Prosecution Insights
Last updated: August 14, 2026
Application No. 19/341,325

SIRNA FOR TARGETED INHIBITION OF AGT GENE EXPRESSION AND USE THEREOF IN TREATING HYPERTENSION

Final Rejection §103§112
Filed
Sep 26, 2025
Priority
Sep 26, 2024 — CN 202411357089.7
Examiner
HUDSON, AMY ROSE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Hangzhou Tianlong Pharmaceutical Co. Ltd.
OA Round
2 (Final)
75%
Grant Probability
Favorable
3-4
OA Rounds
1y 6m
Est. Remaining
86%
With Interview

Examiner Intelligence

Grants 75% — above average
75%
Career Allowance Rate
1090 granted / 1454 resolved
+15.0% vs TC avg
Moderate +11% lift
Without
With
+11.4%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
77 currently pending
Career history
1513
Total Applications
across all art units

Statute-Specific Performance

§101
3.6%
-36.4% vs TC avg
§103
33.8%
-6.2% vs TC avg
§102
13.7%
-26.3% vs TC avg
§112
34.9%
-5.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1454 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant's election with traverse of group I and the species SEQ ID NOs: 11, 24, 209, 222, 423, and 488 in the reply filed on 3/19/26 is acknowledged. Upon further consideration, claim 14 has been rejoined (group II). Claims 14 and 15 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 3/19/26. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 8-13, 16, and 17 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claims are not limited to siRNAs, but are rather directed to double-stranded RNAi agents comprising an oligonucleotide duplex of the pairing of a sense and antisense strand wherein the sense strand has the sequence of SEQ ID NO: 209 or 423 and the antisense strand has the sequence of SEQ ID NO: 222 or 488, respectively. The specification does not define the length requirements oligonucleotides, but they are typically up to 100 nucleotides in length. The specification does not adequately describe oligonucleotide duplexes up to 100 nucleotides in length comprising the instant 20-mers in duplex that would have the required function. The claim language is directed to a double-stranded RNAi agent that comprises an oligonucleotide duplex and therefore can have additional sequence, wherein the sense and antisense strand have (comprise) the instantly recited sequences. The claims are not limited to the instantly recited sequences or to the length of siRNAs. The siRNAs that are specific for AGT of the specification are not representative of the entire claimed genus, wherein the genus encompasses dsRNAs that are around a hundred nucleotides in length and comprise the instant sequences that are shorter fragments. The claims encompass an enormous genus of double-stranded RNAi agents that would not likely have the required function due to the addition of approximately 80 additional non-specific nucleotides. The specification does not adequately describe the structure required for the function. The MPEP states that for a generic claim, the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. See MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad genus. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. Additionally, in Carnegie Mellon University v. Hoffman-La Roche Inc., Nos. 07-1266, -1267 (Fed. Cir. Sept. 8, 2008), the Federal Circuit affirmed that a claim to a genus described in functional terms was not supported by the specification’s disclosure of species that were not representative of the entire genus. Furthermore, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated: "A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398. The claims are rejected under the written description requirement for failing to disclose adequate species to represent the claimed genus, the genus being double stranded RNAi agents of any length that have a sequence shown in any of SEQ ID NOs: 1-13 or any fragment of any length thereof or any modified sequence of the sequence or the fragment that function by inhibiting AGT. The Guidelines for Examination of Patent Applications under the 35 USC § 112, first paragraph, “Written Description” Requirement”, published at Federal Register, Vol. 66, No. 4, pp. 1099-1111 outline the method of analysis of claims to determine whether adequate written description is present. The first step is to determine what the claim as a whole covers, i.e., discussion of the full scope of the claim. Second, the application should be fully reviewed to understand how applicant provides support for the claimed invention including each element and/or step, i.e., compare the scope of the claim with the scope of the description. Third, determine whether the applicant was in possession of the claimed invention as a whole at the time of filing. To achieve the desired function, it appears that the structure is required to be of a shorter length than the claimed genus which has no length limitation. With respect to siRNAs, as single species of RNAi agents, Elbashir et al. (The EMBO Journal, Vol. 20, No. 23, pages 6877-6888, 2001) teaches that duplexes of 21-23 nt RNAs are the sequence specific mediators of RNAi and that even single mismatches between the siRNA duplex and the target mRNA abolish interference (abstract and page 6888). Thus, having analyzed the claims with regard to the Written Description guidelines, it is clear that the specification does not disclose a representative number of species for RNAi agents within the instant enormous genus that are inhibitory of the target as claimed. Thus, one skilled in the art would be led to conclude that Applicant was not in possession of the claimed invention at the time the application was filed. Response to Arguments Applicant argues that due to the claim amendments, the nucleotide sequences, length and modifications of the double-stranded RNAi agent (dsRNAi agent) are definite, and all claimed dsRNAi agents are verified of functionality by experiments in the specification of the present application. Contrary to applicant’s arguments, the claims utilize open language and are not limited to the instantly recited sequences, but are rather limiting to the length of the oligonucleotide duplex region. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 8-13, 16, and 17 are rejected under 35 U.S.C. 103 as being unpatentable over Liu et al. (WO 2024/227458 A1), in view of Zhang et al. (WO 2024/141031 A1), Behlke (OLIGONUCLEOTIDES 18:305–320 (2008)), and Li et al. (Biochemical and Biophysical Research Communications 329 (2005) 1026–1030). All references are of record and cited in the previous office action. Liu et al. teach a siRNA wherein the antisense strand is the complement of instant SEQ ID NO: 11, which is a fragment of instant SEQ ID NO: 24, and therefore the sense strand is identical to instant SEQ ID NO: 11. See the PE2E sequence search result titled “us-19-341-325-11.szlim80.rng” as follows: RESULT 1 BQG31434 ID BQG31434 standard; RNA; 20 BP. AC BQG31434; DT 26-DEC-2024 (first entry) DE Modified Human AGT gene targeting antisense siRNA, SEQ ID 340. KW AGT gene; Angiotensinogen ligand; gene expression; gene silencing; KW phosphorothioate; prophylactic to disease; rna interference; KW short interfering RNA; siRNA; ss; therapeutic. OS Homo sapiens. OS Synthetic. CC PN WO2024227458-A2. CC PD 07-NOV-2024. CC PF 19-AUG-2024; 2024WO-CN113157. PR 22-AUG-2023; 2023CN-11056610. PR 07-FEB-2024; 2024CN-10174415. PR 07-JUN-2024; 2024CN-10742179. CC PA (LEAD-) LEADERNA THERAPEUTICS LTD. CC PI Liu Z, Wan J, Wang Z, Zhou J; DR WPI; 2024-B8659D/096. CC PT New small interfering RNA (siRNA) comprising sense strand and antisense CC PT strand useful for preparing medicament for treating pathological CC PT condition and disease associated with overexpression of the AGT gene e.g. CC PT abnormal blood pressure. XX CC PS Claim 1; SEQ ID NO 340; 243pp; Chinese. XX CC The present invention relates to a novel siRNA for inhibiting CC angiotensinogen (AGT) gene expression. The siRNA comprises: a sense CC strand and an antisense strand; where the antisense strand comprises at CC least 17 consecutive nucleotides that differ by no more than 4 CC nucleotides from the nucleotide sequence shown in any one of SEQ ID CC NO:102 to SEQ ID NO:192 (see BQG31196-BQG31286), SEQ ID NO:201 to SEQ ID CC NO:207 (see BQG31295-BQG31301), SEQ ID NO:209 to SEQ ID NO:220 (see CC BQG31303-BQG31314), SEQ ID NO:222 to SEQ ID NO:223 (see BQG31316- CC BQG31317), SEQ ID NO:225 to SEQ ID NO:233 (see BQG31319-BQG31327), SEQ ID CC NO:235 to SEQ ID NO:250 (see BQG31329-BQG31344), SEQ ID NO:252 to SEQ ID CC NO:291 (see BQG31346-BQG31385), SEQ ID NO:293 to SEQ ID NO:341 (see CC BQG31387-BQG31435), and SEQ ID NO:343 to SEQ ID NO:346 (see BQG31437- CC BQG31440), and the antisense strand is 17 to 30 nucleotides in length; CC the sense strand is 17 to 30 nucleotides in length and is at least CC partially complementary to the antisense strand. The invention also CC provides: a siRNA conjugate obtained by conjugating the siRNA with CC conjugation molecule; and a medicinal composition comprising siRNA and/or CC siRNA conjugate and a carrier. The siRNA is useful for preparing a CC medicament for treating and/or preventing pathological condition or CC disease associated with overexpression of the AGT gene e.g., disease CC related to abnormal blood pressure by inhibiting AGT gene expression. The CC siRNA has good stability. SQ Sequence 20 BP; 8 A; 1 C; 6 G; 0 T; 5 U; 0 Other; Query Match 100.0%; Score 20; Length 20; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CCACCTTTTCTTCTAATGAA 20 |||||||||||||||||||| Db 20 CCACCTTTTCTTCTAATGAA 1 Liu et al. recite: Claim 6: The siRNA according to any one of claims 1 to 5, characterized in that the siRNA contains at least one modified nucleotide. Claim 7: The siRNA according to claim 6, characterized in that all nucleotides in the sense strand and/or antisense strand of the siRNA are modified nucleotides or nucleotide analogs. Claim 8: The siRNA according to claim 7 is characterized in that: the modified nucleotide is selected from 2'-methoxy nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-split nucleotide analogs, 2'-fluoroarabino nucleotides, 2'-methoxyethyl nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, 3'-methoxy nucleotides, 2'-allyl modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates, nucleotides containing 5'-phosphate mimetics, diol-modified nucleotides, abasic nucleotides, morpholino nucleotides, locked nucleotides, unlocked nucleotides, threose nucleotides or glycerol nucleotides (instant claim 8). Claim 9: The siRNA according to any one of claims 1 to 8, characterized in that: the 5' end and the 3' end of the sense strand independently contain 0, 1 or 2 phosphorothioate linkages; and/or the 5' end and the 3' end of the antisense strand independently contain 1 or 2 phosphorothioate linkages. Claim 10: The siRNA according to any one of claims 1 to 9, characterized in that the first nucleotide at the 5' end of the antisense strand is a (E)-vinyl phosphate-modified nucleotide. Liu et al. teach that the siRNA comprises one or more single-stranded nucleotide overhangs. For example, an overhang of 1, 2, 3 or 4 nucleotides. Liu et al. recites conjugation of the siRNA to a ligand, more specifically GalNAc having the instantly recited structures (see claim 21) (instant claims 9-11). Liu et al. recite a pharmaceutical composition, characterized in that: the pharmaceutical composition comprises the siRNA according to any one of claims 1 to 18 and/or the siRNA conjugate according to any one of claims 19 to 22 and a pharmaceutically acceptable carrier (see claim 23) (instant claims 16 and 17). Liu et al. does not exemplify the specific pattern of SEQ ID NOs: 209, 222, 423, and 488. The modification pattern of SEQ ID NOs: 209 and 222 are alternating 2’-O-methyl and 2’-F with a 3’-thiophosphate at the first two nucleotides. It is noted that applicant was required to elect a single modification pattern from claims 12 and 13 that is consistent with the previously elected modification pattern from claim 8. The modification pattern of SEQ ID NOs: 423 and 488 is not the same as SEQ ID NOs: 209 and 222. The instant claims are not directed to any specific modification pattern that has demonstrated an unexpected property; and the modification patterns are considered to be a matter of design choice and routine optimization of known design elements. Zhang et al. teaches incorporation of 2’-O-methyl, 2’-F, and 3’ thiophosphate modifications; and teaches full modification of one or both strands. Liu et al. and Zhang et al. are evidence that combining the modifications in a vast array of patterns and positions is a matter of design choice (see pages 50-60 and 64-66 of Zhang et al.). It would have been prima facie obvious to perform routine optimization to determine placement of each of the modification types taught by Zhang et al. and instantly recited, as noted in In re Aller, 105 USPQ 233 at 235, More particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the particular range used was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art. Additionally, Behlke teaches alternating 2’F and 2’-O-methyl modifications in siRNAs (Table 1). It was routine in the art to combine the instantly recited modifications in various patterns and result in active siRNAs as evidenced by both Zhang et al. and Behlke, wherein Behlke teaches the same alternating pattern as claimed. It was known to incorporate 3’-thiophosphate modifications. Li et al. teach: In this study, we found that thiophosphate substituted siRNAs functioned as well as the native siRNAs in HeLa cell culture, and that some patterns of substitution increase the gene silencing ability of the thiophosphate siRNA over that of the same phosphodiester siRNA (page 1027). It would have been obvious to incorporate 3’-thiophosphoate modifications at varying positions as a matter of design choice with the expectation of the benefits taught by Li et al. Claim(s) 8-13, 16, and 17 is/are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (WO 2024/141031 A1), in view of Behlke (OLIGONUCLEOTIDES 18:305–320 (2008)) and Li et al. (Biochemical and Biophysical Research Communications 329 (2005) 1026–1030). Zhang et al. teaches a siRNA targeting AGT, wherein the siRNA comprises a sense strand that is identical to instant SEQ ID NO: 5 (5’-TGGGTTTTAAAATTAAAGTAT-3’) (see SEQ ID NO: 238 on page 70 of Zhang et al.). The antisense strand comprises a fragment of instant SEQ ID NO: 18 by comprising the complement of SEQ ID NO: 238 of Zhang et al. (instant claim 1). Zhang et al. teaches: Provided is an siRNA capable of inhibiting and targeting the angiotensinogen AGT gene expression. The siRNA contains a sense strand and an antisense strand respectively containing a nucleotide sequence I and a nucleotide sequence II, wherein the nucleotide sequence I and the nucleotide sequence II are respectively composed of 19 modified or unmodified nucleotides, the nucleotide sequence I and the nucleotide sequence II are at least partially complementary in reverse to form a double-stranded region, the nucleotide sequence II is at least partially complementary in reverse with a section of nucleotide sequence in the mRNA expressed by the AGT gene, and in the direction from the 5'-terminal to the 3'-terminal, at least one of the 3rd to 6th nucleotides in the nucleotide sequence II is a stabilized modified nucleotide. The siRNA, and a pharmaceutical composition and siRNA conjugate containing the siRNA can effectively treat diseases or conditions associated with AGT gene expression, such as hypertension (abstract). Zhang et al. teaches incorporation of phosphorothioate groups. Zhang et al. teaches incorporation of 3’ overhangs of 1-3 nucleotides. Zhang et al. teaches that each strand is composed of 19 modified nucleotides (abstract), wherein all nucleotides in the nucleotide sequence II are modified nucleotides; in the direction from the 5' end to the 3' end, the 2nd, 6th, 14th, and 16th nucleotides of the nucleotide sequence II, if not 2'-O-methoxyethyl-modified nucleotides, are 2'-fluoro-modified nucleotides, and the other nucleotides in the nucleotide sequence II are each independently one of the non-fluorinated modified nucleotides (claim 39) (instant claim 5). Zhang et al. teaches incorporation of UNA or GNA modifications. In some embodiments, the nucleotide analog is selected from one of isonucleotides, LNA, ENA, cET, UNA and GNA; and the modifications can be at all positions (page 26). Zhang et al. teaches conjugation to a ligand (instant claim 9), wherein the ligand is identical to the structures of instant claims 10, 11, and 13 (pages 37, 43-49, and 63). Zhang et al. teaches: the present disclosure further provides a pharmaceutical composition, which contains the siRNA provided by the present disclosure and a pharmaceutically acceptable carrier (instant claims 16 and 17). Zhang et al. teaches incorporation of 2’-O-methyl, 2’-F, and 3’ thiophosphate modifications; and teaches full modification of one or both strands. Zhang et al. does not exemplify the specific pattern of SEQ ID NOs: 209, 222, 423, and 488. The modification pattern of SEQ ID NOs: 209 and 222 are alternating 2’-O-methyl and 2’-F with a 3’-thiophosphate at the first two nucleotides. It is noted that applicant was required to elect a single modification pattern from claims 12 and 13 that is consistent with the previously elected modification pattern from claim 8. The modification pattern of SEQ ID NOs: 423 and 488 is not the same as SEQ ID NOs: 209 and 222. The instant claims are not directed to any specific modification pattern that has demonstrated an unexpected property; and the modification patterns are considered to be a matter of design choice and routine optimization of known design elements. Zhang et al. is evidence that combining the modifications in a vast array of patterns and positions is a matter of design choice (see pages 50-60 and 64-66 of Zhang et al.). It would have been prima facie obvious to perform routine optimization to determine placement of each of the modification types taught by Zhang et al. and instantly recited, as noted in In re Aller, 105 USPQ 233 at 235, More particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the particular range used was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art. Additionally, Behlke teaches alternating 2’F and 2’-O-methyl modifications in siRNAs (Table 1). It was routine in the art to combine the instantly recited modifications in various patterns and result in active siRNAs as evidenced by both Zhang et al. and Behlke, wherein Behlke teaches the same alternating pattern as claimed. It was known to incorporate 3’-thiophosphate modifications. Li et al. teach: In this study, we found that thiophosphate substituted siRNAs functioned as well as the native siRNAs in HeLa cell culture, and that some patterns of substitution increase the gene silencing ability of the thiophosphate siRNA over that of the same phosphodiester siRNA (page 1027). It would have been obvious to incorporate 3’-thiophosphoate modifications at varying positions as a matter of design choice with the expectation of the benefits taught by Li et al. Claim(s) 8-13, 16, and 17 is/are rejected under 35 U.S.C. 103 as being unpatentable over Cui et al. (US 2025/0066789 A1), in view of Zhang et al. (WO 2024/141031 A1), Behlke (OLIGONUCLEOTIDES 18:305–320 (2008)), and Li et al. (Biochemical and Biophysical Research Communications 329 (2005) 1026–1030). Cui et al. teaches a siRNA targeting AGT, wherein the siRNA comprises a sense strand that is identical to instant SEQ ID NO: 7 (5’-gttttaaaattaaagtataca-3’) (see SEQ ID NO: 3 on page 10 of Cui et al.). The antisense strand comprises a fragment of instant SEQ ID NO: 20 by comprising the complement of SEQ ID NO: 3 of Cui et al. Cui et al. teach: [0121] In some embodiments, the modified nucleotides are selected from the group consisting of deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2′-modified nucleotides, 3′-3′-linkage (inverted) nucleotides, nucleotides containing unnatural bases, bridged nucleotides, peptide nucleic acids (PNA), unlocked nucleobase analogues, locked nucleotides, 3′-O)-methoxy (2′ inter-nucleoside linkage) nucleotides, 2′-F-arabinose nucleotides, 5′-Me/2′-Fluoro-nucleotides, morpholino nucleotides, vinyl phosphonate deoxyribonucleotides, nucleotides containing vinyl phosphonate and nucleotides containing cyclopropyl phosphonate. Cui et al. teach combinations of 2’F and 2’-O-methyl modifications (Table 6); and teaches incorporation of thiophosphates ([0070]). Cui et al. teach: [0122] In some embodiments, the 2′-modified nucleotide includes: 2′-O-methyl nucleotide, 2′-deoxy-2′-fluoronucleotide, 2′-deoxynucleotide, 2′-methoxyethyl nucleotide, 2′-amino nucleotide and/or 2′-alkyl nucleotide. Cui et al. teach: [0117] In some embodiments, the dsRNA has a length of 21 nucleotides, and both the sense strand and antisense strand have protruding end of 2 nucleotide at the 3′ end. Cui et al. teach: [0039] In some embodiments, the RNAi agent or pharmaceutically acceptable salt thereof for inhibiting AGT gene expression further comprises a ligand, which is conjugated to the sense strand and/or antisense strand through a carrier structure (instant claim 9). Cui et al. teach that the ligand is N-acetylgalactosamine [0006] having the instantly recited structures (pages 21-27) (instant claims 10 and 11). Cui et al. teach: [0041] In yet another aspect, the present invention provides a pharmaceutical composition comprising the aforementioned RNAi agent or pharmaceutically acceptable salt thereof, or the aforementioned RNAi agent or pharmaceutically acceptable salt thereof for inhibiting AGT gene expression, and an optional pharmaceutically acceptable excipient, vehicle, and/or diluent (instant claims 16 and 17). Cui et al. does not teach UNA or GNA modifications and does not exemplify the specific pattern of SEQ ID NOs: 209, 222, 423, and 488. The modification pattern of SEQ ID NOs: 209 and 222 are alternating 2’-O-methyl and 2’-F with a 3’-thiophosphate at the first two nucleotides. It is noted that applicant was required to elect a single modification pattern from claims 12 and 13 that is consistent with the previously elected modification pattern from claim 8. The modification pattern of SEQ ID NOs: 423 and 488 is not the same as SEQ ID NOs: 209 and 222. The instant claims are not directed to any specific modification pattern that has demonstrated an unexpected property; and the modification patterns are considered to be a matter of design choice and routine optimization of known design elements. Zhang et al. teaches incorporation of UNA or GNA modifications. In some embodiments, the nucleotide analog is selected from one of isonucleotides, LNA, ENA, cET, UNA and GNA; and the modifications can be at all positions (page 26). Zhang et al. teach incorporation of the structures of part 2 of instant claim 7 on page 29. It would have been obvious to incorporate the modifications taught by Zhang et al. with an expectation of the benefits taught by Zhang et al. Zhang et al. teaches incorporation of 2’-O-methyl, 2’-F, and 3’ thiophosphate modifications; and teaches full modification of one or both strands. Cui et al. and Zhang et al. are evidence that combining the modifications in a vast array of patterns and positions is a matter of design choice (see pages 50-60 and 64-66 of Zhang et al.). It would have been prima facie obvious to perform routine optimization to determine placement of each of the modification types taught by Zhang et al. and instantly recited, as noted in In re Aller, 105 USPQ 233 at 235, More particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the particular range used was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art. Additionally, Behlke teaches alternating 2’F and 2’-O-methyl modifications in siRNAs (Table 1). It was routine in the art to combine the instantly recited modifications in various patterns and result in active siRNAs as evidenced by both Zhang et al. and Behlke, wherein Behlke teaches the same alternating pattern as claimed. It was known to incorporate 3’-thiophosphate modifications. Li et al. teach: In this study, we found that thiophosphate substituted siRNAs functioned as well as the native siRNAs in HeLa cell culture, and that some patterns of substitution increase the gene silencing ability of the thiophosphate siRNA over that of the same phosphodiester siRNA (page 1027). It would have been obvious to incorporate 3’-thiophosphoate modifications at varying positions as a matter of design choice with the expectation of the benefits taught by Li et al. Response to Arguments Applicant argues that as mentioned in the Office Action, the array of patterns and positions for siRNA is vast, and the design choice for specific modification pattern (types of modification, positions of modification, etc.) is not routine in the art. Applicant is arguing limitations that are not claimed. The instant claims are not directed to siRNAs, but rather ds RNAi agents comprising oligonucleotide duplexes. The specification does not demonstrate duplexes commensurate in scope with the claim language and are therefore not in fact limited to any specific pattern at any specific location because the recited sequences can take place in any location within longer oligonucleotides. The unexpected results argued by applicant are not representative of the entire claimed genus. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMY ROSE HUDSON/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Sep 26, 2025
Application Filed
Apr 09, 2026
Non-Final Rejection mailed — §103, §112
Jul 09, 2026
Response Filed
Jul 22, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12692496
COMPOSITIONS AND METHODS FOR MODULATING RPGR EXPRESSION
3y 11m to grant Granted Jul 28, 2026
Patent 12691135
INHIBITORS OF MICRO-RNA 22
3y 9m to grant Granted Jul 28, 2026
Patent 12686870
NOVEL TLR9 AGONISTS
4y 1m to grant Granted Jul 21, 2026
Patent 12685745
THERAPEUTIC CIRCULAR DNA FORMS
9m to grant Granted Jul 21, 2026
Patent 12680102
miRNAS FOR REDUCING VENTRICLE ENLARGEMENT
4y 5m to grant Granted Jul 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
75%
Grant Probability
86%
With Interview (+11.4%)
2y 5m (~1y 6m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 1454 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month