DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Drawings
The drawings are objected to because Figure 1A references nucleotide sequences using Roman numerals. Where a sequence set forth in a "Sequence Listing XML" is presented in a drawing, reference must be made using the sequence identifier preceded by the notation "SEQ ID NO:" or the like, either in the drawing or in the Brief Description of the Drawings. The sequence identifiers in the disclosure must correspond to sequence identifiers set forth in the "Sequence Listing XML" as defined in 37 CFR 1.832(a). The sequence identifiers in the "Sequence Listing XML" must begin with 1 and increase sequentially by integers. See MPEP § 2412.05(a).
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The disclosure is objected to because of the following informalities:
Paragraphs [0066-0071, 0088-0089, 0101-0102, 0112-0113 & 0122-0124] reference sequences by Roman numeral. 37 CFR 1.831(c) requires that each nucleotide and/or amino acid sequence set forth in a "Sequence Listing XML" in accordance with 37 CFR § 1.831(a) must be referenced by a sequence identifier as defined in 37 CFR 1.832(a) (see MPEP § 2412.05(a)), preceded by the notation "SEQ ID NO:" or the like, when the sequence appears in the description or claims. The sequence identifiers in the disclosure must correspond to sequence identifiers set forth in the "Sequence Listing XML" as defined in 37 CFR 1.832(a). The sequence identifiers in the "Sequence Listing XML" must begin with 1 and increase sequentially by integers.
Paragraphs [0076, 0077,0082,0083,0090,0091,0094,0095,0114,0115,0118 & 0119] present tables that are unnumbered.
Appropriate correction is required.
Status of Claims
Claims 1-10 are under examination on the merits.
Claim Objections
Claims 1-10 are objected to because of the following informalities:
Claim 1 (line 1, line 4): “Oryza sativa Leafy Cotyledon 1” should be italicized.
Claim 1 (line 2, 4), claim 2 (line 1, 5), claim 3 (line 1), claim 4 (line 1), claim 5 (line 1), claim 6 (line 1), claim 7 (line 1), claim 8 (line 1), claim 9 (line 1) and claim 10 (line 1): “OsLEC1” should be italicized.
Claims 1-10 (line 1): “method in” should read --method of--.
Claim 1 (line 4): “Sequence I” should read --SEQ ID NO: 1--.
Claim 1 (line 10), claim 8 (line 8), and claim 9 (lines 2 & 5): Agrobacterium should be italicized.
Claim 1 (line 11), claim 9 (line 6) and claim 10 (lines 2 & 4): “transgenetic” should read --transgenic--.
Claim 2 (line 5): “a 5’ end of the OsLEC1 gene” should read --the 5’ end of the OsLEC1 gene-- because there is only one 5’ end of a given gene.
Claim 4 (line 5) & claim 5 (line 2): “BsaI” should be italicized.
Claim 5 (lines 2-): “wherein the T7 ligase and BsaI enzyme are reacted in the PCR instrument at 37°C for 5 min and 20°C for 10 min, and cycled for 30-50 times” should read --wherein the reaction in the PCR instrument comprises incubating T7 ligase and BsaI enzyme at 37°C for 5 minutes and 20°C for 10 minutes for 30-50 cycles--.
Claim 6 (line 6): “product was as” should read --product as--.
Claim 7 (lines 6-8): “mixing, after the digested products are recovered separately, the purified PCR product and the target vector recovered after digestion in equal amounts and ligating the same with T4 ligase at 4°C overnight” should read --separately recovering the digested purified PCR product and the digested target vector, mixing the digested purified PCR product and the digested target vector in equal amounts and ligating with T4 ligase at 4°C overnight--.
Claim 8 (line 3): “Escherichia coli” should be italicized.
Claim 10 (lines 9-10): “Oryza sativa AUXIN SIGNALING F-BOX PROTEIN 4” and “OsAFB4” should be italicized.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-10 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 (line 4) recites “and the OsLEC1 gene being Sequence I recorded in this invention”. The limitation “this invention” is indefinite, because the instant application presents multiple embodiments and it is not clear what is considered “this” invention. Amending the wording to --wherein the sequence of the OsLEC1 gene is set forth in SEQ ID NO: 1-- or -- wherein the OsLEC1 gene comprises the sequence of SEQ ID NO: 1-- would overcome this indefiniteness. Dependent claims 2-10 are also indefinite.
Claim 1 (line 6) recites “ligating each gRNA fragment”. This limitation is indefinite because it’s not clear if the gRNA fragments are ligated to each other or to themselves or to any vector. Dependent claims 2-10 are also indefinite.
Claim 1 (line 7) recites “a ligation product”. It’s unclear if a ligation product refers to a product formed by ligating all gRNA fragments or a ligated product of a single gRNA fragment in step S3 or some other ligation product entirely. Dependent claims 2-10 are also indefinite.
Claim 1 (line 8) recites “the purified product”. There is insufficient antecedent basis for this limitation in the claims, because there is no step of purifying a product. Dependent claims 2-10 are also indefinite.
Claim 1 (line 9) recites “the ligated vector”. There is insufficient antecedent basis for this limitation in the claim, because there is no step of ligating a vector in the claim. It is unclear if this limitation refers to the ligated gRNA fragment in S3, which may be one or any number of tandem fragments comprising gRNA of S2, or the target vector of S5, or some other vector. Dependent claims 2-10 are also indefinite.
The term “close” in claim 2 (line 5) is a relative term which renders the claim indefinite. The term “close” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. A site may be considered “close” to the end of a gene relative to the other end of the gene; alternatively, a site may be “close” to the end of a gene relative to sites on a different arm of the chromosome where the gene is found. The distance between the target sites and the 5’ end of the OsLEC1 gene is not defined in a way that the scope of a “close” gene sequence encompassed by claim 2 is clear to one of skill in the art. Dependent claims are likewise indefinite.
Claim 3 (line 6) recites “taking 5-10 µL of products”. Steps in method claims do not have an inherent order unless specified by the claim language. It is unclear if this limitation in claim 3 is intended to mean the PCR products of fragments L1, L2, and/or L3 (lines 4-5) or if this line encompasses the ligation product in claim 1, line 7, or the products of the PCR amplification of the ligation product, or some other product entirely. Because the scope of the limitation is unclear, claim 1 and dependent claims 2-10 are indefinite.
Claim 4 (lines 3-4) recites “in equal amounts according to concentrations”. This limitation could be reasonably interpreted as mixing the fragments to arrive at equal concentrations or it could be interpreted to require equal volumes. Clarification of whether “amount” refers to copy number or volume or another “amount” would clarify the issue of indefiniteness.
Claim 6 recites “after the PCR is completed” in line 8). There is insufficient antecedent basis for the limitation in the claim, because there is a PCR amplification in claim 6 (line 6) but claim 6 depends on claim 3, which also comprises a step of PCR amplification (lines 4-5). Wording such as --after the PCR amplification of the diluted product is completed-- would overcome the issue of indefiniteness. Dependent claims 7-10 are also indefinite.
Claim 6 recites “the product” in line 8 and also 9. There is insufficient antecedent basis for this limitation in the claims, because there is ligation product (claim 6, line 6), diluted ligation product (line 8), and implicit PCR product from the PCR amplification in line 6. Because “the product” could refer to any of these products, the limitation is indefinite. Dependent claims 7-10 are also indefinite.
Claim 7 (line 7) recites “in equal amounts”. It is unclear if “amounts” refers to a volume or a mass or a number of copies or some other value, making the meaning of this limitation indefinite. Dependent claims 8-10 are also indefinite.
Claim 8 recites “the correctly sequenced plasmid” in line 8. “Correctly sequenced” in plain English language would be interpreted to mean that the plasmid had been sequenced correctly (the act of determining a sequence was performed correctly) but Applicant appears to be using the phrase to mean a plasmid comprising a correct sequence. There is insufficient antecedent basis for either interpretation in the claims, because line 7 does not require identifying the correctness of a plasmid. Dependent claims 9-10 are also indefinite.
The claims are generally narrative and indefinite, failing to conform with current U.S. practice. They appear to be a literal translation into English from a foreign document and are replete with grammatical and idiomatic errors. Claim 3 (lines 7-8) recites “determining the three PCR products L1, L2 and L3”. It is unclear what “determining” is meant to encompass- L1, L2, and L3 were amplified in line 4, so the identities of L1, L2, and L3 should be known. It’s not clear if this limitation means detecting the presence of the products or determining the concentration, as required by claim 4, lines 3-4 or something else entirely. Dependent claims 4-10 are also indefinite. Claim 8 recites “smearing” and “staying overnight” in lines 3-4. Claim 9 recites “seedling refining” in line 7. These are not standard defined techniques in the art and a definition is not provided in the specification. Dependent claims 9-10 are also indefinite.
Enablement
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 3-10 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The claims all require a plasmid pGTR. A pGTR plasmid is known in the art, which is a PCR template to construct polycistronic tRNA-gRNA. See plasmid #63143 from the addgene website (www.addgene.org/63143/, accessed 6/5/2026). The pGTR plasmid #63143 was described by Xie et al (2015) PNAS. 112(11): 3570-3575 (published 3/27/2015) as comprising PTG genes designed to produce gRNA targeting the rice MPK5 gene (page 3571, right column, paragraphs 1-2).
Because gRNA are target specific, using the pGTR template taught by addgene and/or Xie as a template for amplifying by PCR (claim 3, lines 4-5), would produce fragments comprising gRNA sequences targeting a MPK5 gene, or perhaps another gene, but not likely not targeting the OsLEC1 gene for which gRNA target sites were designed in claim 2.
Thus, claims 3-10 require a pGTR plasmid comprising gRNA fragments targeting OsLEC1. Since the plasmid claimed is essential to the claimed invention, it must be obtainable by a repeatable method set forth in the specification or otherwise be readily available to the public.
The specification does not disclose a repeatable process to obtain the exact same plasmid in each occurrence and it is not apparent if such a plasmid is readily available to the public.
If a plasmid is not so obtainable or available, a deposit thereof may satisfy the requirements of 35 U.S.C. 112. So long as the number of seeds deposited complies with the requirements of the IDA where the deposit is made, the USPTO considers such a compliant submission as satisfying the rules under 37 CFR 1.801 through 1.809.
If the deposit of the plasmid is made and accepted under the terms of the Budapest Treaty, then an affidavit or declaration by the Applicant, or a statement by an attorney of record over his or her signature and registration number, stating that the material will be irrevocably and without restriction or condition released to the public upon the issuance of a patent would satisfy the deposit requirement made herein.
If the deposit has not been made and accepted under the Budapest Treaty, then in order to certify that the deposit, meets the requirements set forth in 37 CFR 1.801-1.809, Applicant may provide assurance of compliance by an affidavit or declaration, or by a statement by an attorney of record over his or her signature and registration number showing that
(a) during the pendency of the application, access to the invention will be afforded to the Commissioner upon request;
(b) all restrictions upon availability to the public will be irrevocably removed upon granting of the patent;
(c) the deposit will be maintained in a public depository for a period of 30 years or 5 years after the last request or for the enforceable life of the patent, whichever is longer; and
(d) the viability of the biological material at the time of deposit will be tested (see 37 CFR 1.807).
In addition, the identifying information set forth in 37 CFR 1.809(d) should be added to the specification. See 37 CFR 1.801 - 1.809 [MPEP 2401-2411.05] for additional explanation of these requirements.
Claim 10 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
Claim 10 recites “obtaining mutant materials with knocked-out Oryza sativa AUXIN SIGNALING F-BOX PROTEIN 4 (OsAFB4) gene in rice”. There are no active steps recited in claim 10 or in claims 1-4 & 6-9 that would result in a knocked-out OsAFB4 gene. Claim 2 requires designing gRNA target sites on a gene sequence close to a 5’ end of the OsLEC1 gene (line 5). There is no requirement to design a gRNA target for an OsAFB4 gene. There are no active steps for introducing mutations into the rice plant other than the introduction of the gRNA fragments targeting OsLEC1.
The instant specification does not provide additional teachings of how to knock out OsAFB4. Paragraph [0045, 0110] teaches obtaining mutant materials with knocked-out OsAFB4, but the gRNA target sites of the method are located in the OsLEC1 gene (paragraph [0009, 0065]).
The skill in the art is high, and one of ordinary skill in the art would understand how to knockout an AFB4 gene. Hu et al (2012) Cell Research. 22: 777-781 (published 1/17/2022, hereafter Hu) teaches AFB4 knockouts in Arabidopsis T-DNA mutants (figure 1, page 778, left column, paragraph 2-right column, paragraph 1), while Guo et al (2021) New Phytologist. 229: 2676-2692 (published 11/1/2020) teaches Osafb4 rice mutants generated using CRISPR-Cas9 technology (page 2677, right column, paragraph 2 & page 2681, right column, paragraphs 3-4; figure 5b). However, one of skill in the art would not understand how to obtain a knocked-out OsAFB4 gene by transforming a rice plant with gRNA fragments targeting an OsLEC1 gene. One of ordinary skill in the art would be required to generate and screen rice plants comprising OsLEC1 targeting plasmids to identify which, if any, also have a knocked out OsAFB4 gene.
Thus, claim 10 is not enabled for obtaining mutant materials with knocked-out OsAFB4 in light of the instant disclosure.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 1-6 are rejected under 35 U.S.C. 103 as being unpatentable over Guo et al (2022) Frontiers in Plant Science. 13:887980. (published 5/10/2022, hereafter Guo) in view of Xie et al (2015) PNAS. 112(11): 3570-3575 (published 3/27/2015 hereafter Xie, appended with SI appendix) and NCBI Reference Sequence NC_089036.1 from base 30656000 to 30657200 (available 7/10/2024), taken with the evidence of the NCBI reference page for Gene ID 4330586 (last updated 7/12/2024).
Claims 1-2 are drawn to a method comprising selecting gRNA target sites, cloning tandem fragments, ligating each gRNA fragment, performing PCR on a ligation product, performing enzyme digestion, transforming, performing Agrobacterium-mediated genetic transformation of rice, and screening and identifying transgenic plants. Claims 3-5 are drawn to the method wherein cloning tandem fragments comprises using pGTR as a template, amplifying three fragments, and detecting the products by 1% agarose gel electrophoresis, purifying and recovering a target fragment, and determining the three PCR products, and mixing the 3 fragments, adding T7 and BsaI and performing a reaction. Claim 6 is drawn to the method wherein performing PCR amplification on a ligation product comprises using diluted product as a template and purifying the product.
Guo teaches a method of generating Oslec1 mutants in rice using CRISPR/Cas9 (abstract). Two single gRNAs were designed to specifically target the protein-coding region of OsLEC1 and assembled into a vector using the PTG strategy of Xie et al 2015. The two gRNAs (5’-CTCTGGGCCATGAGCCGCCT-3’ and 5’-CAGACCGTCAACTTCGAGCA-3’ were assembled into a single vector pRGEB32 to construct OsLEC1-PRGEB32 (page 14, left column, paragraph 4). Guo teaches that the OsLEC1 gene is LOC_Os02g49370 (page 14, left column, paragraph 5).
Oslec1 mutants were generated in the Nipponbare background of rice (page 13, right column, paragraph 4-page 14, left column, paragraph 1). Callus was induced from sterile seeds (page 14, left column, paragraph 2), and the OsLEC1-PREB32 vector was introduced into the rice callus using Agrobacterium tumefaciens-mediated co-cultivation with the EHA 105 strain (page 14, left column, paragraph 7).
mRNA was extracted from Oslec1 embryos and Illumina sequencing was performed (page 15, left column, paragraph 2). The accession number for the data of the study is GSE179596 in the NCBI BioProject database (page 15, right column, paragraph 4). Callus from seeds comprising a 35S:3XFLAG-OsLEC1 construct was subjected to gradient SDS-PAGE to detect proteins (page 15, right column, paragraph 2).
Guo does not teach the sequence of the OsLEC1 gene or the details of the steps of ligating gRNA fragments, performing PCR amplification on the ligation products, and performing enzyme digestion on the purified product and a target vector.
Xie teaches a method to produce numerous gRNAs from a polycistronic gene. Xie teaches a motivation to stack gRNAs within a single synthetic gene in order to improve multiplex editing capability and facilitate more sophisticated Cas9 applications and to improve editing efficiency of CRISPR/Cas9 in plants (page 3570, left column, paragraph 2-right column, paragraph 2). Xie synthesized Polycistronic tRNA-gRNA (PTG) genes designed to produce gRNA1 and gRNA2 targeting a rice gene and introduced the PTG genes into a vector. After transfecting rice with the plasmids, reverse transcription PCR was performed to map both 5’ and 3’ ends followed by sequence analysis (page 3571, right column, paragraph 1-2; figure 2). Up to 8 gRNAs were tandemly arrayed to construct PTGs to target rice MAPKs; the synthesis of the PTG was from PCR components based on Golden Gate assembly for cloning into CRISPR/Cas9 expressing vectors (page 3572, left column, paragraph 3-right column, paragraph 2). Spacer sequences for the gRNA were selected using the CRISPR-PLANT database (page 3575, left column, paragraph 4). The vector pRGEB32 was used for Agrobacterium-mediated rice transformation, and synthesized PTGs comprising the gRNA sequences were inserted into BsaI-digested PRGEB32 for stable rice transformation (page 3575, left column, paragraph 3-4). The pRGEB32 vector comprises an HPT II gene (figure S2 B).
Xie teaches that the pGTR plasmid was used as a template to synthesize PTGs; the gRNA scaffold fragment was amplified by PCR using specific primers then fused with a tRNA fragment by overlapping extension PCR. The overlapping PCR product was separated and purified from an agarose gel (Appendix SI, page 2, paragraph 2).
PTG genes were synthesized by Golden Gate assembly (Appendix SI, page 5, paragraph 1). A gRNA spacer was split into two parts and synthesized within primers with a BsaI site (Appendix SI, page 5, paragraph 2). Amplified PCR products of the PTG fragments were purified with a kit (Appendix SI, page 7, step 2.2). In a second Golden Gate assembly method taught by Xie, PTGs were synthesized by PCR amplification as in the level 1 Golden Gate assembly, the PCR products were separated in 1% agarose gel, then PCR bands with the expected size were excised and purified (SI appendix, page 9, step 3.3-page 10, step 3.4). The purified amplified parts were ligated by a reaction that required BsaI, T7 DNA ligase, and 25-50 ng of the PCR products, added in equal amount for each part. The total volume for the ligation reaction was 20 uL, leaving 7 uL for the PCR amplified “parts” (Appendix SI, page 7, step 2.3). Golden Gate assembly was performed in a thermal cycler by incubation at 37°C for 5 minutes and 20°C for 10 minutes for 30-50 cycles (Appendix SI, page 8, step 2.4). PTGs comprising two gRNA fragments required 3 PCR amplified “parts” to be assembled (Appendix SI, page 7, step 2.3).
After Golden Gate Assembly, the products (20 uL) were diluted with 180uL water. A PCR amplification was performed using 1uL of ligation product at a 1:10 dilution as template and a forward and reverse primer S5AD5-F and S3AD5-R, which are located at each end of the PTG (Appendix SI, page 8, step 2.5 & step 2.6; figure S6). PCR product was purified (Appendix SI, page 8, step 2.7). Xie teaches PTGs comprising two gRNA sequences comprising 367 nucleotides (SI appendix, Table S1, PTG6) and PTGs comprising 4 gRNA sequences comprising 711 nucleotides (SI appendix, Table S1, PTG8).
The purified PCR product was digested with Fok I and digested products were separated on 1% agarose gel, excised, and purified (Appendix SI, page 8, step 2.8-2.9). The Fok I digested fragment was ligated into BsaI digested pRGEB32 with T4 DNA ligase (Appendix SI, page 8, step 2.10).
Ligation product was transformed into E. coli DH5α. Plasmids were purified and confirmed by Sanger sequencing (Appendix SI, page 8, step 2.11).
Transgenic rice plants were generated by transforming mature seed-derived calli (page 3575, right column, paragraph 1) and rice was Kitaake or Nipponbare (page 3575, left column, paragraph 2). Conventional Agrobacterium-mediated transformation was used to produce stable transgenic lines (page 3573, right column, paragraph 2), and seedlings were regenerated from transformed callus (figure 4C). To confirm mutagenesis, rice genomic DNA was extracted, target regions were amplified with specific primers, and the PCR product was separated in 1% agarose gel. Selected PCR products were cloned for DNA sequencing (page 3575, right column, paragraph 2).
NCBI Reference Sequence NC_089036.1 from base 30656000 to 30657200 teaches a nucleotide sequence from the assembly of the rice Nipponbare reference genome that comprises a sequence with 100% identity to instant SEQ ID NO: 1 (see alignment below) and encodes a nuclear transcription factor Y subunit B-3 for which the gene ID is 4330586. The coding sequence is found at bases 97-861 of the appended sequence record.
Score
Expect
Identities
Gaps
Strand
2159 bits(1169)
0.0
1169/1169(100%)
0/1169(0%)
Plus/Plus
Query 1 CACACTTTAGCTGCTAGCTAGTGCTACCACCCACAGGAGGCAACCCTAGCTTTCCCACGC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 32 CACACTTTAGCTGCTAGCTAGTGCTACCACCCACAGGAGGCAACCCTAGCTTTCCCACGC 91
Query 61 AGCCAATGGAGGCCGGCTACCCGGGCACGGCGGCGAACGGCGCTGCCGCCGACGGGAACG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 92 AGCCAATGGAGGCCGGCTACCCGGGCACGGCGGCGAACGGCGCTGCCGCCGACGGGAACG 151
Query 121 GTGGCGCGCAGCAGGCGGCGGCCGCGCCGGCTATACGTGAGCAGGACCGGCTGATGCCGA 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 152 GTGGCGCGCAGCAGGCGGCGGCCGCGCCGGCTATACGTGAGCAGGACCGGCTGATGCCGA 211
Query 181 TCGCGAACGTGATCCGCATCATGCGCCGCGTGCTCCCGGCGCACGCCAAGATCTCGGACG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 212 TCGCGAACGTGATCCGCATCATGCGCCGCGTGCTCCCGGCGCACGCCAAGATCTCGGACG 271
Query 241 ACGCCAAGGAGACGATCCAGGAGTGCGTGTCGGAGTACATCAGCTTCATCACCGGGGAGG 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 272 ACGCCAAGGAGACGATCCAGGAGTGCGTGTCGGAGTACATCAGCTTCATCACCGGGGAGG 331
Query 301 CCAACGAGCGGTGCCAGCGCGAGCAGCGCAAGACCATCACCGCCGAGGACGTGCTCTGGG 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 332 CCAACGAGCGGTGCCAGCGCGAGCAGCGCAAGACCATCACCGCCGAGGACGTGCTCTGGG 391
Query 361 CCATGAGCCGCCTCGGCTTCGACGACTACGTCGAGCCCCTCGGCGTCTACCTCCACCGCT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 392 CCATGAGCCGCCTCGGCTTCGACGACTACGTCGAGCCCCTCGGCGTCTACCTCCACCGCT 451
Query 421 ACCGCGAGTTCGAGGGGGAGTCCcgcggcgtcggcgtcggcgtcggcgccgcgcgcggcg 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 452 ACCGCGAGTTCGAGGGGGAGTCCCGCGGCGTCGGCGTCGGCGTCGGCGCCGCGCGCGGCG 511
Query 481 ACCACCACCATGGTCACGTCGGTGGGATGCTCAAGTCCCGCGCGCAGGGCTCCATGGTGA 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 512 ACCACCACCATGGTCACGTCGGTGGGATGCTCAAGTCCCGCGCGCAGGGCTCCATGGTGA 571
Query 541 CGCACCACGACATGCAGATGCACGCCGCCATGTACGGTGGCGGCGCGGTGCCGCCGCCGC 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 572 CGCACCACGACATGCAGATGCACGCCGCCATGTACGGTGGCGGCGCGGTGCCGCCGCCGC 631
Query 601 CGCATCCTCCTCCGCACCACCACGCGTTCCACCAGCTCATGCCGCCGCACCACGGCCAGT 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 632 CGCATCCTCCTCCGCACCACCACGCGTTCCACCAGCTCATGCCGCCGCACCACGGCCAGT 691
Query 661 ACGCGCCGCCGTACGACATGTACGGCGGCGAGCACGGGATGGCGGCGTACTAcggcggga 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 692 ACGCGCCGCCGTACGACATGTACGGCGGCGAGCACGGGATGGCGGCGTACTACGGCGGGA 751
Query 721 tgtacgcgcccggcagcggcggcgacgggagcggcagcagcggcagcggtggcgccggca 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 752 TGTACGCGCCCGGCAGCGGCGGCGACGGGAGCGGCAGCAGCGGCAGCGGTGGCGCCGGCA 811
Query 781 cgccgcagACCGTCAACTTCGAGCACCAGCATCCGTTCGGATACAAGTAGTAACAGCAGC 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 812 CGCCGCAGACCGTCAACTTCGAGCACCAGCATCCGTTCGGATACAAGTAGTAACAGCAGC 871
Query 841 AGAATGGCGATCGGTCTGCACCTGCATGCACACGTATCGCATGCAGATCGAGCTAGTAGT 900
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 872 AGAATGGCGATCGGTCTGCACCTGCATGCACACGTATCGCATGCAGATCGAGCTAGTAGT 931
Query 901 GCAACTGGCTAACTTGAACCAGTTAAAAACTTAAGACTTAGTGATCGTGTGTGGTTTAAT 960
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 932 GCAACTGGCTAACTTGAACCAGTTAAAAACTTAAGACTTAGTGATCGTGTGTGGTTTAAT 991
Query 961 TAATTTGCTACGTTCAGGTAGTGATCGATGAGATTTTAATTTCCTACTGTCAGTTTAATT 1020
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 992 TAATTTGCTACGTTCAGGTAGTGATCGATGAGATTTTAATTTCCTACTGTCAGTTTAATT 1051
Query 1021 CACCGTTCATGTACTCGATCCAGCTAGTACTACTCCTAGTTACCCTTGTTCTAATCTTAA 1080
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1052 CACCGTTCATGTACTCGATCCAGCTAGTACTACTCCTAGTTACCCTTGTTCTAATCTTAA 1111
Query 1081 CGCAATTGTGTCGATCGGACGATCGCACGTTTATCTTCAAGTGGAATTTGTCTTATAACA 1140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1112 CGCAATTGTGTCGATCGGACGATCGCACGTTTATCTTCAAGTGGAATTTGTCTTATAACA 1171
Query 1141 CTAATTAAGCGCCTGGAAGCTTATGTACA 1169
|||||||||||||||||||||||||||||
Sbjct 1172 CTAATTAAGCGCCTGGAAGCTTATGTACA 1200
This sequence aligns to the gRNA sequences of Guo targeting the OsLEC1 gene. See alignments below of the coding sequence and Guo’s gRNA.
gRNA ------------------------------------------------------------
coding_seq ATGGAGGCCGGCTACCCGGGCACGGCGGCGAACGGCGCTGCCGCCGACGGGAACGGTGGC
gRNA ------------------------------------------------------------
coding_seq GCGCAGCAGGCGGCGGCCGCGCCGGCTATACGTGAGCAGGACCGGCTGATGCCGATCGCG
gRNA ------------------------------------------------------------
coding_seq AACGTGATCCGCATCATGCGCCGCGTGCTCCCGGCGCACGCCAAGATCTCGGACGACGCC
gRNA ------------------------------------------------------------
coding_seq AAGGAGACGATCCAGGAGTGCGTGTCGGAGTACATCAGCTTCATCACCGGGGAGGCCAAC
gRNA ------------------------------------------------CTCTGGGCCATG
coding_seq GAGCGGTGCCAGCGCGAGCAGCGCAAGACCATCACCGCCGAGGACGTGCTCTGGGCCATG
gRNA AGCCGCCT----------------------------------------------------
coding_seq AGCCGCCTCGGCTTCGACGACTACGTCGAGCCCCTCGGCGTCTACCTCCACCGCTACCGC
gRNA ------------------------------------------------------------
coding_seq GAGTTCGAGGGGGAGTCCCGCGGCGTCGGCGTCGGCGTCGGCGCCGCGCGCGGCGACCAC
gRNA ------------------------------------------------------------
coding_seq CACCATGGTCACGTCGGTGGGATGCTCAAGTCCCGCGCGCAGGGCTCCATGGTGACGCAC
gRNA ------------------------------------------------------------
coding_seq CACGACATGCAGATGCACGCCGCCATGTACGGTGGCGGCGCGGTGCCGCCGCCGCCGCAT
gRNA ------------------------------------------------------------
coding_seq CCTCCTCCGCACCACCACGCGTTCCACCAGCTCATGCCGCCGCACCACGGCCAGTACGCG
gRNA ------------------------------------------------------------
coding_seq CCGCCGTACGACATGTACGGCGGCGAGCACGGGATGGCGGCGTACTACGGCGGGATGTAC
gRNA ------------------------------------------------------------
coding_seq GCGCCCGGCAGCGGCGGCGACGGGAGCGGCAGCAGCGGCAGCGGTGGCGCCGGCACGCCG
gRNA CAGACCGTCAACTTCGAGCA-------------------------
coding_seq CAGACCGTCAACTTCGAGCACCAGCATCCGTTCGGATACAAGTAG
The NCBI reference page for Gene ID 4330586 provides evidence that the names of the gene ID 4330586 include Os02g0725700 and leafy cotyledon 1.
Before the time of filing of the instant application, it would have been obvious to one of ordinary skill in the art to combine the method of Xie for knockout out a rice gene with the method of Guo targeting OsLEC1. One of ordinary skill in the art would have been motivated to follow the steps of Xie’s method, because Guo teaches that the method of generating Oslec1 mutants used the PTG strategy of Xie et al 2015. One of ordinary skill in the art would have had reasonable expectation of success, because Guo’s method using the strategy of Xie led to Oslec1 mutant rice plants.
The OsLEC1 gene being SEQ ID NO: 1 of the instant application would have been obvious if not inherent, because Guo and Xie use Nipponbare rice, and NCBI Reference Sequence NC_089036.1 from base 30656000 to 30657200, taken with the evidence of the NCBI reference page for Gene ID 4330586, teaches that Nipponbare rice comprises a leafy cotyledon 1 gene with a sequence identical to instant SEQ ID NO: 1.
The two gRNA target sites designed by Guo reads on selecting gRNA target sites being located on an OsLEC1 gene of SEQ ID NO: 1 (claim 1, S1). Creating the pGTR plasmid taught by Xie reads on cloning tandem fragments comprising gRNA (claim 1, S2). Assembling the PTG genes of Xie and constructing a pRGEB32 plasmid reads on ligating each gRNA fragment, performing PCR amplification on a ligation product, and performing enzyme digestion on the purified product and a target vector (claim 1, S3-S5). Transforming the pRGEB32 plasmid into E. coli reads on transforming the ligated vector (claim 1, S6). Introducing the plasmid into rice callus using Agrobacterium tumefaciens-mediated co-cultivation reads on performing Agrobacterium-mediated genetic transformation of rice (claim 1, step S7). Finally, confirming mutagenesis of rice plants by sequencing and by PCR amplification of the target sequences reads on screening and identifying transgenic plants in claim 1, S8.
Regarding claim 2, Xie teaches selecting CRISPR target sites from a plant CRISPR database, which reads on following target site design principles for CRISPR-Cas9 technology. Guo teaches two gRNA target sites in the OsLEC1 gene. The limitation “on a gene sequence close to a 5’ end of the OsLEC1 gene” (line 5) is broad and does not require that the gRNA target sequences be within the sequence of the OsLEC1 gene specifically. Additionally, “close” is a relative term, which makes the limitation indefinite as to how “close” to a 5’ end the sequences must be located. At least one of the two gRNA sequences of Guo is located closer to the 5’ of the coding sequence than the 3’ end, which reads on “close”. See alignment above. Additionally, both gRNA sequences are closer to the 5’ end of the gene than a sequence located in a neighboring gene, which also reads on “close”.
Regarding claims 3-5, the method of Xie comprises amplifying three fragments comprising gRNA sequences by PCR using a plasmid pGTR as a template to produce fragments for the Golden Gate assembly, which reads on amplifying three fragments, L1, L2, and L3 comprising gRNA sequences (claim 3, lines 4-5). Xie teaches a method wherein the amplified fragments are run on 1% agarose gel electrophoresis and the correct band is excised and purified, which reads on detecting the products, purifying, and recovering a target fragment (claim 3, lines 6-7). The method of Xie comprises ligating equal amounts of the purified amplified parts with BsaI and T7 DNA ligase in a thermal cycler, which reads on a PCR instrument, at 37°C for 5 minutes and 20°C for 10 minutes for 30-50 cycles. This reads on mixing the 3 fragments in equal mounts according to concentrations, adding T7 ligase and BsaI enzyme and performing a reaction (instant claims 4 & 5).
The total volume for the ligation reaction was 20 uL, leaving 7 uL for the PCR amplified “parts”, which reads on taking 5-10µL of products (instant claim 3, line 6).
In the method of Xie, PTGs comprising two gRNA fragments required 3 PCR amplified “parts” to be assembled, which reads on amplifying three fragments and mixing the three fragments in claim 3 line 4 & 7-8 and claim 4 line 3).
It is not definite what “determining the three PCR products L1, L2 and L3” means in claim 3, but if it means detecting the presence of, the gel electrophoresis to identify a correct size band reads on this limitation. Alternatively, the requirement that equal amounts of the amplified fragments are added to the ligation reaction requires that the concentration of each fragment is determined. This also reads on the limitation of “determining the three PCR products” in claim 3.
Regarding claim 6, Xie teaches diluting the ligation product with water at a 1:10 dilution as a template for PCR amplification using a primer at each end of the PTG. It would have been obvious to one of ordinary skill in the art to try different dilutions of the ligation product to arrive a concentration of DNA that was appropriate for PCR; thus, taking 1uL of ligation product and diluting with 19uL of water would have been obvious to one of ordinary skill in the art prior to the filing of the instant application as part of routine optimization of parameters for PCR. One of ordinary skill in the art would have had reasonable expectation of success, because optimization of PCR parameters, including concentration of DNA template, was routine in the art prior to the filing of the instant application. Although Xie and Guo are silent about using the product for electrophoresis detection and how much of the product is loaded into a gel for electrophoresis, Xie teaches PCR product was purified and teaches other methods of purifying PCR product by excising bands from agarose gel after electrophoresis. One of ordinary skill in the art would have been motivated to take PCR product for electrophoresis detection in order to purify the product of the appropriate size. One of ordinary skill in the art would have been motivated to optimize the volume of product used as part of routine optimization of parameters based on factors such as well size and DNA concentration; too little DNA would not provide sufficient material for purifying and too much would not provide a clear band. Arriving at 5uL of product through routine optimization would have been obvious. One of ordinary skill in the art would have had reasonable expectation of success in optimizing gel electrophoresis of the product, because gel electrophoresis was routine prior to the filing of the instant application. Finally, although Guo and Xie do not teach a product size of 500bp for the PCR amplification of the ligation products, Xie does teach PTGs produced via ligation with 367 nucleotides, 711 nucleotides, or more. PTGs comprise gRNA scaffolds, pre-tRNA, and gRNA spacers (table S1). The exact length of the PCR product of the amplification of the ligation product would depend on the design of the gRNA targets, the spacers, and other features. It would have been obvious to one of ordinary skill in the art as part of routine laboratory design to try different sequences to optimize the PTG protocol, some of which would have led to a product size of 500bp.
Claims 1-6 are obvious over Guo, Xie, and NCBI Reference Sequence NC_089036.1.
Claim(s) 7 is rejected under 35 U.S.C. 103 as being unpatentable over Guo, Xie, and NCBI Reference Sequence NC_089036.1 taken with the evidence of NCBI reference page for Gene ID 4330586 as applied to claims 1-6 above, and further in view of Promega T4 ligase product sheet Part #9PIM180 (revised April 2018, hereafter T4 ligase product sheet).
Claim 7 is drawn to the method wherein digested PCR product and pRGEB32 are ligated with T4 ligase overnight.
The teachings of over Guo, Xie, and NCBI Reference Sequence NC_089036.1 are presented above. They do not teach mixing the digested PCR products and digested vector in equal amounts and ligating at 4°C overnight.
The T4 ligase product sheet recommends using a 1:1, 1:3, or 3:1 molar ratio of vector: insert DNA when cloning a fragment into a plasmid vector (second page, left column, paragraph 2). The T4 ligase product sheet teaches that sticky ends are ligated effectively at 4-8°C overnight and there is considerable latitude in the temperature and time needed for ligation (second page, right column, Note 1).
Before the filing date of the instant application, it would have been obvious to one of ordinary skill in the art to modify the method of Guo and Xie to mix the digested PCR product and digested pRGEB31 vector in equal amounts and to ligate with T4 ligase at 4°C overnight. One of ordinary skill in the art would have been motivated to mix in equal amounts, because this ratio was recommended by the T4 ligase product sheet. 1:1 ratio reads on equal amounts. One of ordinary skill in the art would have been motivated to perform the ligation at 4°C overnight because the T4 ligase product sheet taught this to be effective conditions for sticky end ligations. One of ordinary skill in the art would have had reasonable expectation of success, because ligation reaction optimization was routine in the art at the time of filing, and the conditions of the instant claims fall within the ranges suggested by the product sheet for T4 ligase.
Thus, Xie’s method comprising a step of digesting the purified PCR product with Fok I and ligating the fragment into BsaI digested pRGEB32 with T4 DNA ligase, in view of the T4 product sheet, reads on digesting the purified PCR product with FokI, digesting the target vector pRGEB32 with BsaI, recovering digested products separately, mixing, and ligating with T4 ligase (claim 7).
Claim(s) 8-9 are rejected under 35 U.S.C. 103 as being unpatentable over Guo, Xie, NCBI Reference Sequence NC_089036.1, and Promega T4 ligase product sheet, taken with the evidence of NCBI reference page for Gene ID 4330586 as applied to claims 1-7 above, and further in view of Eriksson (2018). Transformation of E. coli cells of strain DH5?. protocols.io https://dx.doi.org/10.17504/protocols.io.mqqc5vw (available 7/16/2018, hereafter Eriksson) and Dulk-Ras et al (1995) Methods in Molecular Biology. 55. Plant Cell Electroporation and Electrofusion Protocols. Chapter 4. 63-72. Nickoloff ed. (published 1995, hereafter Dulk-Ras).
Claims 8-9 are drawn to the method wherein the ligated vector is transformed into competent cells of E. coli and transgenic plants are obtained through resistance screening.
The teachings of Guo, Xie, NCBI Reference Sequence NC_089036.1, and Promega T4 ligase product sheet are presented above. They do not explicitly teach the steps of smearing E. coli, staying overnight at 37°C, picking a single colony for bacterial culture, and electroporating the plasmid into Agrobacterium.
Eriksson teaches a method for transformation of E. coli from ligation products that comprises spreading cells on plates and allowing the bacteria to grow over night in 37°C (page 3, step 6).
Dulk-Ras teaches a method of Agrobacterium transformation (page 66, section 3.2). Dulk-Ras teaches that cloning of binary vectors is traditionally done in E. coli, and the resulting vector is then introduced into A. tumefaciens for delivery to plant cells (page 63, paragraph 1-page 64, paragraph 1). Dulk-Ras teaches that electroporation efficiently introduces plasmids in A. tumefaciens (page 64, paragraph 2).
Before the filing date of the instant application, it would have been obvious to one of ordinary skill in the art to follow the E. coli transformation protocol of Eriksson and the Agrobacterium transformation protocol of Dulk-Ras in the method of transformation taught by Guo and Xie. One of ordinary skill in the art would have been motivated to use these methods because Guo and Xie are silent about the exact protocols used for E. coli and Agrobacterium transformation, and so use of one routine protocol over another would be routine laboratory optimization of parameters. One of ordinary skill in the art would have had reasonable expectation of success, because transformation protocols were well known in the art prior to the filing of the instant application.
The transformation of the ligation product into E. coli DH5α reads on transforming the ligated vector into competent cells of E. coli. Spreading transformed E. coli on plants and growing over night at 37°C reads on smearing and staying overnight at 37°C. Purification of plasmids and confirmation by Sanger sequencing reads on identifying the correctness through sequencing after plasmid extraction.
It would have been obvious to pick a single bacterial culture and identify whether the target fragment is ligated into the vector by PCR, because previous steps in the protocol comprise identifying the size of ligated fragments by PCR. One of ordinary skill in the art would have been motivated to confirm that the plasmid comprised the target fragment before extracting and transforming Agrobacterium with the plasmid. One of ordinary skill would have had reasonable expectation of success, because such methods were routine in the art of bacterial transformation prior to the instant filing date.
Regarding claim 9, transforming mature seed-derived calli of Nipponbare rice, as in Xie, reads on using mature embryo callus of wild-type rice Niponbare as explants. Agrobacterium-mediated co-cultivation transformation with strain EHA105, as in Guo, reads on performing infection transformation with Agrobacterium EHA105. Regenerating seedlings of stable transformants from the callus, as depicted in Xie, reads on tissue differentiation, rooting, and seedling refining. Although Xie does not teach resistance screening of the obtained transgenic plants, Xie does teach that the rice plants were transformed with a pRGEB32 vector comprising a gene with resistance to hygromycin. Thus, it would have been obvious to one of skill in the art to screen the transgenic plants for resistance to hygromycin to confirm presence of the plasmid. One of skill in the art would have had reasonable expectation of success, because resistance screening of transformants is routine in the art and would have been motivated to screen in order to quickly identify which rice cells had been successfully transformed.
Therefore, claims 1-9 are obvious in view of Guo, Xie, NCBI Reference Sequence NC_089036.1, Promega T4 ligase product sheet, Eriksson, and Dulk-Ras.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-F 8:00am-4pm EDT.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/VICTORIA L DELEO/Examiner, Art Unit 1662
/Anne Kubelik/Primary Examiner, Art Unit 1663