DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Specification
The use of the term “ATCC” on page 122; “Lipofectamine RNAiMax” on page 108 ; “Trizol” on page 108; and “TagMAN” on page 115, which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Due to the limited amount of time the Office has to review the specification, as a courtesy to the examiner, please review the entire specification for any additional trade names or marks.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Interpretation
The claimed invention embraces an antisense oligonucleotide conjugate to an anti-transferrin receptor antibody or fragment thereof, wherein the oligonucleotide starting from its 5’ end is at least 90% complementary to nucleotides 1897-1917 or nucleotides 1927-1947 of the human PRKAG2 mRNA set forth in SEQ ID NO: 237, wherein the oligonucleotide mediates downregulation of the human PRKAG2 mRNA in a cardiac muscle cell.
Page 102 of the specification discloses that instant SEQ ID NO: 237 is a human PKRAG2 nucleotide sequence (GenBank NM_012603.4). The specification discloses that the human PRKAG2 nucleotide sequence is known in the prior art as set forth in GenBank NM_012603.4.
The working examples in the specification disclose that double stranded RNA comprising SEQ ID NOs: 211 or 212 or SEQ ID NOs: 223 or 224 can reduce PRKAG2 expression in cardiac cells and treat cardiomyopathy. See pages 109-130.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 10 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 10 recites the limitation " the guide strand" in line 1 and “passenger strand” on line 2. There is insufficient antecedent basis for this limitation in the claim.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-3, 6-8, and 11-15 are rejected under 35 U.S.C. 103 as being unpatentable over Fitzgerald et al. (WO 2011038031) taken with Darimont et al. (US 2020/0325237.
‘031 teaches PCSK9 siRNA for treating hyperlipidemia and other forms of lipid imbalance such as hypercholesterolemia, hypertriglyceridemia, and other forms of lipid imbalance and pathological conditions associated with heart and circulatory diseases (pages 73-80 and 131-133). Pages 4-5, 9, 11 and 22-25 of '031 teach using a linker to attach another molecule to the siRNA and the siRNA having at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety. The siRNA can be linked to a ligand including a targeting group e.g., an antibody (page 30).
Two of the siRNA taught by ‘031 have a strand that has 90% complementary to nucleotides 1897-1917 of SEQ ID NO: 237 recited in the instant claims. See below for alignment:
Qy is nucleotides 1897-1917 of SEQ ID NO: 237.
siRNA comprising SEQ ID NO: 1641 (sense strand) and SEQ ID NO: 1642 (antisense strand, Db) taught by ‘031:
aaagttgtagatatttattc (Qy)
ttuugaacuucuauaaauaag (Db)-antisense
aacuugaagauauuuauuctt -sense
siRNA comprising SEQ ID NO: 1643 (sense strand) and SEQ ID NO: 1644 (antisense strand, Db).
aaagttgtagatatttattc (Qy)
acuugaagauauuuauucutt-sense
ttugaacuucuauaaauaaga (Db)-antisense
However, ‘031 does not specifically teach conjugating an anti-transferrin receptor antibody or fragment thereof to the PCSK9 siRNA.
Anti-transferrin receptor antibodies were well known in the prior art and can be connected to a drug (siRNA) to deliver the drug to cells as taught by Darimont (pages 1-15, 19-32 and 107). Darimont teaches using a linker (maleimide-based) to connect the antibody to the drug (paragraph 7). Darimont teaches the structural limitations of the anti-transferrin receptor antibody set forth in instant claims 12 and 13 (pages 4-15). See SEQ ID NOs: 13 (Db) and 17 (Db) which read on SEQ ID NO: 256 (Qy) and 260 (Qy), respectively.
PNG
media_image1.png
131
615
media_image1.png
Greyscale
PNG
media_image2.png
130
582
media_image2.png
Greyscale
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘031 taken with Darimont to attach an anti-transferrin receptor antibody to the PCSK9 siRNA, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to assist in the delivery of the siRNA to a cell. The limitation in claim 2 is an inherent property of the siRNA taught by ‘031 because claim 2 does not add any additional structures to the polynucleotide conjugate of claim 1 and the siRNA taught by ‘031 reads on an siRNA embraced by the claimed product.
Pages 4-5, 9, 11 and 22-25 of '031 teach using a linker to attach another molecule to the siRNA. These pages of ‘031 also teach the limitations in instant claims 6-8 directed to the siRNA having at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety. It would have been obvious to one of ordinary skill in the art to chemically modify the siRNA using the modifications set forth in claim 6-8 to increase the bioavailability of the siRNA in a cell line or a subject.
Darimont teaches the anti-transferrin receptor antibody comprising VH sequence of SEQ ID NO: 256 and VL sequence of SEQ ID NO: 260 and the structural limitations of the anti-transferrin receptor antibody set forth in instant claim 20 (pages 4-15). See SEQ ID NO: 13 and 17, respectively. One of ordinary skill in the art would have been motivated to connect the antibody to the siRNA using a linker to assists in connection of the antibody to the siRNA (paragraph 7 of Darimont). It would have been obvious to try siRNA to antibody ratio of from about 1 to about 4 to optimize the bioavailability of the siRNA-conjugate in a cell line or a subject (paragraph 7 of Darimont). Paragraph 350 discloses using a maleimide-based linker to attach the antibody to a drug (siRNA).
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claim 9 is rejected under 35 U.S.C. 103 as being unpatentable over ‘031 taken with Darimont as applied to claims 1-3, 6-8, and 11-15 above, and further in view of Parmar et al. (ChemBioChem 2016, 17, 985-989).
‘031 and Darimont do not specifically teach the siRNA comprising a 5’ terminal vinlyphosphonate modified nucleotide.
However, Parmar teaches that incorporation of 5’-(E)-vinylphosphonate results in up to 20-fold improved in vitro potency and up to a threefold benefit in vivo activity by promoting Ago2 loading and enhancing metabolic stability (abstract).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘031 and Darimont taken with Parmar to make a siRNA comprising a 5’ terminal vinlyphosphonate modified nucleotide to increase the potency of the siRNA.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Double Patenting
A rejection based on double patenting of the “same invention” type finds its support in the language of 35 U.S.C. 101 which states that “whoever invents or discovers any new and useful process... may obtain a patent therefor...” (Emphasis added). Thus, the term “same invention,” in this context, means an invention drawn to identical subject matter. See Miller v. Eagle Mfg. Co., 151 U.S. 186 (1894); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Ockert, 245 F.2d 467, 114 USPQ 330 (CCPA 1957).
A statutory type (35 U.S.C. 101) double patenting rejection can be overcome by canceling or amending the claims that are directed to the same invention so they are no longer coextensive in scope. The filing of a terminal disclaimer cannot overcome a double patenting rejection based upon 35 U.S.C. 101.
Claim 10 is rejected under 35 U.S.C. 101 as claiming the same invention as that of claim 10 of prior U.S. Patent No. 12491257. This is a statutory double patenting rejection. Both claims are directed to a polynucleotide conjugate, wherein the polynucleotide conjugate comprises an anti-transferrin receptor antibody or antigen-binding fragment conjugated to a polynucleotide that targets a human PRKAG2 mRNA, wherein the polynucleotide is double stranded, wherein the guide strand is SEQ ID NO: 211 or 212 and the passenger strand is SEQ ID NO: 223 or 224.
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-9 and 11-25 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-22 of U.S. Patent No. 12491257. Although the claims at issue are not identical, they are not patentably distinct from each other because both set of claims embrace a polynucleotide conjugate comprising an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a polynucleotide that hybridizes to a target sequence of a human PRKAG2 mRNA and mediates downregulation of the human PRKAG2 mRNA in a cardiac muscle cell, wherein the polynucleotide is a double-stranded small interfering RNA (siRNA) comprising a guide strand and a passenger strand, wherein the guide strand comprises the nucleic acid sequence selected from SEQ ID NOs: 211 and 212 and the passenger strand comprises SEQ ID NOs: 223 and 224. The siRNA comprising SEQ ID NOs: 211 and 212 or SEQ ID NOs: 223 and 224 read on the chemical modifications set forth in instant claims 6-9 and 18-21. The conjugate comprising an anti-transferrin receptor antibody or fragment thereof in instant claims 11-15 are obvious variants of the antibody in claims 12-13 and 18 of ‘257. The method in claims 15-17 of ‘157 are obvious variants of instant claims 23-25.
Claims 1-25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-18 of co-pending Application No. 19383467 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because both set of claims embrace treating a cardiomyopathy in a subject in need thereof comprising administering to a subject an effective amount of a polynucleotide conjugate, wherein the polynucleotide conjugate comprises an anti-transferrin receptor antibody or antigen-binding fragment conjugated to a polynucleotide that targets a human PRKAG2 mRNA, wherein the polynucleotide is double stranded comprising SEQ ID NOs: 211, 212, 223, 224. NOTE: there is no sequence listing of record in ‘467, but a comparison of SEQ ID NOs: 211, 212, 223, and 224 in claims 8 and 9 of ‘467 appear to read on the same SEQ ID NOs: for the siRNA set forth in the instant claims. See table 13 on pages 120-211 of ‘467 disclosure. SEQ ID NOs: 223 and 212 are chemically modified PRKAG2 siRNA that read on the chemical modifications set forth in instant claims 6-9 and.18-21. The claims of ‘467 do not specifically recite the SEQ ID NOs: for the anti-transferrin antibody set forth in instant claim 13, but when one of ordinary skill in the art looks for the definition of the anti-transferrin antibody, they would arrive at SEQ ID NOs: 256-260 and 261-265 on pages 43-46 of the ‘467 disclosure. In view of the siRNA reading on the siRNA recited in the instant claims and method of using the siRNA recited in the claims of ‘467 are directed to treating cardiomyopathy, one of ordinary skill in the art would conclude that the invention defined in the instant claims would have been an obvious variant of the invention defined in the claims of co-pending application ‘467.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Allowable Subject Matter
The prior art does not teach or suggest a nucleotide sequence having at least 90% complementary to a 20 nucleotide sequence region (1927-1947) of SEQ ID NO: 237.
The closest prior art is ‘031, which teaches siRNA PCSK9. PCSK9 has a different nucleotide sequence and encodes a different protein than the nucleotide sequence for human PRKAG2, it would not have been obvious for one of ordinary skill in the art to modify at least one nucleotide of these siRNA to make the PCKS9 siRNA have at least 95% complementary to the regions of the human PRKAG2 set forth in SEQ ID NO: 237. In addition, the specification does not disclose that the method used to make the siRNA was based on any known siRNA protocol. The specification provides sufficient description of siRNA that target these regions of SEQ ID NO: 237 (pages 109-130). One of ordinary skill in the art would possess the knowledge that there are various algorithms and programs for making siRNA. See Table 1 Martinelli (Health Science Reviews, 11 (2024), pages 1-11); Table 2 of Fakhr (Cancer Gene Therapy (2016) 23, 73-82) and Watts et al. (Journal of Pathology 226:365-379, 2012). Each program has advantages and disadvantages and each program results in the production of siRNAs with different nucleotide sequences based on different parameters. As taught by Martinelli, Watts, and Fakhr the siRNA have to be further tested to determine if they can reduce the target sequence in a cell. Unless the prior art teaches the instant siRNA, there is no motivation for one of ordinary skill in the art to select one siRNA designer program over another program and target these specific regions of SEQ ID NO: 237 and reasonably expect to arrive at these claimed sequences. See MPEP 2143(I)E. Thus, there is not a finite number of identified and predictable solutions to arrive at the siRNA set forth in the instant claims.
A sequence search of the prior art does not teach or suggest making siRNA comprising SEQ ID NOs: 211 or 212 or 223 or 224 recited in claims 10 and 22.
The method claims 23-25 are free of the prior art because the prior art does not teach or suggest targeting these two regions of SEQ ID NO: 237 to treat cardiomyopathy in a subject in nee thereof. The closest prior art (‘031) is directed to using PCSK9 siRNA to treat metabolism disorders, including cardiac metabolism disorders. PCSK9 is a well-known lipid metabolism gene. However, ‘031 does not teach using PCSK9 siRNA for treating cardiomyopathy in a subject in need thereof. The prior art teaches that some studies link PCSK9 deficiency to cardiomyopathy and others have found no direct association between PCSK9 and cardiomyopathy. For example, see Xu et al. (Biomedicine & Pharmacotherapy Vo. 158, 114106, pages 1-10, 2023). Thus, there is no reasonable expectation for one of ordinary skill in the art to use PSCK9 siRNA to treat cardiomyopathy in a subject in need thereof.
Conclusion
See attached PTO-326 for disposition of claims.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636