Prosecution Insights
Last updated: July 17, 2026
Application No. 19/535,829

DNA COMPOSITIONS AND RELATED METHODS

Non-Final OA §103§DP
Filed
Feb 10, 2026
Priority
Oct 18, 2021 — provisional 63/262,690 +5 more
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Flagship Pioneering Inc.
OA Round
1 (Non-Final)
48%
Grant Probability
Moderate
1-2
OA Rounds
3y 7m
Est. Remaining
92%
With Interview

Examiner Intelligence

Grants 48% of resolved cases
48%
Career Allowance Rate
26 granted / 54 resolved
-11.9% vs TC avg
Strong +44% interview lift
Without
With
+43.5%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
48 currently pending
Career history
107
Total Applications
across all art units

Statute-Specific Performance

§101
2.1%
-37.9% vs TC avg
§103
46.0%
+6.0% vs TC avg
§102
4.8%
-35.2% vs TC avg
§112
22.8%
-17.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 54 resolved cases

Office Action

§103 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant's preliminary amendment filed on May 19, 2026 is acknowledged. Claims 1-26 are pending. Election/Restrictions Applicant’s election without traverse of Group I (claims 1-24) and species (membrane protein) in the reply filed on May 19, 2026 is acknowledged. Claims 25 and 26 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on May 19, 2026. Claims 4, 6, and 7 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on May 19, 2026. Claims 1-3, 5, and 8-24 are examined on the merits herein. Priority PNG media_image1.png 128 430 media_image1.png Greyscale Information Disclosure Statement The information disclosure statement (IDS) submitted on February 10, 2026 and May 19, 2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Drawings The drawings were received on February 10, 2026. The drawings are objected to because lane 3 of FIG. 10B reads “1 hours” and should read “1 hour”. In addition, FIGS. 16B through 16D are blurry and difficult to decipher. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The disclosure is objected to because of the following informalities: Page 71, first full paragraph: a period is missing at the end of the paragraph (line 6). Page 112, lines 13-14 refer to a red arrow in FIG. 9; however, color drawings were not submitted with the instant application. Appropriate correction is required. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. See e.g., pages 30, 63, 65, 71, 81, 101, and 117. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-3, 5, 8, 10-13, 16-19, and 21-24 are rejected under 35 U.S.C. 103 as being unpatentable over Kotin et al. (WO 2019/051255; reference cited by Applicant) in view of Längle-Rouault et al. (Journal of Virology 1998; reference cited by Applicant). Regarding claims 1, 12, 13, 19, 22, 23, and 24, Kotin et al. teaches non-viral, capsid-free ceDNA molecules with covalently-closed ends (ceDNA). These non-viral capsid free ceDNA molecules can be produced in permissive host cells from an expression construct. . Kotin et al. teaches that the expression cassette can comprise a transgene or nucleic acid in the range of 500 to 5,000 nucleotides in length [00108]. Further, the expression cassette can comprise any transgene of interest [00111] wherein the transgene encodes a therapeutic agent such as a protein [00112]. Kotin et al. also teaches a pharmaceutical composition comprising a ceDNA vector and a pharmaceutically acceptable carrier or diluent [00276]. Further, the ceDNA can be formulated into lipid nanoparticles (LNPs) [00281]. Kotin et al. teaches in Figures 3A-3D that the ssDNA does not form a double stranded structure longer than 100 base pairs. The ceDNA of Kotin et al. does not comprise a protelomerase target sequence. Regarding claim 2, Kotin et al. teaches a closed-ended DNA vector comprising a promoter operably linked to a transgene [0018]. Regarding claim 3, Kotin et al. teaches a ceDNA vector wherein at least one heterologous nucleotide sequence encodes a therapeutic protein wherein the therapeutic protein is cystic fibrosis transmembrane conductance regulator (CFTR) [0027] on page 15. Regarding claim 5, Kotin et al. teaches a ceDNA vector wherein at least one heterologous nucleotide sequence encodes a therapeutic protein wherein the therapeutic protein is an enzyme [0027] on page 15. Regarding claim 8, Kotin et al. teaches that the transgene in the expression cassette, expression construct, or ceDNA vector can be codon optimized [00342]. Regarding claim 10, Kotin et al. teaches that non-viral, capsid-free ceDNA molecules with covalently-closed ends can be produced in permissive host cells from an expression construct containing a heterologous gene (transgene) positioned between two different inverted terminal repeat (ITR) sequences [00101]. The instant specification discloses that in some embodiments the SSM is an inverted repeat or hairpin sequence, e.g., an inverted terminal repeat from a virus [page 63, lines 27-29]. Regarding claim 11, Kotin et al. teaches that the expression cassette can comprise a transgene or nucleic acid in the range of 500 to 5,000 nucleotides in length [00108]. Regarding claim 16, Kotin et al. teaches that the ceDNA vectors can be incorporated into a pharmaceutical composition suitable for a desired route of therapeutic administration (e.g., parenteral administration) [00277]. Regarding claim 17, Kotin et al. teaches that the ceDNA vector can be incorporated into a pharmaceutical composition suitable for topical administration [00279]. Regarding claim 18, Kotin et al. teaches that ceDNA vectors are single-strand linear DNA having closed ends [00113]. Regarding claim 21, Kotin et al. teaches in Figures 3A-3D that the ssDNA does not form a double stranded structure longer than 50 base pairs. However, Kotin et al. does not teach that the ssDNA comprises an EBV oriP site. Kotin et al. also does not explicitly teach the GC content percentage of the ssDNA. Längle-Rouault et al. teaches that a 100-fold increase in luciferase activity was observed in 293 cells, stably expressing Epstein-Barr nuclear antigen 1 (EBNA1; 293-EBNA1 cells), that had been transiently transfected with plasmids carrying Epstein Barr virus (EBV) oriP sequences. Längle-Rouault et al. also teaches that substantially increasing the apparent expression of a gene under the control of a strong constitutive promoter in the presence of oriP sequences and EBNA1 is due to intranuclear enhancement of gene expression [abstract]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the ssDNA of Kotin et al. wherein the ssDNA comprises an EBV oriP site because Kotin et al. taught non-viral, capsid-free ceDNA molecules with covalently-closed ends and Längle-Rouault et al. taught that a 100-fold increase in luciferase activity was observed in 293 cells, stably expressing Epstein-Barr nuclear antigen 1 (EBNA1; 293-EBNA1 cells), that had been transiently transfected with plasmids carrying Epstein Barr virus (EBV) oriP sequences. Längle-Rouault et al. also taught that substantially increasing the apparent expression of a gene under the control of a strong constitutive promoter in the presence of oriP sequences and EBNA1 is due to intranuclear enhancement of gene expression. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results. Although Kotin et al. does not explicitly teach the GC content percentage of the ssDNA, it would have been obvious to try because Kotin et al. taught that the transgene in the expression cassette, expression construct, or ceDNA vector can be codon optimized. Kotin et al. also taught that the term "codon optimized" refers to the process of modifying a nucleic acid sequence for enhanced expression in the cells of the vertebrate of interest, e.g., human [00342]. Furthermore, Kotin et al. taught that there remains an important unmet need for controllable recombinant DNA vectors with improved production and/or expression properties [0010]. Claim 9 is rejected under 35 U.S.C. 103 as being unpatentable over Kotin et al. (WO 2019/051255; reference cited by Applicant) in view of Längle-Rouault et al. (Journal of Virology 1998; reference cited by Applicant) as applied to claims 1-3, 5, 8, 10-13, 16-19, and 21-24 above, and further in view of Zechiedrich et al. (US 2018/0305701; reference cited by Applicant). Regarding claim 9, the teachings of Kotin et al. and Längle-Rouault et al. are discussed above. However, Kotin et al. and Längle-Rouault et al. do not teach wherein the ssDNA further comprises a maintenance sequence. Zechiedrich et al. teaches that conventional minicircles lack an origin of replication, so they do not replicate within the target cells and the encoded genes will disappear as the cell divides. Zechiedrich et al. also teaches that a promising development is nonviral self-replicating minicircles, which owe this property to the presence of a scaffold/matrix attachment region (S/MAR)-Element. The S/MAR element ensures that the minicircle are maintained episomally, with once per cell cycle replication, synchronized with the host genome [0013]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the ssDNA of Kotin et al. wherein the ssDNA further comprises a maintenance sequence because Kotin et al. taught non-viral, capsid-free ceDNA molecules with covalently-closed ends and Zechiedrich et al. taught that conventional minicircles lack an origin of replication, so they do not replicate within the target cells and the encoded genes will disappear as the cell divides. Zechiedrich et al. also taught that a promising development is nonviral self-replicating minicircles, which owe this property to the presence of a scaffold/matrix attachment region (S/MAR)-Element. The S/MAR element ensures that the minicircle are maintained episomally, with once per cell cycle replication, synchronized with the host genome [0013]. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results. Claims 14 and 15 are rejected under 35 U.S.C. 103 as being unpatentable over Kotin et al. (WO 2019/051255; reference cited by Applicant) in view of Längle-Rouault et al. (Journal of Virology 1998; reference cited by Applicant) as applied to claims 1-3, 5, 8, 10-13, 16-19, and 21-24 above, and further in view of Foot et al. (US 2019/0270991; reference cited by Applicant). Regarding claims 14 and 15, the teachings of Kotin et al. and Längle-Rouault et al. are discussed above. However, Kotin et al. and Längle-Rouault et al. do not teach that the ssDNA comprises at least one nucleotide modification (claim 14) wherein the modification is 5-formylcytosine (claim 15). Foot et al. teaches compositions for delivery of cargo to targeted cells, such as cancer cells, using a nanoparticle (e.g., nucleic acid (DNA and/or RNA) nanoparticle) linked to one or more cargoes, which may alter the function of the target cell [0007]. Foot et al. also teaches that nucleic acid nanoparticles may include one or more modified nucleotides such as 5fC [0025]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the ssDNA of Kotin et al. wherein the ssDNA comprises a 5-formylcytosine nucleotide modification because Kotin et al. taught non-viral, capsid-free ceDNA molecules with covalently-closed ends and Foot et al. taught compositions for delivery of cargo to targeted cells, such as cancer cells, using a nanoparticle (e.g., nucleic acid (DNA and/or RNA) nanoparticle) linked to one or more cargoes, which may alter the function of the target cell [0007]. Foot et al. also taught that nucleic acid nanoparticles may include one or more modified nucleotides such as 5fC [0025]. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results. Claim 20 is rejected under 35 U.S.C. 103 as being unpatentable over Kotin et al. (WO 2019/051255; reference cited by Applicant) in view of Längle-Rouault et al. (Journal of Virology 1998; reference cited by Applicant) as applied to claims 1-3, 5, 8, 10-13, 16-19, and 21-24 above, and further in view of Bachmann et al. (EP 1921142). Bachmann et al. teaches SEQ ID NO: 37 which is the expression vector pCEP-SP-Sfi-Fc. Bachmann et al. also teaches that the pCEP-SP-Sfi-Fc vector is a derivative of the episomal mammalian expression vector pCEP4 carrying the Epstein-Barr Virus replication origin (oriP) and nuclear antigen (encoded by the EBNA-1 gene) to permit extrachromosomal replication [Example 6]. Bachmann et al. SEQ ID NO: 37 (designated as Db) is complementary to instant SEQ ID NO: 23 (designated as Qy) as shown in the alignment below. Query Match 100.0%; Score 2186; Length 10309; Best Local Similarity 100.0%; Matches 2186; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CATGCAGGAAAAGGACAAGCAGCGAAAATTCACGCCCCCTTGGGAGGTGGCGGCATATGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3543 CATGCAGGAAAAGGACAAGCAGCGAAAATTCACGCCCCCTTGGGAGGTGGCGGCATATGC 3484 Qy 61 AAAGGATAGCACTCCCACTCTACTACTGGGTATCATATGCTGACTGTATATGCATGAGGA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3483 AAAGGATAGCACTCCCACTCTACTACTGGGTATCATATGCTGACTGTATATGCATGAGGA 3424 Qy 121 TAGCATATGCTACCCGGATACAGATTAGGATAGCATATACTACCCAGATATAGATTAGGA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3423 TAGCATATGCTACCCGGATACAGATTAGGATAGCATATACTACCCAGATATAGATTAGGA 3364 Qy 181 TAGCATATGCTACCCAGATATAGATTAGGATAGCCTATGCTACCCAGATATAAATTAGGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3363 TAGCATATGCTACCCAGATATAGATTAGGATAGCCTATGCTACCCAGATATAAATTAGGA 3304 Qy 241 TAGCATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3303 TAGCATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGA 3244 Qy 301 TAGCCTATGCTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3243 TAGCCTATGCTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGA 3184 Qy 361 TAGCATATGCTATCCAGATATTTGGGTAGTATATGCTACCCAGATATAAATTAGGATAGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3183 TAGCATATGCTATCCAGATATTTGGGTAGTATATGCTACCCAGATATAAATTAGGATAGC 3124 Qy 421 ATATACTACCCTAATCTCTATTAGGATAGCATATGCTACCCGGATACAGATTAGGATAGC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3123 ATATACTACCCTAATCTCTATTAGGATAGCATATGCTACCCGGATACAGATTAGGATAGC 3064 Qy 481 ATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3063 ATATACTACCCAGATATAGATTAGGATAGCATATGCTACCCAGATATAGATTAGGATAGC 3004 Qy 541 CTATGCTACCCAGATATAAATTAGGATAGCATATACTACCCAGATATAGATTAGGATAGC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3003 CTATGCTACCCAGATATAAATTAGGATAGCATATACTACCCAGATATAGATTAGGATAGC 2944 Qy 601 ATATGCTACCCAGATATAGATTAGGATAGCCTATGCTACCCAGATATAGATTAGGATAGC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2943 ATATGCTACCCAGATATAGATTAGGATAGCCTATGCTACCCAGATATAGATTAGGATAGC 2884 Qy 661 ATATGCTATCCAGATATTTGGGTAGTATATGCTACCCATGGCAACATTAGCCCACCGTGC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2883 ATATGCTATCCAGATATTTGGGTAGTATATGCTACCCATGGCAACATTAGCCCACCGTGC 2824 Qy 721 TCTCAGCGACCTCGTGAATATGAGGACCAACAACCCTGTGCTTGGCGCTCAGGCGCAAGT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2823 TCTCAGCGACCTCGTGAATATGAGGACCAACAACCCTGTGCTTGGCGCTCAGGCGCAAGT 2764 Qy 781 GTGTGTAATTTGTCCTCCAGATCGCAGCAATCGCGCCCCTATCTTGGCCCGCCCACCTAC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2763 GTGTGTAATTTGTCCTCCAGATCGCAGCAATCGCGCCCCTATCTTGGCCCGCCCACCTAC 2704 Qy 841 TTATGCAGGTATTCCCCGGGGTGCCATTAGTGGTTTTGTGGGCAAGTGGTTTGACCGCAG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2703 TTATGCAGGTATTCCCCGGGGTGCCATTAGTGGTTTTGTGGGCAAGTGGTTTGACCGCAG 2644 Qy 901 TGGTTAGCGGGGTTACAATCAGCCAAGTTATTACACCCTTATTTTACAGTCCAAAACCGC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2643 TGGTTAGCGGGGTTACAATCAGCCAAGTTATTACACCCTTATTTTACAGTCCAAAACCGC 2584 Qy 961 AGGGCGGCGTGTGGGGGCTGACGCGTGCCCCCACTCCACAATTTCAAAAAAAAGAGTGGC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2583 AGGGCGGCGTGTGGGGGCTGACGCGTGCCCCCACTCCACAATTTCAAAAAAAAGAGTGGC 2524 Qy 1021 CACTTGTCTTTGTTTATGGGCCCCATTGGCGTGGAGCCCCGTTTAATTTTCGGGGGTGTT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2523 CACTTGTCTTTGTTTATGGGCCCCATTGGCGTGGAGCCCCGTTTAATTTTCGGGGGTGTT 2464 Qy 1081 AGAGACAACCAGTGGAGTCCGCTGCTGTCGGCGTCCACTCTCTTTCCCCTTGTTACAAAT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2463 AGAGACAACCAGTGGAGTCCGCTGCTGTCGGCGTCCACTCTCTTTCCCCTTGTTACAAAT 2404 Qy 1141 AGAGTGTAACAACATGGTTCACCTGTCTTGGTCCCTGCCTGGGACACATCTTAATAACCC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2403 AGAGTGTAACAACATGGTTCACCTGTCTTGGTCCCTGCCTGGGACACATCTTAATAACCC 2344 Qy 1201 CAGTATCATATTGCACTAGGATTATGTGTTGCCCATAGCCATAAATTCGTGTGAGATGGA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2343 CAGTATCATATTGCACTAGGATTATGTGTTGCCCATAGCCATAAATTCGTGTGAGATGGA 2284 Qy 1261 CATCCAGTCTTTACGGCTTGTCCCCACCCCATGGATTTCTATTGTTAAAGATATTCAGAA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2283 CATCCAGTCTTTACGGCTTGTCCCCACCCCATGGATTTCTATTGTTAAAGATATTCAGAA 2224 Qy 1321 TGTTTCATTCCTACACTAGTATTTATTGCCCAAGGGGTTTGTGAGGGTTATATTGGTGTC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2223 TGTTTCATTCCTACACTAGTATTTATTGCCCAAGGGGTTTGTGAGGGTTATATTGGTGTC 2164 Qy 1381 ATAGCACAATGCCACCACTGAACCCCCCGTCCAAATTTTATTCTGGGGGCGTCACCTGAA 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2163 ATAGCACAATGCCACCACTGAACCCCCCGTCCAAATTTTATTCTGGGGGCGTCACCTGAA 2104 Qy 1441 ACCTTGTTTTCGAGCACCTCACATACACCTTACTGTTCACAACTCAGCAGTTATTCTATT 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2103 ACCTTGTTTTCGAGCACCTCACATACACCTTACTGTTCACAACTCAGCAGTTATTCTATT 2044 Qy 1501 AGCTAAACGAAGGAGAATGAAGAAGCAGGCGAAGATTCAGGAGAGTTCACTGCCCGCTCC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2043 AGCTAAACGAAGGAGAATGAAGAAGCAGGCGAAGATTCAGGAGAGTTCACTGCCCGCTCC 1984 Qy 1561 TTGATCTTCAGCCACTGCCCTTGTGACTAAAATGGTTCACTACCCTCGTGGAATCCTGAC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1983 TTGATCTTCAGCCACTGCCCTTGTGACTAAAATGGTTCACTACCCTCGTGGAATCCTGAC 1924 Qy 1621 CCCATGTAAATAAAACCGTGACAGCTCATGGGGTGGGAGATATCGCTGTTCCTTAGGACC 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1923 CCCATGTAAATAAAACCGTGACAGCTCATGGGGTGGGAGATATCGCTGTTCCTTAGGACC 1864 Qy 1681 CTTTTACTAACCCTAATTCGATAGCATATGCTTCCCGTTGGGTAACATATGCTATTGAAT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1863 CTTTTACTAACCCTAATTCGATAGCATATGCTTCCCGTTGGGTAACATATGCTATTGAAT 1804 Qy 1741 TAGGGTTAGTCTGGATAGTATATACTACTACCCGGGAAGCATATGCTACCCGTTTAGGGT 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1803 TAGGGTTAGTCTGGATAGTATATACTACTACCCGGGAAGCATATGCTACCCGTTTAGGGT 1744 Qy 1801 TAACAAGGGGGCCTTATAAACACTATTGCTAATGCCCTCTTGAGGGTCCGCTTATCGGTA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1743 TAACAAGGGGGCCTTATAAACACTATTGCTAATGCCCTCTTGAGGGTCCGCTTATCGGTA 1684 Qy 1861 GCTACACAGGCCCCTCTGATTGACGTTGGTGTAGCCTCCCGTAGTCTTCCTGGGCCCCTG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1683 GCTACACAGGCCCCTCTGATTGACGTTGGTGTAGCCTCCCGTAGTCTTCCTGGGCCCCTG 1624 Qy 1921 GGAGGTACATGTCCCCCAGCATTGGTGTAAGAGCTTCAGCCAAGAGTTACACATAAAGGC 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1623 GGAGGTACATGTCCCCCAGCATTGGTGTAAGAGCTTCAGCCAAGAGTTACACATAAAGGC 1564 Qy 1981 AATGTTGTGTTGCAGTCCACAGACTGCAAAGTCTGCTCCAGGATGAAAGCCACTCAGTGT 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1563 AATGTTGTGTTGCAGTCCACAGACTGCAAAGTCTGCTCCAGGATGAAAGCCACTCAGTGT 1504 Qy 2041 TGGCAAATGTGCACATCCATTTATAAGGATGTCAACTACAGTCAGAGAACCCCTTTGTGT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1503 TGGCAAATGTGCACATCCATTTATAAGGATGTCAACTACAGTCAGAGAACCCCTTTGTGT 1444 Qy 2101 TTGGTCCCCCCCCGTGTCACATGTGGAACAGGGCCCAGTTGGCAAGTTGTACCAACCAAC 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1443 TTGGTCCCCCCCCGTGTCACATGTGGAACAGGGCCCAGTTGGCAAGTTGTACCAACCAAC 1384 Qy 2161 TGAAGGGATTACATGCACTGCCCCGC 2186 |||||||||||||||||||||||||| Db 1383 TGAAGGGATTACATGCACTGCCCCGC 1358 It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the EBV oriP site of Längle-Rouault et al. wherein the EBV oriP site comprises the nucleotide sequence of SEQ ID NO: 23 because Kotin et al. taught non-viral, capsid-free ceDNA molecules with covalently-closed ends and Längle-Rouault et al. taught that a 100-fold increase in luciferase activity was observed in 293 cells, stably expressing Epstein-Barr nuclear antigen 1 (EBNA1; 293-EBNA1 cells), that had been transiently transfected with plasmids carrying Epstein Barr virus (EBV) oriP sequences. Längle-Rouault et al. also taught that substantially increasing the apparent expression of a gene under the control of a strong constitutive promoter in the presence of oriP sequences and EBNA1 is due to intranuclear enhancement of gene expression and Bachmann et al. taught the expression vector pCEP-SP-Sfi-Fc (SEQ ID NO: 37) which is a derivative of the episomal mammalian expression vector pCEP4 carrying the Epstein-Barr Virus replication origin (oriP) and nuclear antigen (encoded by the EBNA-1 gene). One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-3, 5, and 8-24 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 106-109 of copending Application No. 18/702,197 in view of Kotin et al. (WO 2019/051255; reference cited by Applicant), Längle-Rouault et al. (Journal of Virology 1998; reference cited by Applicant), Zechiedrich et al. (US 2018/0305701; reference cited by Applicant), Foot et al. (US 2019/0270991; reference cited by Applicant), and Bachmann et al. (EP 1921142). The instant application is drawn to a pharmaceutical formulation comprising a lipid nanoparticle comprising a single stranded DNA wherein the ssDNA PNG media_image2.png 302 658 media_image2.png Greyscale Copending application ‘197 is drawn to a pharmaceutical formulation comprising a lipid nanoparticle comprising a single stranded DNA wherein the ssDNA PNG media_image3.png 192 566 media_image3.png Greyscale (claim 106) and to a method of delivering a therapeutic protein to a subject comprising administering to the subject the pharmaceutical formulation of claim 106 (claim 107), a method of modulating a biological parameter in a cell, tissue or subject, comprising administering to the cell, tissue, or subject the pharmaceutical formulation of claim 106 (claim 108), and a method of treating a cell, tissue, or subject comprising administering to the cell, tissue, or subject the pharmaceutical formulation of claim 106 (claim 109). However, copending application ‘197 does not teach that the ssDNA comprises an EBV oriP site or the limitations of the instant dependent claims. Kotin et al. teaches a closed-ended DNA vector comprising a promoter operably linked to a transgene [0018]. Kotin et al. teaches a ceDNA vector wherein at least one heterologous nucleotide sequence encodes a therapeutic protein wherein the therapeutic protein is cystic fibrosis transmembrane conductance regulator (CFTR) [0027] on page 15. Kotin et al. teaches that the transgene in the expression cassette, expression construct, or ceDNA vector can be codon optimized [00342]. Kotin et al. teaches that non-viral, capsid-free ceDNA molecules with covalently-closed ends can be produced in permissive host cells from an expression construct containing a heterologous gene (transgene) positioned between two different inverted terminal repeat (ITR) sequences [00101]. The instant specification discloses that in some embodiments the SSM is an inverted repeat or hairpin sequence, e.g., an inverted terminal repeat from a virus [page 63, lines 27-29]. Kotin et al. teaches that the expression cassette can comprise a transgene or nucleic acid in the range of 500 to 5,000 nucleotides in length [00108]. Kotin et al. teaches that the ceDNA vectors can be incorporated into a pharmaceutical composition suitable for a desired route of therapeutic administration (e.g., parenteral administration) [00277]. Kotin et al. teaches that the ceDNA vector can be incorporated into a pharmaceutical composition suitable for topical administration [00279]. Kotin et al. teaches that ceDNA vectors are single-strand linear DNA having closed ends [00113]. Kotin et al. teaches in Figures 3A-3D that the ssDNA does not form a double stranded structure longer than 50 base pairs. Längle-Rouault et al. teaches that a 100-fold increase in luciferase activity was observed in 293 cells, stably expressing Epstein-Barr nuclear antigen 1 (EBNA1; 293-EBNA1 cells), that had been transiently transfected with plasmids carrying Epstein Barr virus (EBV) oriP sequences. Längle-Rouault et al. also teaches that substantially increasing the apparent expression of a gene under the control of a strong constitutive promoter in the presence of oriP sequences and EBNA1 is due to intranuclear enhancement of gene expression [abstract]. Zechiedrich et al. teaches that conventional minicircles lack an origin of replication, so they do not replicate within the target cells and the encoded genes will disappear as the cell divides. Zechiedrich et al. also teaches that a promising development is nonviral self-replicating minicircles, which owe this property to the presence of a scaffold/matrix attachment region (S/MAR)-Element. The S/MAR element ensures that the minicircle are maintained episomally, with once per cell cycle replication, synchronized with the host genome [0013]. Foot et al. teaches compositions for delivery of cargo to targeted cells, such as cancer cells, using a nanoparticle (e.g., nucleic acid (DNA and/or RNA) nanoparticle) linked to one or more cargoes, which may alter the function of the target cell [0007]. Foot et al. also teaches that nucleic acid nanoparticles may include one or more modified nucleotides such as 5fC [0025]. Bachmann et al. teaches SEQ ID NO: 37 which is the expression vector pCEP-SP-Sfi-Fc. Bachmann et al. also teaches that the pCEP-SP-Sfi-Fc vector is a derivative of the episomal mammalian expression vector pCEP4 carrying the Epstein-Barr Virus replication origin (oriP) and nuclear antigen (encoded by the EBNA-1 gene) to permit extrachromosomal replication [Example 6]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the ssDNA of copending ‘197 and arrive at the instantly claimed limitations based on the teachings of Kotin et al., Längle-Rouault et al., Zechiedrich et al., Foot et al., and Bachmann et al. because Kotin et al. taught non-viral, capsid-free ceDNA molecules with covalently-closed ends and Längle-Rouault et al. taught that a 100-fold increase in luciferase activity was observed in 293 cells, stably expressing Epstein-Barr nuclear antigen 1 (EBNA1; 293-EBNA1 cells), that had been transiently transfected with plasmids carrying Epstein Barr virus (EBV) oriP sequences. Längle-Rouault et al. also taught that substantially increasing the apparent expression of a gene under the control of a strong constitutive promoter in the presence of oriP sequences and EBNA1 is due to intranuclear enhancement of gene expression and Bachmann et al. taught the expression vector pCEP-SP-Sfi-Fc (SEQ ID NO: 37) which is a derivative of the episomal mammalian expression vector pCEP4 carrying the Epstein-Barr Virus replication origin (oriP) and nuclear antigen (encoded by the EBNA-1 gene). Zechiedrich et al. taught that conventional minicircles lack an origin of replication, so they do not replicate within the target cells and the encoded genes will disappear as the cell divides. Zechiedrich et al. also taught that a promising development is nonviral self-replicating minicircles, which owe this property to the presence of a scaffold/matrix attachment region (S/MAR)-Element. The S/MAR element ensures that the minicircle are maintained episomally, with once per cell cycle replication, synchronized with the host genome [0013]. Foot et al. taught compositions for delivery of cargo to targeted cells, such as cancer cells, using a nanoparticle (e.g., nucleic acid (DNA and/or RNA) nanoparticle) linked to one or more cargoes, which may alter the function of the target cell [0007]. Foot et al. also taught that nucleic acid nanoparticles may include one or more modified nucleotides such as 5fC [0025]. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results. Although Kotin et al. does not explicitly teach the GC content percentage of the ssDNA, it would have been obvious to try because Kotin et al. taught that the transgene in the expression cassette, expression construct, or ceDNA vector can be codon optimized. Kotin et al. also taught that the term "codon optimized" refers to the process of modifying a nucleic acid sequence for enhanced expression in the cells of the vertebrate of interest, e.g., human [00342]. Furthermore, Kotin et al. taught that there remains an important unmet need for controllable recombinant DNA vectors with improved production and/or expression properties [0010]. This is a provisional nonstatutory double patenting rejection. Claims 1-3, 5, and 8-24 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-22 of U.S. Patent No. 12,303,526 in view of Längle-Rouault et al. (Journal of Virology 1998; reference cited by Applicant) and Bachmann et al. (EP 1921142). The instant application is drawn to a pharmaceutical formulation comprising a lipid nanoparticle comprising a single stranded DNA wherein the ssDNA PNG media_image2.png 302 658 media_image2.png Greyscale Patent ‘526 is drawn to the following PNG media_image4.png 686 542 media_image4.png Greyscale PNG media_image5.png 160 276 media_image5.png Greyscale However, patent ‘526 does not teach that the ssDNA comprises an EBV oriP site wherein the EBV oriP site comprises the nucleotide sequence of SEQ ID NO: 23. Längle-Rouault et al. teaches that a 100-fold increase in luciferase activity was observed in 293 cells, stably expressing Epstein-Barr nuclear antigen 1 (EBNA1; 293-EBNA1 cells), that had been transiently transfected with plasmids carrying Epstein Barr virus (EBV) oriP sequences. Längle-Rouault et al. also teaches that substantially increasing the apparent expression of a gene under the control of a strong constitutive promoter in the presence of oriP sequences and EBNA1 is due to intranuclear enhancement of gene expression [abstract]. Bachmann et al. teaches SEQ ID NO: 37 which is the expression vector pCEP-SP-Sfi-Fc. Bachmann et al. also teaches that the pCEP-SP-Sfi-Fc vector is a derivative of the episomal mammalian expression vector pCEP4 carrying the Epstein-Barr Virus replication origin (oriP) and nuclear antigen (encoded by the EBNA-1 gene) to permit extrachromosomal replication [Example 6]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the ssDNA of patent ‘526 wherein the ssDNA comprises an EBV oriP site wherein the EBV oriP site comprises the nucleotide sequence of SEQ ID NO: 23 because patent ‘526 taught a pharmaceutical formulation comprising a lipid nanoparticle comprising a single stranded DNA and Längle-Rouault et al. taught that a 100-fold increase in luciferase activity was observed in 293 cells, stably expressing Epstein-Barr nuclear antigen 1 (EBNA1; 293-EBNA1 cells), that had been transiently transfected with plasmids carrying Epstein Barr virus (EBV) oriP sequences. Längle-Rouault et al. also taught that substantially increasing the apparent expression of a gene under the control of a strong constitutive promoter in the presence of oriP sequences and EBNA1 is due to intranuclear enhancement of gene expression and Bachmann et al. taught the expression vector pCEP-SP-Sfi-Fc (SEQ ID NO: 37) which is a derivative of the episomal mammalian expression vector pCEP4 carrying the Epstein-Barr Virus replication origin (oriP) and nuclear antigen (encoded by the EBNA-1 gene). One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Feb 10, 2026
Application Filed
Jun 12, 2026
Non-Final Rejection mailed — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12649004
HIGHLY EFFICIENT TRANSDUCTION AND LATERAL SPREAD IN THE RETINA BY A NOVEL AAV VIRUS ENHANCED BY RATIONAL DESIGN
4y 10m to grant Granted Jun 09, 2026
Patent 12624362
MUTANT REVERSE TETRACYCLINE TRANSACTIVATORS FOR EXPRESSION OF GENES
5y 1m to grant Granted May 12, 2026
Patent 12584126
MICRORNA INHIBITORS FOR USE IN TREATING METABOLIC DISEASES
5y 3m to grant Granted Mar 24, 2026
Patent 12570707
CODON-OPTIMISED COMPLEMENT FACTOR I
4y 8m to grant Granted Mar 10, 2026
Patent 12545893
RECOMBINANT NERVOUS SYSTEM CELLS AND METHODS TO GENERATE THEM
4y 10m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
48%
Grant Probability
92%
With Interview (+43.5%)
4y 0m (~3y 7m remaining)
Median Time to Grant
Low
PTA Risk
Based on 54 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month