Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 86-89 and 91-105 is/are rejected under 35 U.S.C. 103 as being unpatentable over Nioi et al. (US 2024/0392294 A1) (priority to 63/272,769, filed 10/28/21, page 204, AD-1659342), in view of Manoharan et al. (WO 2015/006740 A2) and Matsuda et al. (ACS Chem. Biol. 2015, 10, 1181−1187).
Nioi et al. teach a duplex targeting AGT, wherein each strand is 21 nucleotides and length, wherein the duplex comprises a strand that has 21 contiguous nucleotides that are identical to nucleotides 1815-1835 of instant SEQ ID NO: 1 and a second strand that is fully complementary to the first strand (see unmodified AD-1659342 on page 124 CCGACCAGCUUGUUUGUGAAAU). Nioi et al. teaches a modified form of the duplex at page 205 (see AD-1659342.1) (instant claim 86).
Nioi et al. teach: [0017] In one embodiment, all of the nucleotides of the sense strand are modified nucleotides; all of the nucleotides of the antisense strand are modified nucleotides; or all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides (instant claim 97).
Nioi et al. teach attachment to a ligand, more specifically a N-acetylgalactosamine (GalNAc) derivative (page 2). Noi et al. teach the structure of trivalent GalNAc on page 3, which is identical to the GalNAc in the instantly recited structures (instant claims 87 and 88).
Nioi et al. teach various configurations and structures for the 5’ or 3’ nucleoside comprising the ligand including those encompassing the structures of instant claims 87 and 88 (see page 27, 30, 42-52, 54-57, 72, and 73, for example).
Nioi et al. teach: [0033] In one embodiment, the ligand is one or more GalNAc derivatives attached through a monovalent, bivalent, or trivalent branched linker (instant claim 86).
Nioi et al. teach: [0553] In certain embodiments, the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent. In certain embodiments, the double stranded RNAi agents of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.
Nioi et al. teach: [0551] In some embodiments, the carbohydrate conjugate comprises one or more GalNAc derivatives. The GalNAc derivatives may be attached via a linker, e.g., a bivalent or trivalent branched linker. In some embodiments the GalNAc conjugate is conjugated to the 3′ end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 3′ end of the sense strand) via a linker, e.g., a linker as described herein. In some embodiments the GalNAc conjugate is conjugated to the 5′ end of the sense strand. In some embodiments, the GalNAc conjugate is conjugated to the iRNA agent (e.g., to the 5′ end of the sense strand) via a linker, e.g., a linker as described herein (instant claim 86).
Nioi et al. teach: [0022] In one embodiment, the thermally destabilizing nucleotide modification is a mismatch with the opposing nucleotide in the duplex (instant claim 89).
Nioi et al. teach: [0166] Modified RNA backbones include, for example, phosphorothioates (instant claim 98).
Nioi et al. teach: [0235] The iRNA may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. The phosphorothioate or methylphosphonate internucleotide linkage modification may occur on any nucleotide of the sense strand, antisense strand, or both strands in any position of the strand. For instance, the internucleotide linkage modification may occur on every nucleotide on the sense strand or antisense strand; each internucleotide linkage modification may occur in an alternating pattern on the sense strand or antisense strand; or the sense strand or antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating pattern of the internucleotide linkage modification on the sense strand may be the same or different from the antisense strand, and the alternating pattern of the internucleotide linkage modification on the sense strand may have a shift relative to the alternating pattern of the internucleotide linkage modification on the antisense strand. In one embodiment, a double-stranded RNAi agent comprises 6-8 phosphorothioate internucleotide linkages. In some embodiments, the antisense strand comprises two phosphorothioate internucleotide linkages at the 5′-end and two phosphorothioate internucleotide linkages at the 3′-end, and the sense strand comprises at least two phosphorothioate internucleotide linkages at either the 5′-end or the 3′-end (instant claims 98 and 99).
Nioi et al. teach: [0019] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of LNA, HNA, CeNA, 2′-methoxyethyl, 2′-O-alkyl, 2′-O-allyl, 2′-C-allyl, 2′-fluoro, 2′-deoxy, 2′-hydroxyl, and glycol; and combinations thereof (instant claims 100-103).
Nioi et al. teach that the modification is a 2′-O-methyl modified nucleotide. Since Nioi et al. teach incorporation of at least one, Nioi et al. encompass embodiments of 1, 2, 3, 4, or 5 2’-F modifications, which meets the limitation of no more than five in instant claims 104 and 105.
Although Nioi et al. does not teach siRNAs consisting of the sequences of claims 91-96, Nioi et al. teaches siRNAs that collectively blanket the instantly recited region (see siRNAs targeting 1815-1835, 1816-1836, and 1817-1837 on page 162 of Nioi et al.) and Nioi et al. teaches incorporation of a mismatch as a thermally destabilizing nucleotide [0022]. Therefore, it would have been obvious to incorporate mismatches into the sequences of Nioi et al. and targeting the same region as instantly claimed as a matter of design choice with the motivation and expectation of thermal destabilization.
Each of the instantly recited sequences represent species that would result in the routine incorporation of mismatches into siRNAs that are targeted to a known target region of AGT.
Although Nioi et al. do not teach that the oligonucleotide consists of the instantly recited sequences which are 21, 22, or 23 nucleotides in length, Nioi et al. teaches that the siRNA can be 21, 22, or 23 nucleotides in length [0101]. Therefore, it would have been obvious as a matter of design choice to design the siRNA to be 21, 22, or 23 nucleotides in length resulting in a compound consisting of the sequences of instant claims 91-96.
Nioi et al. explicitly teach conjugation of the GalNAC conjugate to the 5′ end of the sense strand, but does not teach that the GalNAc is attached to the 2’ carbon of the ribosyl ring.
However, it would have been obvious to attach the GalNAc to the 2’ carbon of the ribosyl ring because Manoharan et al. teach ligands identical to the instantly recited ligands (instant claims 87 and 88) (see Table 2 and 2A) and teach GalNAc conjugation at the 2’ position on the ribose ring (example 20, page 118). Manoharan et al. teach that the GalNAc derivatives are conjugated to ribose rings in nucleosides and that the nucleosides generate 2’ and 3’ products.
At Example 42, Manoharan et al. teaches that the ligands are attached to the 5’ end of the sense strand (Ayg GalNaC conjugate 56724) or at both ends of the sense strand (conjugates 56725 and 56726). Example 43 demonstrates Q151 at the 5’ end of the sense strand of a siRNA in siRNA 56876 and 56877) (pages 198-200).
The Oligonucleotide is preferably attached to the Linker through (i) the 3' or 5 '-terminal of the oligonucleotide, (ii) one or more sugar moieties of the nucleoside present in the oligonucleotide independent of position, or (iii) one or more base moieties of the nucleoside present independent of position (page 4). The ligand is conjugated to one of the strands of a siRNA (page 4).
Therefore, Manoharan et al. teaches that GalNAc ligands can be attached to one or both strands of an siRNA at the 3’ or 5’ end of one or both strands independent of position, teaches that the conjugate can be attached at the 5’ end of the sense strand, and teaches that the ligand can be at the 2’ carbon of the ribose ring.
Manoharan et al. expressly teaches that the oligonucleotide can be an siRNA and can have a carbohydrate-containing ligand at the 2’-position of a nucleoside, GalNAc being an example of the carbohydrate ligand.
The present invention also relates to a ligand conjugate of an oligonucleotide where at least one nucleoside is conjugated to a carbohydrate-containing Ligand either (i) through the nucleobase of the nucleoside or (ii) at the 2' -position of the nucleoside (page 35).
In one embodiment, the first, third, and fifth nucleotides from the 5' terminus are each conjugated to a -Linker-Ligand moiety (page 38).
At Example 42, Manoharan et al. teaches that the GalNac ligands are attached to the 5’ end of the sense strand (Ayg GalNaC conjugate 56724) and Manoharan et al. teaches that the ligands can be conjugated through the nucleobase of the nucleoside or (ii) at the 2' -position of the nucleoside (page 35).
Therefore, it would have been obvious to attach the ligands of Nioi et al. and Manoharan et al. to the 2’ carbon of the ribosyl ring of the nucleoside at the 5’ end of the sense strand as a matter of design choice with a reasonable expectation of success.
Additionally, Matsuda et al. teach attachment of GalNAc to the 2′ position of the ribosugar moiety (Scheme S1 in the SI) (pages 1181 and 1182). Matsuda et al. demonstrate active siRNAs conjugated to GalNAc at the 5’ end of the sense strand (Table 1). Matsuda et al. is additional evidence that it would have been a matter of design choice to attach the GalNAc conjugate to the 2’ position of the ribosyl ring of the nucleoside at the 5’ end of the sense strand (instant claim 86).
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/Primary Examiner, Art Unit 1636
