page 76, lines 6-10). Furthermore, “the prior art’s mere disclosure of more than one alternative does not constitute a teaching away from any of these alternatives because such disclosure does not criticize, discredit, or otherwise discourage the solution claimed….” In re Fulton, 391 F.3d 1195, 1201, 73 USPQ2d 1141, 1146 (Fed. Cir. 2004). See also UCB, Inc. v. Actavis Labs, UT, Inc., 65 F.4th 679, 692, 2023 USPQ2d 448 (Fed. Cir. 2023) (“a reference does not teach away if it merely expresses a general preference for an alternative invention but does not criticize, discredit or otherwise discourage investigation into the invention claimed.”) (internal quotations omitted) (quoting DePuy Spine, Inc. v. Medtronic Sofamor Danek, Inc., 567 F.3d 1314, 1327 (Fed. Cir. 2009)); and Schwendimann v. Neenah, Inc., 82 F.4th 1371, 1381, 2023 USPQ2d 1173 (Fed. Cir. 2023). MPEP 2145.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 82-84 and 86-101 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-81 of copending Application No. 19163749. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
The instant application claims a double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises a sense strand and an antisense strand each 21 nucleotides in length, wherein:
the antisense strand comprises a nucleobase sequence of at least 15 contiguous nucleotides of UUAUUAAGAAAGUAUAAGCCAGG (SEQ ID NO: 272) or UUUAUUAAGAAAGUAUAAGCCAG (SEQ ID NO: 273);
the sense strand comprises a nucleobase sequence of at least 15 contiguous nucleotides of UGGCUUAUACUUUCUUAAUAA (SEQ ID NO: 126) or GGCUUAUACUUUCUUAAUAAA (SEQ ID NO: 127);
wherein at least one nucleotide of the dsRNA is a modified nucleotide selected from a 2’- O-methyl modified nucleotide or a 2’-fluoro modified nucleotide; wherein at least one internucleoside linkage is a phosphorothioate linkage; and wherein the dsRNA further comprises a ligand or targeting moiety that comprises at least one N-acetyl-galactosamine (GalNAc).
Copending ‘749 claims a double-stranded ribonucleic acid for inhibiting expression of angiotensinogen (INHBE) wherein the dsRNA comprises a sense strand and an antisense strand each 15 to 30 nucleotides in length. Specific sequences claimed include 603, 594, 611, and 620.
Instant SEQ ID NO: 272 (Qy) and Copending ‘749 SEQ ID NO: 603 (Db) have 100% identity.
PNG
media_image7.png
194
642
media_image7.png
Greyscale
Instant SEQ ID NO: 126 (Qy) and COpending ‘749 SEQ ID No: 594 (Db) have 100% identity.
PNG
media_image8.png
186
678
media_image8.png
Greyscale
Instant SEQ ID NO: 127 (Qy) and Copending ‘749 SEQ ID NO: 611 (Db) have 95.2% identity with 20 contiguous nucleotides matching.
PNG
media_image9.png
174
648
media_image9.png
Greyscale
Instant SEQ ID NO: 273 (Qy) and Copending ‘749 SEQ ID No:620 (Db) have 95.7% identity with 22 contiguous nucleotides matching.
PNG
media_image10.png
170
640
media_image10.png
Greyscale
As claimed at least one nucleotide of the dsRNA is a modified nucleotide selected from group consisting of a 2’-O methyl modified, a 5’-phosphorthioate, etc. (claim 31). At least one phosphorothioate is claimed (claim 60). A ligand or targeting moiety conjugated to the 5’ end of the dsRNA is claimed specifically the sense strand (claim 62; 64). The targeting moiety is a GalNAc (claim 65). A pharmaceutical composition with the dsRNA and carrier is claimed (claim 76). A method of inhibiting INHBE expression is a cell with the same method steps as instantly claimed is claimed (claim 77). A method of treating a disorder with the same method step as instantly claimed is claimed (claim 79).
The difference between the instant claims and copending ‘749 is that ‘749 does not expressly claim SEQ ID NO: 603, 594, 611, and 620 have at least one modified nucleotide, at least one internucleoside linkage and a ligand or targeting moiety. However, copending ‘749 does claim that such features can be part of the dsRNA.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to utilize any of the specifically taught modifications and ligands. It would have been obvious to one of ordinary skill in the art to try any of the specifically taught modifications, internucleoside linkages and ligand/targeting moiety as a person with ordinary skill has good reason to pursue known options within his or her technical grasp. Note: MPEP 2141 KSR International CO. v. Teleflex Inc. 82 USPQ 2d 1385 (Supreme Court 2007).
Regarding the claimed sequences in 82-84, 86, 91-92, copending ‘749 claims sequences with the required number of contiguous nucleotides.
Regarding the length of 21 nucleotides in claims 85-86, 91-92 , copending ‘749 claims an overlapping length of 15 to 30. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). Note MPEP 2144.05.
Regarding claims 89-90, 91-92, copending ‘749 claims conjugation at the 5’ end of the sense strand.
Regarding claims 93-95, copending ‘749 claims the same pharmaceutical composition.
Regarding claims 96-101, copending ‘749 claims the same methods.
Response to Arguments
Applicants’ arguments filed February 27 2026 have been fully considered but they are not persuasive.
Applicants argue that copending ‘749 is not a proper ODP as it is not earlier filed. The examiner cannot agree that the MPEP teaches that in order to make a proper non-statutory double patenting rejection (NSDP) the copending application must be later filed. As pointed to in the last Office Action, MPEP 804 I.B.1 (b) (ii) expressly states:
PNG
media_image11.png
173
781
media_image11.png
Greyscale
As set forth in MPEP 804 I.B.1 (a):
PNG
media_image12.png
114
801
media_image12.png
Greyscale
Here, the instant application has a patent term filing date of March 11 2024 (as priority under 35 USC 119 is not taken into consideration when determining the patent term filing date). Copending ‘749 also has a patent term filing date of March 11 2024.
Since both applications have the same patent term filing date, the rejection is maintained as the reply does not indicate how the claims are distinct or a terminal disclaimer was not filed.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ABIGAIL VANHORN whose telephone number is (571)270-3502. The examiner can normally be reached M-Th 6 am-4 pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ABIGAIL VANHORN/ Primary Examiner, Art Unit 1636