DETAILED ACTION
Response to Amendment
Applicant’s response to the office action filed on July 29, 2026 have been entered. The claims pending in this application are claims 1-17 wherein claims 14 and 15 have been withdrawn due to the restriction requirement in the office action mailed on April 30, 2026. The objections not reiterated from the previous office action are hereby withdrawn in view of applicant’s amendment filed on July 29, 2026. Claims 1-17 will be examined.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-13 are rejected under 35 U.S.C. 103 as being unpatentable over Kapteyn et al., (BMC Genomics, 11, 413, 2010) in view of Chenchik et al., (US Patent No. 5,962,272, published on October 5, 1999) and Hendrickson (US 2009/0191553 A1, published on July 30, 2009).
Regarding claims 1-4 and 6-13, Kapteyn et al., teach a method comprising: combining: a
template ribonucleic acid (RNA); a template switch oligonucleotide comprising a 3’ hybridization domain and a sequencing platform adapter construct (ie., a sequence near 5’ end of the template switch oligonucleotide), a template switching polymerase (ie., a reverse transcriptase such as SuperScript II); and dNTPs; in a reaction mixture under conditions sufficient to produce a product nucleic acid comprising the template RNA and the template switch oligonucleotide each of the template RNA and the template switch oligonucleotide hybridized to adjacent regions of a single product nucleic acid (ie., the first strand cDNA) comprising a region polymerized from the dNTPs by the polymerase; and wherein the single product nucleic acid has a partial or complete sequencing platform adapter sequence at its 3’ end (ie., a sequence at 3’ end of the first strand cDNA has an ability to be used as sequencing platform adapter sequence) as recited in claim 1 wherein the sequencing platform adapter construct comprises at least a portion of a nucleic acid domain (ie., having an ability to be) selected from the group consisting of: a domain that specifically binds to a surface-attached sequencing platform oligonucleotide, a sequencing primer binding domain, a barcode domain, a barcode sequencing primer binding domain, a molecular identification domain, and combinations thereof as recited in claim 2, the nucleic acid domain is a sequencing primer binding domain as recited in claim 3, the sequencing primer binding domain (ie., GGC near 5’ of Oligo-dT primer which is a part of the first strand cDNA or the single product nucleic acid recited in claim 1) binds to a Read 1 primer (ie., hybridizing to CCG of the Read 1 primer) or a Read 2 primer, and wherein the Read 1 primer has the sequence (5’ -ACACTCTT TCCCTACACGACGCTCTTCC GATCT-3’) (SEQ ID NO: 03) and the Read 2 primer has the sequence (5’-GTGACTGGAGTTC AGACGTGTGCTCTTCCGATC T-3’) (SEQ ID NO: 04) as recited in claim 4, the method further comprises contacting the template RNA with a first primer (ie., Oligo-dT primer) that primes the synthesis of the single product nucleic acid as recited in claim 6, the first primer comprises a first domain that hybridizes to the template RNA and a second domain that does not hybridize to the template RNA as recited in claim 7, the method further comprises subjecting the single product nucleic acid to nucleic acid amplification conditions (ie., cDNA amplification by long-distance PCR) as recited in claim 8, the amplification is carried out using a primer pair in which one or two primers of the primer pair include a sequencing platform adapter construct as recited in claim 9, the polymerase (ie., a reverse transcriptase such as SuperScript II) has terminal transferase activity as recited in claim 10, the polymerase is a reverse transcriptase as recited in claim 11, the reverse transcriptase is Moloney murine leukemia virus reverse transcriptase (MMLV-RT) (ie., SuperScript II is MMLV-RT ) as recited in claim 12, and the template RNA is a messenger RNA (mRNA) as recited in claim 13 (see pages 2, 7, and 8, and Figure 1).
Kapteyn et al., do not disclose that the template switch oligonucleotide is attached to a solid support as recited in claim 1 wherein the solid support is a bead as recited in claim 5.
Chenchik et al., teach a template switching oligonucleotide comprising a hapten group such as biotin in its 5’ end and incubating said RNA-cDNA-hapten intermediate with a binding ligand of said hapten group such as streptavidin wherein said binding ligand is conjugated to a support that is any known substrate which can be used for the immobilization of a binding ligand or oligonucleotide /polynucleotide sequences by any known method (see columns 6, second paragraph, column 13, fourth paragraph, and claims 1 and 16).
Hendrickson teaches to make a bead attached oligonucleotide by a linkage comprising biotin and a biotin-binding protein such as streptavidin (see paragraphs [0401] and [0403]).
Therefore, it would have been prima facie obvious to one having ordinary skill in the art at the time the invention was made to have performed the methods as recited in claims 1 and 5 wherein the template switch oligonucleotide is attached to a solid support such as a bead in view of the prior arts of Kapteyn et al., Chenchik et al., and Hendrickson. One having ordinary skill in the art would have been motivated to do so because Chenchik et al., teach a template switching oligonucleotide comprising a hapten group such as biotin in its 5’ end and incubating said RNA-cDNA-hapten intermediate with a binding ligand of said hapten group such as streptavidin wherein said binding ligand is conjugated to a support that is any known substrate which can be used for the immobilization of a binding ligand or oligonucleotide/polynucleotide sequences by any known method (see columns 6, second paragraph, column 13, fourth paragraph, and claims 1 and 16) while Hendrickson teaches to make a bead attached oligonucleotide by a linkage comprising biotin and a biotin-binding protein such as streptavidin (see paragraphs [0401] and [0403]). One having ordinary skill in the art at the time the invention was made would have a reasonable expectation of success to make a bead attached template switch oligonucleotide by incorporating a hapten group such as biotin to 5’ end of the template switch oligonucleotide taught by Kapteyn et al., and interacting the template switch oligonucleotide having the hapten group such as biotin with a bead conjugated with a binding agent for the hapten group such as a biotin binding protein (ie., streptavidin) and perform the methods recited in claims 1 and 5 using the bead attached template switch oligonucleotide in view of the prior arts of Kapteyn et al., Chenchik et al., and Hendrickson in order to purify the single product of nucleic acid (ie., template RNA-cDNA complex) recited in claim 1 by incorporating a bead to the single product of nucleic acid using the bead attached template switch oligonucleotide.
Response to Arguments
In page 5, sixth paragraph bridging to page 7, first paragraph of applicant’s remarks, applicant argues that “[A]n element of the claims is ‘combining… a template switch oligonucleotide wherein the template switch oligonucleotide is attached to a solid support… in a reaction mixture under conditions sufficient to produce a product nucleic acid’. Applicant submits that the combination of the cited art fails to teach or suggest the above element. In making the rejection, the Office asserts that Kapteyn does not disclose that the template switch oligonucleotide is attached to a solid support and that Chenchik teaches this element at column 6 2ⁿᵈ paragraph, column 13 4th paragraph, and claims 1 and 16. Column 6 2nd paragraph describes that the CAPswitch oligonucleotide may contain nucleotides that are labeled with a hapten group. Column 13 4th paragraph provides a definition for solid support. Claim 1 describes the general method of Chenchik and claim 16 specifically states ‘template switching oligonucleotide comprises at least one nucleotide with a hapten group, and further comprises the steps of incubating said RNA-cDNA-hapten intermediate with a binding ligand of said hapten group, where said binding ligand is conjugated to a support’. None of the above sections disclose that the template switch oligonucleotide is attached to a solid support when added to the reaction mixture and prior to the production of the product nucleic acid. The closest recited section to the claimed element is claim 16, however, claim 16 only describes that the template switch oligonucleotide comprises a nucleotide with a hapten group and that the RNA-cDNA hybrid is incubated with a binding ligand attached to a support. Accordingly, Chenchik fails to disclose a template switch oligonucleotide attached to a solid support prior to the production of the product nucleic acid, as is claimed. Chenchik does not even suggest the claimed element because the formation of the hapten- ligand-support complex is only ever mentioned in the definitions of ‘hapten’ and ‘solid support’, and in claim 16. None of these sections provide any indication that the complex is formed prior to the production of the RNA-cDNA intermediate, i.e., the product nucleic acid and the template mRNA, nor are there any sections of Chenchik that express a desire to form the hapten-ligand-support complex at any other point in time. Thus, Chenchik fails to teach or suggest a template switch oligonucleotide that is attached to a solid support prior to the production of the product nucleic acid. As Hendrickson is silent with respect to template switching, template switch oligonucleotides, and template switch oligonucleotides attached to solid supports, Hendrickson fails to remedy the deficiencies of the Kapteyn and Chenchik. As such, claims 1-13 are not obvious over Kapteyn in view of Chenchik and Hendrickson at least because the combination of the cited art fails to teach or suggest all elements of the claims”.
The above arguments have been fully considered but they are not persuasive toward the withdrawal of rejection.
First, the rejection is based on a combination of the prior arts of Kapteyn et al., Chenchik et al., and Hendrickson and is not dependent on a prior art of Kapteyn et al., or Chenchik et al., or Hendrickson alone.
Second, although applicant argues that “[K]apteyn does not disclose that the template switch oligonucleotide is attached to a solid support”, “[C]henchik fails to disclose a template switch oligonucleotide attached to a solid support prior to the production of the product nucleic acid, as is claimed”, and “[H]endrickson fails to remedy the deficiencies of the Kapteyn and Chenchik”, since Chenchik et al., teach a template switching oligonucleotide comprising a hapten group such as biotin in its 5’ end and incubating said RNA-cDNA-hapten intermediate with a binding ligand of said hapten group such as streptavidin wherein said binding ligand is conjugated to a support that is any known substrate which can be used for the immobilization of a binding ligand or oligonucleotide/polynucleotide sequences by any known method (see columns 6, second paragraph, column 13, fourth paragraph, and claims 1 and 16) while Hendrickson teaches to make a bead attached oligonucleotide by a linkage comprising biotin and a biotin-binding protein such as streptavidin (see paragraphs [0401] and [0403]), one having ordinary skill in the art at the time the invention was made would have a reasonable expectation of success to make a bead attached template switch oligonucleotide by incorporating a hapten group such as biotin to 5’ end of the template switch oligonucleotide taught by Kapteyn et al., and interacting the template switch oligonucleotide having the hapten group such as biotin with a bead conjugated with a binding agent for the hapten group such as streptavidin and perform the methods recited in claims 1 and 5 using the bead attached template switch oligonucleotide in view of the prior arts of Kapteyn et al., Chenchik et al., and Hendrickson in order to purify the single product of nucleic acid (ie., template RNA-cDNA complex) recited in claim 1 by incorporating a bead to the single product of nucleic acid using the bead attached template switch oligonucleotide. Furthermore, applicant has on evidence to show why a bead attached template switch oligonucleotide cannot be made by one having ordinary skill in the art at the time the invention was made in view of Kapteyn et al., in view of Chenchik et al., and Hendrickson.
Claims 16 and 17 are rejected under 35 U.S.C. 103 as being unpatentable over Kapteyn et al., in view of Chenchik et al., and Hendrickson as applied to claims 1-13 above, and further in view of Islam et al., (Nature Protocols, 7, 813-828, 2012).
The teachings of Kapteyn et al., Chenchik et al., and Hendrickson have been summarized previously, supra.
Kapteyn et al., Chenchik et al., and Hendrickson do not disclose that the template RNA is isolated from less than 9 cells as recited in claim 16 wherein the less than 9 cells is a single cell as recited in claim 17. However, Kapteyn et al., teach that RNA is isolated from glandular trichome sample (see page 7, right column).
Islam et al., teach synthesis of a first-strand cDNA using RNA isolated from a single cell in the presence of a reverse transcriptase and a template switching oligonucleotide (see abstract and Figure 1).
Therefore, it would have been prima facie obvious to one having ordinary skill in the art at the time the invention was made to have performed the methods as recited in claims 16 and 17 wherein the template RNA is isolated from a single cell in view of the prior arts of Kapteyn et al., Chenchik et al., Hendrickson, and Islam et al., One having ordinary skill in the art would have been motivated to do so because Islam et al., teach synthesis of a first-strand cDNA using mRNA isolated from a single cell in the presence of a reverse transcriptase and a template switching oligonucleotide (see abstract and Figure 1) and the simple substitution of one kind of template RNA (ie., the RNA isolated from glandular trichome sample taught by Kapteyn et al.,) from another kind of template RNA (ie., the RNA isolated from a single cell taught by Islam et al.,) during the process of performing the method recited in claim 1, in the absence of convincing evidence to the contrary, would have been prima facie obvious to one having ordinary skill in the art at the time the invention was made since the RNA isolated from glandular trichome sample taught by Kapteyn et al., and the RNA isolated from a single cell taught by Islam et al., are used for the same purpose (ie., making a first-strand cDNA) and are exchangeable. One having ordinary skill in the art at the time the invention was made would have a reasonable expectation of success to perform the methods recited in claims 16 and 17 by substituting the RNA isolated from glandular trichome sample taught by Kapteyn et al., from the RNA isolated from a single cell taught by Islam et al., in view of the prior arts of Kapteyn et al., Chenchik et al., Hendrickson, and Islam et al..
Furthermore, the motivation to make the substitution cited above arises from the expectation that the prior art elements will perform their expected functions to achieve their expected results when combined for their common known purpose. Support for making the obviousness rejection comes from the M.P.E.P. at 2144.06, 2144.07 and 2144.09.
Also note that there is no invention involved in combining old elements is such a manner that these elements perform in combination the same function as set forth in the prior art without giving unobvious or unexpected results. In re Rose 220 F.2d. 459, 105 USPQ 237 (CCPA 1955).
Response to Arguments
In page 7, second paragraph bridging to page 8, first paragraph of applicant’s remarks, applicant argues that “[A]s discussed above, the combination of Kapteyn in view of Chenchik and Hendrickson fails to teach or suggest the element of ‘combining… a template switch oligonucleotide wherein the template switch oligonucleotide is attached to a solid support… in a reaction mixture under conditions sufficient to produce a product nucleic acid’. With regard to Islam, Isam also fails to teach or suggest the above element. Firstly, Islam discloses the template switch oligonucleotide used in their method on pg. 817 column 1 4th paragraph. Nowhere within this section is there a mention that the template switch oligonucleotide is attached to a solid support, nor is there any mention that the template switch oligonucleotide has been modified such that it could be attached to a solid support” and “[I]slam also fails to remedy the deficiencies of Kapteyn in view of Chenchik and Hendrickson”.
The above arguments have been fully considered but they are not persuasive toward the withdrawal of rejection because Kapteyn et al., in view of Chenchik et al., and Hendrickson teach all limitations recited in claim 1 (see above Response to Arguments related to the Rejection Item 3).
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Frank Lu, Ph. D., whose telephone number is (571)272-0746. The examiner can normally be reached Monday to Friday, 9 AM to 5 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/ interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anne Gussow, Ph.D., can be reached at 571-272-6047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/FRANK W LU/
Primary Examiner, Art Unit 1683
August 14, 2026
Prosecution Insights