DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This application is a CON of 18/968659 which is a divisional application of 18/582272. Therefore, it is entitled to the priority date of the filing date of the parent application which is 20th Feb 2024.
Status of the Claims
Claims 1 - 5 are under examination.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Enablement Rejection
Claims 1-5 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. The specification does not reasonably provide enablement for the use of SEQ ID NO: 3 to bind to and cause degradation of messenger ribonucleic acid (mRNA) that encodes for 5HT1b. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with the claims.
As stated in MPEP §2164.01(a), “there are many factors to consider when determining whether there is sufficient evidence to support a determination that a disclosure does not satisfy the enablement requirement and whether any experimentation is ‘undue’.” These factors include, but are not limited to:
The nature of the invention;
The breadth of the claims;
The state of the prior art;
The level of skill in the art;
The level of predictability in the art;
The amount of direction provided by the inventor;
The presence or absence of working examples;
The quantity of experimentation necessarily needed to make or use the invention based on the disclosure.
See In re Wands USPQ 2d 1400 (CAFC 1988).
Further MPEP §2164.01(c) recites, “When a compound or composition claim is limited by a particular use, enablement of that claim should be evaluated based on that limitation. See In re Vaeck, 947 F.2d 488, 495, 20 USPQ2d 1438, 1444 (Fed. Cir. 1991) (claiming a chimeric gene capable of being expressed in any cyanobacterium and thus defining the claimed gene by its use).”
The relevant In re Wands factors are applied to Claim 1 are as follows:
Nature of the Invention and Breath of the Claims
With respect to claim breadth, the standard under 35 U.S.C. §112(a) entails determining what the claims recite and what the claims mean as a whole. The nature of the invention indicates that the instant claims encompass inhibition of gene expression in vitro and in vivo by administering to a cell a nucleic acid cassette comprising a miRNA or a RP comprising the nucleic acid cassette. While claims are directed to a composition (SEQ ID NO: 15), the specification discloses only one use for the composition: inhibiting gene expression in a cell in vivo or in vitro. Therefore, for enablement determination, claims are evaluated in light of the specification which is enabled for effecting inhibition of gene expression in a cell in vitro and in vivo. The target biomolecule is 5HT1b [0024], and SEQ ID NO: 15 is the miRNA expression cassette No. 3 – 5HT1b [0077]. Further, the specification in [0008] recites: embodiments of the present disclosure relate to compositions that upregulate the production of miRNA that degrades, or causes degradation of, or inactivates or causes the inactivation of, the target mRNA of the target biomolecule; in [0024]: Embodiments of the present disclosure relate to at least one approach for inducing endogenous production of one or more sequences of miRNA that target and silence mRNA of a target biomolecule, for example 5HT1b; in [0065]: In some embodiments of the present disclosure, the insert comprises one or more nucleotide sequences that each encode one or more miRNA sequences that may be complementary to and degrade, or cause degradation of, mRNA of the target biomolecule.
Specifically, the broadest reasonable interpretation (BRI) of claim 1 is:
Claim 1 is directed to a RP that comprises SEQ ID NO: 15, and the RP is administered to cells in vivo or in vitro to effect degradation of, or inactivate, or silence 5HT1b (target mRNA).
The State of the Art
Challenges identified in the Art and Prior Art with respect to MiRNA
A review of the art and prior art shows that the following are challenges associated with the use of a miRNA molecule to function in a cell in vitro or in vivo in a subject:
Proper processing of nucleic acid sequences to produce pri-miRNAs in the nucleus.
Length considerations for designing a functional miRNA.
Sequence requirements on the region of complementarity of the miRNA with the target mRNA, such regions of complementarity referred to as a “seed region”.
Testing of candidate miRNAs is essential because of the unpredictability whether a candidate miRNA will work in a cell
These challenges were discussed in the written description section and are discussed in-depth below as well as in the Level of Unpredictability section:
Lam (Lam et al. 2015. Molec. Ther. Nuc. Ac. 4:e252, IDS). Lam teaches (Table 1) miRNAs are produced in a cell following post-transcriptional processing. First the primary miRNA transcript (pri-miRNA) produces a 70-100 nucleotide precursor (pre-miRNA). The pre-miRNA precursors are then processed by Dicer into a 18-25-mer miRNA duplex which associates with RISC and binds to the target mRNA through partial complementary base pairing with the consequence that the target gene silencing occurs via translational repression, degradation, and/or cleavage.
Lam further teaches (§ Design of therapeutic siRNA-Strand selection):
Since this phenomenon can occur with both siRNA and miRNA,48,49,50 the RNA duplex needs to be carefully designed to warrant correct guide strand selection by the RISC. Two major sequence parameters are known to determine the guide strand selection: (i) the asymmetry rule and (ii) 5′ nucleotide preference; both of which can be applied to … miRNA design
Lam also teaches (same §) the asymmetry rule means the guide strand should have a more thermodynamically unstable 5’ end vs. the passenger strand and the 5’ nucleotide preference rule instructs that the guide strand should have a U or A at the 5’ end whereas the passenger strand should always contain C and G at the 5′ end to minimize the risk of being incorrectly selected as a guide strand.
An incorrect loading orientation into RISC results in the intended guide strand being discarded and off-target effects produced since the remaining (intended passenger strand) strand base-pairs to non-intended mRNA (Lam §Design of therapeutic siRNA-Strand selection).
With respect the use of claimed miRNA for in vivo use in a subject, Lam teaches (§Main text ¶3) RNA therapies face barriers of stability, delivery challenges, and off-target effects. Lam teaches (§Design of therapeutic miRNA ¶2) synthetic miRNA precursors with longer sequences (from a few extra nucleotides to a full-length pri-miRNA) have been proposed as therapeutic agents and these pri-miRNAs require processing in the nucleus, whereas pre-miRNAs and miRNAs do not, so different strategies are required for delivery of different types of miRNA to their cellular targets. Lam teaches (§Delivery of siRNA and miRNA Therapeutics, entire §) miRNA has an intracellular site of action but is poorly permeable across biological membranes. Lam teaches (§Viral vectors) viral vectors can be effective for delivery but are associated with serious safety concerns. Regarding stability, Lam teaches (§Chemical modification, entire §) RNA exhibits poor stability and chemical modifications can address that. However, an artisan would understand that if SEQ ID NO: 15 were expressed from a vector, it would be transcribed and therefore the pri-miRNA would not comprise chemical modifications.
The art of Ying (Ying et al. 2008. Mol. Biotechnol. 38:257–268, IDS) teaches (§MicroRNA, entire §) miRNAs are small single-stranded RNA genes possessing the reverse complement of another protein-coding gene’s mRNA transcript. Like Lam, Ying similarly teaches, (same §, ¶2) miRNA are made from primary transcripts that are processed in the nucleus to precursors, which are then cut by Dicer into (§Introduction ¶1) shorter miRNAs that are 18-25 nucleotide long. Ying teaches (§MicroRNA ¶3) miRNAs suppress gene expression via complementarity to an mRNA target:
miRNAs suppress gene expression based on their complementarity to a part of one or more messenger RNAs (mRNAs), usually at a site in the 3’ UTR. The annealing of the miRNA to the target mRNA inhibits protein translation… [or] triggers the degradation of the mRNA transcript through a process similar to RNAi... [emphasis added.]
Ying further teaches (§Identification ¶3) miRNAs should have complementarity to 8-10 nucleotide of the target mRNA and that experimentally validating miRNAs is necessary:
There are numerous new computational methods that provide ways to estimate the total number of miRNA genes in different animals [55–58]. Fundamentally, each program identifies highly conserved genomic non-coding regions that possess stem-loop structures with specific “seed” sequences, and complementarity of the first 8–10 nucleotides… computational techniques may suffer from a high false alarm rate. Therefore, validation of the identified miRNAs by Northern blot analysis and functional study is critical. [emphases added.]
Altogether the teachings of Ying indicate that a miRNA should comprise complementarity to 8-10 consecutive nucleotides of its target mRNA (i.e., complementarity of the first 8–10 nucleotides) and that experimentally validating miRNA function is necessary to determine whether a given miRNA actually binds its target and functions as intended.
The art of Gorski (Gorski, S., Vogel, J. & Doudna, J., Nat Rev Mol Cell Biol 18, 215–228 (2017), IDS) teaches that essential to a regulatory RNA’s function is the presentation of short 'seed sequences' in a target (abstract). Detailed teachings of Gorski have been discussed above in the written description section.
Thus, Lam, Ying, and Gorski all teach that miRNA should be complementary to its target mRNA. All references teach there is unpredictability in miRNA function. Ying teaches the region of complementarity should be at least 8 consecutive nucleotides long, Gorski teaches a seed sequence is necessary, Lam teaches, specifically, unpredictability with respect to miRNA design, miRNA delivery, lack of stabilizing chemical modifications to miRNA, and miRNA function.
Challenges identified in the Art and Prior Art with respect to Instant SEQ ID NO: 15 and whether they will effect the intended changes in target gene expression in a cell
It is noted that there is currently no prior art that recites SEQ ID NO: 15 of the instant application. However, it is also noted that no sequence in the prior art is complementary to the given sequences. Short segments of 45 nucleotides (of SEQ ID NO: 15) are seen in the prior art as part of vectors meant for gene therapy. These segments are described in the prior art as consensus regions flanking 5' of amiRNA sequences in transcripts from which miRNA is released.
An ABSS search indicated that the closest sequence to the insert in SEQ ID NO: 15 is SEQ ID NO: 868 of Minshull (US11162102), IDS. SEQ ID NO: 868 is an exemplary multi-hairpin amiRNA sequence for inhibition of human TCR alpha and TCR beta2 and TCR beta1 (column 104, lines 35-36).
As per Minshull, multi-hairpin amiRNA sequence for the inhibition of a target gene comprises two or more different hairpin sequences that can be expressed in the target mammalian cell to produce two or more different RNA guide strand sequences, each of which is complementary to a different region of the target mRNA. Each guide strand sequence is separated from its corresponding passenger strand sequence by a sequence that, in the expressed RNA, forms an unpaired loop of between 5 and 35 bases. Each passenger strand sequence comprises at least 19 bases that are at least 78% identical to the reverse complement of its corresponding guide strand sequence. The differences between the guide and passenger strand sequences are selected to favor processing of the transcribed hairpins by the mammalian RNA interference pathway and loading of the guide strand(s) into the RISC complex, to reduce expression of the target mRNA. Hairpin sequences of the invention (that is the combination of guide, loop and passenger strand sequences) in the multi-hairpin amiRNA sequence are preferably sequences that are not naturally expressed sequences in mammalian cells, or from viruses that may infect mammalian cells (pg. 12, Summary of Invention).
The instant sequence (SEQ ID NO: 15) has elements of the design as taught by Minshull above, and further, the instant insert sequence, SEQ ID NO: 3, is a 79% match when limited to local alignment, to SEQ ID NO: 868 of Minshull. The alignment below shows how instant SEQ ID NO: 3 aligns with Minshull’s SEQ ID NO: 868.
Query Match 41.2%; Score 222.4; Length 774;
Best Local Similarity 78.7%;
Matches 343; Conservative 0; Mismatches 81; Indels 12; Gaps 6;
Qy 104 CTATGTGCTGGAGGCTTGCTGAAGGCTGTATGCTGTAATCTTTCGCTGGCTGCAGTTCGT 163
| | | |||||||||||||||||||||||||||| || || | || | || || ||
Db 265 CCAGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGAAACCTGTGGCC--CAGCTCTTAGT 322
Qy 164 TTTGGCCTCTGACTGACGAACTGCAGCGCGAAAGATTACAGGACACAAGGCCTGTTACTA 223
||||||| ||||||||| || || || | || || ||||||||||||||||||||||
Db 323 TTTGGCCACTGACTGACTAAGAGCTGCC--ACAGGTTTCAGGACACAAGGCCTGTTACTA 380
Qy 224 GCACTCACATGGAACAAATGGCCTCTAGCCTGGAGGCTTGCTGAAGGCTGTATGCTGTGT 283
||||||||||||||||||||||| | |||||||||||||||||||||||||||||
Db 381 GCACTCACATGGAACAAATGGCCCAGATCCTGGAGGCTTGCTGAAGGCTGTATGCTGAAA 440
Qy 284 TAATGCTGATGTCACGCTGCGTTTTGGCCTCTGACTGACGCAGCGTGACCAGCATTAACA 343
| || | || | | || ||||||||| ||||||||| || | || | || |
Db 441 TCATTCAGAGG--AGCCTTTGTTTTGGCCACTGACTGACAAAGGCT--CCTGAATGATTT 496
Qy 344 CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCTCTAGCCTGGAGGCT 403
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||
Db 497 CAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAGATCCTGGAGGCT 556
Qy 404 TGCTGAAGGCTGTATGCTGTTCACCTGGTTAACACATACACCGTTTTGGCCTCTGACTGA 463
|||||||||||||||||||| | | | | || |||||||||| ||||||||
Db 557 TGCTGAAGGCTGTATGCTGTGTAGAAG--ACATCACTTCATCGTTTTGGCCACTGACTGA 614
Qy 464 CGGTGTATGTGAACCAGGTGAACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACA 523
|| || | || | | |||||||||||||||||||||||||||||||||||||||
Db 615 CGATGAAGTTG--TCTTCTACACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACA 672
Qy 524 AATGGCCTCTCTAGAA 539
||||||| | | | |
Db 673 AATGGCCACCGTGGGA 688
Given the high degree of similarity between the insert of instant SEQ ID NO: 15 and SEQ ID NO: 868 disclosed by Minshull, the non-requirement for absolute complementarity with target mRNA in order for miRNAs to bind to and cause degradation of their target mRNAs as disclosed by Gorski and described in the State of the Prior Art above, SEQ ID NO: 15 may hybridize to or bind to the targets of Minshull’s SEQ ID NO: 868, i.e., human TCR alpha and TCR beta2 and TCR beta1. But inhibition of human TCR alpha and TCR beta2 and TCR beta1 are not intended targets of the instant invention, rather 5HT1b is disclosed as the intended target. One skilled in the art would not know how to reconcile the probable binding of SEQ ID NO: 15 with a target unrelated to intended target 5HT1b.
The Level of Predictability in the Art
While it is recognized that introduction of exogenous nucleic acids that are targeted to a specific gene may result in attenuation of expression of the targeted gene, nucleic acid based therapies are highly unpredictable. See for example, Van den Berg et al., (Van den Berg, et al., Pgs. 1-12, Molecular Therapy - Nucleic Acids, Volume 5, 2016, IDS) have taught the design of effective primary microRNA mimics with different basal stem conformations. While the entire reference is relied on, applicant is directed to the “Design and functionality of pri-miRNA mimic” starting at page 4. On Pg. 5, Van den Berg recite, “The processing and silencing efficacy of guides derived from pri-miRNA mimics was again assessed by northern blot analyses and luciferase reporter assays (Figure 4b–e).” Further recitation, “In contrast to the original pri-miRNAs, functional miRNAs were not effectively derived from all pri-miRNA mimics”. Van den Berg conclude this section of the reference with the following significant recitation, “Together, these results indicated that exogenous miRNAs can indeed be effectively derived from expressed pri-miRNAs with a variety of basal stem lengths and motifs, where the canonical hairpin was present in almost all, most, or none of the predicted structures including the extended flanking sequence, but the level of target silencing differed for mimics with the same scaffold or core guide sequence”.
Denzler (Denzler R et al., Mol Cell. 2016 Nov 3;64(3):565-579, IDS). Denzler teach that several factors unduly influence miRNA-induced target-gene repression (1st line of introduction). Some of these as described in the entire reference are: competing endogenous RNA-mediated derepression counteracts intended miRNA activity, miRNA decay, almost complementary sites can contribute to target-site competition without imparting repression, and closely spaced sites of the same or different miRNAs cooperatively sequester miRNAs. Denzler conclude their study by suggesting testing of putative miRNAs in two different cell types and testing several different miRNA families.
Therefore, the instant claimed invention is highly unpredictable. If one skilled in the art cannot readily anticipate the effect of a change within the subject matter to which that claimed invention pertains (i.e., using a miRNA construct of the claimed invention to bind to and cause degradation of messenger ribonucleic acid (mRNA) that encodes for 5HT1b), then there is a lack of predictability in the art.
The court has indicated that the more unpredictable an area is, the more specific enablement is necessary in order to satisfy the statute. (See In re Fisher, 427 F.2d 833, 166 USPQ 18 (CCPA 1970)). This is because it is not obvious from the disclosure of one species what other species will work.
In the instant case, applicants do not demonstrate enablement for SEQ ID NO: 15 containing RP of the claimed invention administered to any subject or for that matter, an isolated cell in vitro, to bind to and cause degradation of messenger ribonucleic acid (mRNA) that encodes for an 5HT1b. Rather, applicants only demonstrate the making of their RP bearing SEQ ID NO: 15 as disclosed. Applicants appear to rely on the assumption that by providing a novel construct intended to perform a certain function, the intended results for the binding and degradation of the target will be achieved. However, such an assumption cannot be made because there is no indication that a nucleic acid sequence with no disclosed complementarity would exhibit such results in any cell or model/species. Additionally, since the specification fails to demonstrate any data or evidence that the claimed SEQ ID NO: 15 achieves the intended result, there would be no way of determining without undue experimentation whether the claimed sequence would exhibit such a desired result when administered to any human or non-human animal or an isolated cell. Without more experimentation demonstrating the efficacy of the claimed sequence, the level of unpredictability remains high. Therefore, it is unpredictable that the claimed sequence will bind to and cause degradation of messenger ribonucleic acid (mRNA) that encodes for 5HT1b as claimed.
A skilled artisan would not be able to use the composition for targeting mRNA of 5HT1b and degrading/inactivating 5HT1b mRNA with a reasonable expectation of success based on guidance provided in the specification and art at the time of the filing of the application.
The Amount of Direction Provided by the Inventor and
The Presence or Absence of Working Examples
What is described in the specification and sole working example does not enable the claimed invention. The specification discloses the general design of the RP. While no function for SEQ ID NO: 15 is disclosed, the specification in [0007] recites: embodiments of the present disclosure relate to compositions that upregulate the production of miRNA that degrades, or causes degradation of, or inactivates or causes the inactivation of, the target mRNA of the target biomolecule; in [0065]: In some embodiments of the present disclosure, the insert comprises one or more nucleotide sequences that each encode one or more miRNA sequences that may be complementary to and degrade, or cause degradation of, mRNA of the target biomolecule . With respect to 5HT1b, in [0023] the specification recites: Embodiments of the present disclosure relate to at least one approach for inducing endogenous production of one or more sequences of miRNA that target and silence mRNA of a target biomolecule, for example 5HT1b.
These general statements do not provide any specific guidance regarding how to use the claimed miRNA of SEQ ID NO: 15.
In regards to the amount of direction provided by Applicant as to how one of skill in the art would practice the full scope of the claimed invention, the specification as filed discloses how to make an expression cassette but does not disclose any observations of inhibition of the intended target in any scenario i.e., in vitro or in vivo. Example 1-Expression Cassette, the only example in the disclosure, in [paragraph 0102] discloses how expression cassettes for expressing miRNA were synthesized. The disclosure provides background information on administering a therapeutically effective amount of the composition which is based on the tissue culture infective dose [paragraph 0073]. However, no tissue culture infective dose, or information on how to obtain such a dose is provided. Applicant provides no examples of binding to and causing degradation of messenger ribonucleic acid (mRNA) that encodes for 5HT1b, in vivo or in vitro, with the putative miRNA. Additionally, the specification as filed provides only general guidance concerning viral vectors that can be used for therapy procedures.
With regard to achieving the binding to and causing degradation of messenger ribonucleic acid (mRNA) that encodes for 5HT1b, the specification does not provide sufficient guidance for selecting the target gene, nor does the specification disclose the appropriate route of administration or amount of the RP, such that a sufficient amount of the RP would be taken up and effectively inhibit binding to and causing degradation of messenger ribonucleic acid (mRNA) that encodes for 5HT1b. Moreover, the specification does not provide guidance as to which reference sequence is targeted by the sequences of the invention, in which cell or organism, nor does the specification provide any representative working examples of target RNA sequences within the scope of the use of the RP of the invention as claimed.
An Examiner conducted alignment with 5HT1b with reference sequences obtained from Nucleotide/NCBI (NM_000863.3) (5HT1b Sequence Genbank revision history Nov 2023, 9 pages. Retrieved from the United States NCBI webpage on the internet <https://www.ncbi.nlm.nih.gov> [retrieved on 24 Mar 2025]) uncovered minimal regions of identity between the insert of recited sequence; i.e., SEQ ID NO: 3 and its intended target. See alignment:
NM_000863.3_HTR1B
Query Match 3.6%; Score 19.4; DB 1; Length 2568;
Best Local Similarity 55.1%;
Matches 38; Conservative 0; Mismatches 31; Indels 0; Gaps 0;
Qy 109 TGCTGGAGGCTTGCTGAAGGCTGTATGCTGTAATCTTTCGCTGGCTGCAGTTCGTTTTGG 168
|| || | | | | | |||| |||| | | |||||| | | | |||
Db 390 TGGTGATGCCCATCAGCACCATGTACACTGTCACCGGCCGCTGGACACTGGGCCAGGTGG 449
Qy 169 CCTCTGACT 177
|| |||||
Db 450 TCTGTGACT 458
The highest complementarity between SEQ ID NO: 3 and sequence of 5HT1b is over regions of 6 consecutive nucleotides. However, nothing about this alignment indicates the areas of sequence complementarity are in 5HT1b mRNA’s 3’ UTR, which was suggested by Ying as the target for miRNA. The specification does not provide any teachings/guidance as to what part of the 5HT1b mRNA, claimed miRNA targets. This alignment result would have indicated to an artisan that more information is needed to determine that SEQ ID NO: 15 encodes a miRNA that binds to and degrades and/or inactivates 5HT1b mRNA. The specification does not teach any assay system for testing the activity of the claimed miRNA nor does it teach how to create such an assay system or what cell system could be used for testing the activity of the claimed miRNA or the plasmid comprising the miRNA.
With respect to the intended use - degradation of target mRNA, the specification in [0068] generally states that a sequence of the invention contains “one, two, three, four, five, or six miRNA sequences that each are complementary to and degrade, or cause degradation of, one biomolecule,… such as 5HT1b (and other serotonin receptors) . …In some embodiments of the present disclosure, the composition may comprise multiple copies of the same nucleotide sequence of miRNA”. The specification in [0069] discloses the RP of the invention may be used in gene therapy. “The gene therapy is useful for increasing the subject’s endogenous production of one or more sequences of miRNA that target the mRNA”. These are all general statements and lack any specific guidance regarding how to use the claimed miRNA and the RP comprising the miRNA. Furthermore,
There is no evidence that SEQ ID NO: 15 can be successfully delivered to a nucleus and processed into miRNA.
There is no evidence that SEQ ID NO: 15 encodes a miRNA.
There is no evidence that SEQ ID NO: 15 encodes a miRNA that binds to 5HT1b mRNA in the 3’UTR.
There is no evidence that SEQ ID NO: 15 encodes a miRNA that binds to and degrades 5HT1b mRNA.
There is no evidence that SEQ ID NO: 15 encodes a miRNA that binds to and inactivates 5HT1b mRNA.
The Specification does not disclose what part of SEQ ID NO: 15 forms the pri-miRNA, the pre-miRNA, or the miRNA duplex of 18-25 nucleotides. The Specification does not provide any evidence that their SEQ ID NO: 15 has been successfully delivered to a cell’s nucleus and processed into miRNA. The Specification does not provide any evidence that the miRNA duplex binds to the target 5HT1b mRNA and does not demonstrate any target gene silencing via translational repression, degradation, and/or cleavage.
In view of the prior art teachings that miRNA are 18-25 nucleotide long, and instantly claimed miRNA cassette of SEQ ID NO: 15 being 540 nucleotides long, there is a lack of guidance in the Specification whether SEQ ID NO: 15 is processed in a cell or what part of it becomes the active 18-25 nucleotide miRNA.
In view of Lam’s teaching about (§Design of therapeutic miRNA ¶2) using synthetic miRNA precursors as therapeutic agents and that pri-miRNAs require processing in the nucleus and require different delivery strategies than pre-miRNAs and miRNAs, there is no guidance or evidence that the 540 nucleotide long SEQ ID NO: 15 would be delivered to the nucleus and processed to produce active miRNA. Applicant has not demonstrated that SEQ ID NO: 15 has been delivered to the nucleus, nor that it is transcribed or expressed as a pri-miRNA or processed to a pre-miRNA.
Regarding the claimed composition wherein the sequence of nucleotides is encased in a viral vector of any sort, in view of Lam’s teaching about stability (§Chemical modification, entire §), an artisan would understand that if SEQ ID NO: 15 were expressed from a vector, it would be transcribed and therefore the pri-miRNA would not comprise stabilizing chemical modifications, even if such modifications had been applied to the RP. Applicant has not provided any evidence that the miRNA encoded on and expressed from the RP is stable enough to perform the claimed functions.
The art of Ying discussed above teaches that (§Identification ¶3) even when miRNAs are identified with computational tools, they must be validated by functional testing/ analysis in a cell. The sole example in the Specification doesn’t enable the claimed invention because the Specification doesn’t teach any assay system for validating the activity of SEQ ID NO: 15 and doesn’t provide guidance on whether the miRNA encoded by SEQ ID NO: 15 actually binds and downregulates 5HT1b mRNA. The Specification provides no evidence of binding between any miRNA and 5HT1b mRNA, let alone degradation or inactivation of the mRNA target. Furthermore, the state of the art discussion above found no evidence that making and using miRNAs that target 5HT1b is standard and well-known in the art.
The instant claims recite specific functions that the composition performs, but provides absolutely no evidence that the composition performs any of those functions.
In conclusion, the specification does not describe I) the number of miRNAs encoded in SEQ ID NO: 15, II) the identity of the miRNAs encoded in SEQ ID NO: 15 either by name or by sequence, or III) the locations of the miRNA-encoding sequences in SEQ ID NO: 15. An ABSS search of SEQ ID NO: 15 failed to uncover any hits to facilitate identification of the miRNA-encoding sequences therein.
The Quantity of Experimentation Necessary
The sole example in the disclosure does not provide any guidance regarding:
how to deliver SEQ ID NO: 15 to a cell.
how to ensure delivery of SEQ ID NO: 15 to the nucleus.
Which region in the target the recited sequences actually target.
Which region in the recited sequences are miRNAs or sequences intended to be the active miRNAs.
an assay system for validating the activity of SEQ ID NO: 15.
The guidance stated above is necessary because, as discussed, SEQ ID NO: 15, the sequence that encodes the miRNA that performs the claimed functions, has not been demonstrated to possess the characteristics the art teaches a miRNA should possess, and the miRNA encoded by SEQ ID NO: 15 has not been demonstrated to perform the intended function disclosed in the specification.
Furthermore, the state of the art discussion above found no evidence that making and using miRNAs that target 5HT1b is standard and well-known in the art.
In light of the unpredictability surrounding the claimed subject matter and the lack of adequate guidance, one wishing to practice the presently claimed invention would be unable to do so without engaging in undue experimentation. It is especially noted that applicants provide no data, examples, figures, etc. demonstrating that the claimed miRNA sequences are capable of binding to and causing degradation of messenger ribonucleic acid (mRNA) that encodes for 5HT1b. One wishing to practice the presently claimed invention would have to produce additional data and experimentation to determine whether the claimed sequences are capable of achieving the intended results. In the absence of such information, a person of ordinary skill in the art would reasonably require an undue quantity of experimentation.
Conclusion of Enablement Rejection
Altogether, the Specification does not support enablement for the claimed composition comprising SEQ ID NO: 15 that encodes a miRNA that binds to and degrades and/or inactivates mRNA that encodes 5HT1b. The guidance present in the specification does not address the enablement issues raised in view of the state of art discussion presented above. The Specification does not demonstrate delivery to the nucleus, and does not disclose what part(s) of SEQ ID NO: 15 form the active miRNA or show any binding to 5HT1b mRNA or any degradation or inactivation of 5HT1b mRNA. Those evidences are necessary because, as discussed, SEQ ID NO: 15, the sequence that encodes the miRNA that performs the claimed functions, has not been demonstrated to possess the characteristics the art teaches a miRNA should possess, and the miRNA encoded by SEQ ID NO: 15 has not been demonstrated to perform the intended function disclosed in the specification.
Therefore, in view of the quantity of experimentation necessary, the breadth of the claims, lack of guidance in the specification, and the absence of working examples for inhibiting 5HT1b in a target cell, it would require undue experimentation for one skilled in the art to practice the invention as broadly claimed In conclusion, Claim 1 is rejected for lack of enablement under 35 U.S.C. 112(a). Claims 2-5 are rejected because they depend from Claim 1 and do not remedy the issues.
Sequences free of the art of record
SEQ ID NO: 15 in instant claim 1 is free of the art of record.
Conclusion
No claims are allowed.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached on (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SHABANA S MEYERING/Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635