Prosecution Insights
Last updated: July 17, 2026
Application No. 19/376,782

COMPOSITIONS AND METHODS OF USING PRKAG2-TARGETING ANTIBODY-OLIGONUCLEOTIDE CONJUGATES

Final Rejection §103§DP
Filed
Oct 31, 2025
Priority
Jun 27, 2023 — provisional 63/510,531 +1 more
Examiner
WHITEMAN, BRIAN A
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Atrium Therapeutics, Inc.
OA Round
2 (Final)
68%
Grant Probability
Favorable
3-4
OA Rounds
1y 11m
Est. Remaining
85%
With Interview

Examiner Intelligence

Grants 68% — above average
68%
Career Allowance Rate
792 granted / 1159 resolved
+8.3% vs TC avg
Strong +17% interview lift
Without
With
+16.7%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
51 currently pending
Career history
1197
Total Applications
across all art units

Statute-Specific Performance

§101
1.8%
-38.2% vs TC avg
§103
43.0%
+3.0% vs TC avg
§102
15.2%
-24.8% vs TC avg
§112
11.6%
-28.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1159 resolved cases

Office Action

§103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Specification The amended specification filed on 5/19/26 has been entered. Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Claim Rejections - 35 USC § 103 The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. The broadest reasonable interpretation of the new limitation (comprises at least 16 consecutive nucleotides from a sequence that is complementary to a target sequence, which corresponds to positions 1897-1917 or positions 1927-1947 of the human PRKAG2 mRNA set forth in SEQ ID NO: 237) in instant claim 1 reads on any sequence that has at least 16 nucleotides complementary to positions 1897-1917 or positions 1927-1947 of SEQ ID NO: 237. The specification does not provide a definition for term ‘complementary’ but provides examples of the term (see paragraph 76). A nucleic acid can be at least 40% complementary to the target sequence of PRKAG2 mRNA. The limitation does not require 16 nucleotides that are 100% complementary to either positions of the instant SEQ ID NO: and reads on a sequence that is at least 40% complementary to at least 16 nucleotides of positions 1897-1917 or positions 1927-1947 of SEQ ID NO: 237. Claims 1-3, 6-8, and 11-15 are rejected under 35 U.S.C. 103 as being unpatentable over Fitzgerald et al. (WO 2011038031) taken with Darimont et al. (US 2020/0325237), both of record. '031 teaches PCSK9 siRNA for treating hyperlipidemia and other forms of lipid imbalance such as hypercholesterolemia, hypertriglyceridemia, and other forms of lipid imbalance and pathological conditions associated with heart and circulatory diseases (pages 73-80 and 131-133). Pages 4-5, 9, 11 and 22-25 of '031 teach using a linker to attach another molecule to the siRNA and the siRNA having at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety. The siRNA can be linked to a ligand including a targeting group e.g., an antibody (page 30). Two of the siRNA taught by '031 have a strand that has complementary to at least 16 consecutive nucleotides 1897-1917 of SEQ ID NO: 237 recited in the instant claims. See below for alignment: Qy is nucleotides 1897-1917 of instant SEQ ID NO: 237. ‘031 discloses siRNA comprising SEQ ID NO: 1641 (sense strand) and SEQ ID NO: 1642 (antisense strand, Db): aaagttgtagatatttattc (Qy) aacuugaagauauuuauuct -sense ttuugaacuucuauaaauaag (Db)-antisense; ‘031 further teaches siRNA comprising SEQ ID NO: 1643 (sense strand) and SEQ ID NO: 1644 (antisense strand, Db). aaagttgtagatatttattc (Qy) acuugaagauauuuauucutt-sense ttugaacuucuauaaauaaga (Db)-antisense However, '031 does not specifically teach conjugating an anti-transferrin receptor antibody or fragment thereof to the PCSK9 siRNA. Anti-transferrin receptor antibodies were well known in the prior art and can be connected to a drug (siRNA) to deliver the drug to cells as taught by Darimont (pages 1- 15, 19-32 and 107). Darimont teaches using a linker (maleimide-based) to connect the antibody to the drug (paragraph 7). Darimont teaches the structural limitations of the anti-transferrin receptor antibody set forth in instant claims 12 and 13 (pages 4-15). See SEQ ID NOs: 13 (Db) and 17 (Db) which read on SEQ ID NO: 256 (Qy) and 260 (Qy), respectively. It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of '031 taken with Darimont to attach an anti-transferrin receptor antibody to the PCSK9 siRNA, namely to arrive at the claimed invention. NOTE: even though the siRNA taught by Fitzgerald targets a different nucleotide sequence, the siRNA taught by Fitzgerald has the same structure as recited in the instant claims and would have the same properties, including mediating downregulation of the human PRKAG2 mRNA in a cardiac muscle cell. One of ordinary skill in the art would have been motivated to combine the teaching to assist in the delivery of the siRNA to a cell. The limitation in instant claim 2 is an inherent property of the siRNA taught by '031 because claim 2 does not add any additional structures to the polynucleotide conjugate of claim 1 and the siRNA taught by '031 reads on an siRNA embraced by the claimed product. Pages 4-5, 9, 11 and 22-25 of '031 teach using a linker to attach another molecule to the siRNA. These pages of '031 also teach the limitations in instant claims 6-8 directed to the siRNA having at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety. It would have been obvious to one of ordinary skill in the art to chemically modify the siRNA using the modifications set forth in claim 6-8 to increase the bioavailability of the siRNA in a cell line or a subject. Darimont teaches the anti-transferrin receptor antibody comprising VH sequence of SEQ ID NO: 256 and VL sequence of SEQ ID NO: 260 and the structural limitations of the anti-transferrin receptor antibody set forth in instant claim 20 (pages 4-15). See SEQ ID NO: 13 and 17, respectively. One of ordinary skill in the art would have been motivated to connect the antibody to the siRNA using a linker to assists in connection of the antibody to the siRNA (paragraph 7 of Darimont). It would have been obvious to try siRNA to antibody ratio of from about 1 to about 4 to optimize the bioavailability of the siRNA-conjugate in a cell line or a subject (paragraph 7 of Darimont). Paragraph 350 discloses using a maleimide-based linker to attach the antibody to a drug (siRNA). Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Response to Arguments Applicant's arguments filed 5/19/26 have been fully considered but they are not persuasive. In response to applicant’s argument that the pending claims are free of the prior art because of the amendment to the independent claim to recite “at least 16 consecutive nucleotides from a sequence that is complementary to a target sequence of a human PRKAG2 mRNA and mediates downregulation of the human PRKAG2 mRNA in a cardiac muscle cell, wherein the target sequence corresponds to positions 1897-1917 or positions 1927-1947 of the human PRKAG2 mRNA set forth in SEQ ID NOL 237 from the 5’ end” is not found persuasive because the broadest reasonable interpretation of the limitation reads on any sequence that has at least 16 nucleotides complementary to positions 1897-1917 or positions 1927-1947 of SEQ ID NO: 237. The specification does not appear to provide a definition for term ‘complementary,’ but provides examples of the term (see paragraph 76). A nucleic acid can be at least 40% complementary to a target sequence of PRKAG2 mRNA. The limitation does not require 16 nucleotides that are 100% complementary to either positions of the instant SEQ ID NO: and reads on a sequence that is at least 40% complementary to at least 16 nucleotides of positions 1897-1917 or positions 1927-1947 of SEQ ID NO: 237. In response to applicant’s argument that the prior art teaches PCSK9 siRNA, which is different than the claimed invention directed to PRKAG2 siRNA, the argument is not found persuasive because while it is acknowledged that the prior art is directed to targeting a different sequence, the prior art teaches a siRNA that reads on the structural limitations of the instant claims and would thus have the same properties as the claimed product. Although Fitzgerald and Darimont are silent with respect to the functional limitations (mediates downregulation of the human PRKAG2 mRNA in a cardiac muscle cell) of the instant claims, Fitzgerald makes obvious all of the claimed structural limitations of the polynucleotide, so the functional limitations of the claimed product are considered to be inherent in the product made obvious by Fitzgerald and Darimont. Where, as here, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his claimed product. See In re Ludtke 441 F.2d 660, 169 USPQ 563 (CCPA 1971). Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972). Applicant further argues that the Office noted that the unless the prior art teaches the instant siRNA, one of ordinary skill in the art could have reasonably expected that the claimed siRNA could target the specific region of the human PRKAG set forth in SEQ ID NO: 237 (see pages 13-14 of the office action, the argument is not found persuasive for the reasons set forth above, which are incorporated herein. In addition, the applicant appear to have misconstrued the statement on pages 13-14 of the office action. Pages 13-14 of the office action are directed to whether or not there is reasonable expectation for making the claimed product based on using any known siRNA algorithm in the prior art and not reasonable expectation of success for when the product has the same structure as recited in the instant claims. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). This is the case here because the rejection is under 103 and not 102 and the rejection is based on Fitzgerald taken with Darimont and not Darimont alone. Claim 9 is rejected under 35 U.S.C. 103 as being unpatentable over '031 taken with Darimont as applied to claims 1-3, 6-8, and 11-15 above, and further in view of Parmar et al. (ChemBioChem 2016, 17, 985-989). '031 and Darimont do not specifically teach the siRNA comprising a 5' terminal vinlyphosphonate modified nucleotide. However, Parmar teaches that incorporation of 5'-(E)-vinylphosphonate results in up to 20-fold improved in vitro potency and up to a threefold benefit in vivo activity by promoting Ago2 loading and enhancing metabolic stability (abstract). It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of '031 and Darimont taken with Parmar to make a siRNA comprising a 5' terminal vinlyphosphonate modified nucleotide to increase the potency of the siRNA. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Response to Arguments Applicant's arguments filed 5/19/26 have been fully considered but they are not persuasive for the reasons set forth above, which are incorporated herein. The applicant provides the same arguments as set forth above and further states that the Parmar does not teach the claimed invention. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). This is the case here because the rejection is under 103 and not 102 and the rejection is based on Fitzgerald and Darimont taken with Parmar and not Parmar alone. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-9 and 11-25 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-22 of U.S. Patent No. 12491257, of record. Although the claims at issue are not identical, they are not patentably distinct from each other because both set of claims embrace a polynucleotide conjugate comprising an anti-transferrin receptor antibody or antigen-binding fragment thereof conjugated to a polynucleotide that hybridizes to a target sequence of a human PRKAG2 mRNA and mediates downregulation of the human PRKAG2 mRNA in a cardiac muscle cell, wherein the polynucleotide is a double-stranded small interfering RNA (siRNA) comprising a guide strand and a passenger strand, wherein the guide strand comprises the nucleic acid sequence selected from SEQ ID NOs: 211 and 212 and the passenger strand comprises SEQ ID NOs: 223 and 224. The siRNA comprising SEQ ID NOs: 211 and 212 or SEQ ID NOs: 223 and 224 read on the chemical modifications set forth in instant claims 6-9 and 18-21. The conjugate comprising an anti-transferrin receptor antibody or fragment thereof in instant claims 11-15 are obvious variants of the antibody in claims 12-13 and 18 of '257. The method in claims 15-17 of '157 are obvious variants of instant claims 23-25. Claims 1-9 and 11-25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-18 of co-pending Application No. 19383467 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because both set of claims embrace treating a cardiomyopathy in a subject in need thereof comprising administering to a subject an effective amount of a polynucleotide conjugate, wherein the polynucleotide conjugate comprises an anti-transferrin receptor antibody or antigen-binding fragment conjugated to a polynucleotide that targets a human PRKAG2 mRNA, wherein the polynucleotide is double stranded comprising SEQ ID NOs: 211, 212, 223, 224. NOTE: there is no sequence listing of record in '467, but a comparison of SEQ ID NOs: 211, 212, 223, and 224 in claims 8 and 9 of '467 appear to read on the same SEQ ID NOs: for the siRNA set forth in the instant claims. See table 13 on pages 120-211 of '467 disclosure. SEQ ID NOs: 223 and 212 are chemically modified PRKAG2 siRNA that read on the chemical modifications set forth in instant claims 6-9 and. 18-21. The claims of '467 do not specifically recite the SEQ ID NOs: for the anti-transferrin antibody set forth in instant claim 13, but when one of ordinary skill in the art looks for the definition of the anti-transferrin antibody, they would arrive at SEQ ID NOs: 256-260 and 261-265 on pages 43-46 of the '467 disclosure. In view of the siRNA reading on the siRNA recited in the instant claims and method of using the siRNA recited in the claims of '467 are directed to treating cardiomyopathy, one of ordinary skill in the art would conclude that Art Unit: 1636 the invention defined in the instant claims would have been an obvious variant of the invention defined in the claims of co-pending application '467. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Response to Arguments Applicant's arguments filed 5/19/26 have been fully considered but they are not persuasive because applicant did not argue the merits of either NSDP rejection, but stated that either rejection be held in abeyance until the claims of either case are deemed allowable. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. See attached PTO-326 for disposition of claims. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Oct 31, 2025
Application Filed
Feb 19, 2026
Non-Final Rejection mailed — §103, §DP
May 19, 2026
Response Filed
Jun 02, 2026
Final Rejection mailed — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680101
RNA MOLECULE, CHIMERIC NA MOLECULE, DOUBLE-STRANDED RNA MOLECULE, AND DOUBLE-STRANDED CHIMERIC NA MOLECULE
4y 0m to grant Granted Jul 14, 2026
Patent 12674165
OLIGONUCLEOTIDES FOR TREATMENT OF ANGIOPOIETIN LIKE 4 (ANGPTL4) RELATED DISEASES
4y 2m to grant Granted Jul 07, 2026
Patent 12655429
MICRORNA AS A THERAPEUTIC AGENT
4y 0m to grant Granted Jun 16, 2026
Patent 12655434
Aptamers and use thereof
3y 9m to grant Granted Jun 16, 2026
Patent 12655435
Aptamers Specific for TLR-4 and Uses Thereof
3y 4m to grant Granted Jun 16, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
68%
Grant Probability
85%
With Interview (+16.7%)
2y 8m (~1y 11m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 1159 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month