DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Applicant’s amendment filed 7/31/2026 has been entered. Claims 2-26, 33, 36-37, 39, 41-53, 55-57, and 59 are cancelled. Claims 1, 27-32, 34-35, 38, 40, 54, 58, and 60-70 are pending and examined herein.
Election/Restrictions
Applicant’s election without traverse of species Group A: LNP composition of claim 30, part (vi) "40-60 mol-% CCD lipid; 0-10 mol-% neutral lipid; 1.5-10 mol-% stealth lipid; and 25-55 mol-% helper lipid or an amount of the helper lipid that brings the lipid component to at least 99 mol-%, wherein the N/P ratio of the LNP composition is 3-10", species Group B: SEQ ID NO: 236, species Group C: SEQ ID NO: 237 in the reply filed on 7/31/2026 is acknowledged.
Species in Group A: LNP compositions of (i) – (v) and (vii) – (ix) listed in claims 30 and 31, Group B: SEQ ID NOs: 232, 234, 238, 241 and 275-277 from claim 61, and Group C: SEQ ID NOs: 233, 235, 239, and 240 from claim 61 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 7/31/2026.
Specification
The disclosure filed 5/21/2026 is objected to because it contains an embedded hyperlink and/or other form of browser-executable code in paragraph 00288. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 27-32, 34-35, 38, 40, 54, 58, and 60-70 are rejected under 35 U.S.C. 103 as being obvious over Kanjolia (US20200248180A1; published June 6, 2020, with priority date September 29, 2017; Cite No. 13 on page 3 of 15 page IDS filed 3/26/2026) and Dombrowski (US20200354702A1; published November 12, 2020; with priority date September 29, 2017; Cite No. 14 on page 3 of 15 page IDS filed 3/26/2026).
The applied reference has a common inventor and assignee with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2).
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Kanjolia’s disclosure is directed to compositions and methods for gene editing within the TTR gene and for treating subjects having amyloidosis associated with transthyretin (ATTR) (abstract; entire document). Kanjolia teaches that transthyretin (TTR) is a protein that normally functions to transport retinal and thyroxine throughout the body, usually in tetrameric form in the blood (paras 0003-0004). Kanjolia further teaches that pathogenic variants of TTR, which may disrupt the tetramer stability, can lead to amyloidosis, or disease resulting from build-up of amyloids (para 0004). Kanjolia uses CRISPR/Cas systems to reduce or knockout expression of TTR gene variants, thereby substantially reducing or eliminating the production of TTR protein associated with ATTR (para 0004).
Regarding claims 1 and 54, Kanjolia teaches a composition comprising a nucleic acid encoding a Cas9 and an sgRNA comprising the sequence of SEQ ID NO: 87 (claims 1-43, 47, and 53;; and OA.Appendix for sequence alignment). Kanjolia further teaches that each thymidine in an open reading frame is replaced with a modified or unmodified uridine (paras 0337-0339).
However, Kanjolia does not teach the nucleic acid encoding the Cas9 comprising an open reading frame (ORF) that is at least 98% identical to SEQ ID NO: 311.
Dombrowski’s disclosure is directed to compositions and methods for gene editing, including a polynucleotide encoding Cas9 is provided that can provide one or more of improved editing efficiency, reduced immunogenicity, or other benefits (abstract; entire document).
Regarding claims 1 and 54, Dombrowski teaches a nucleic acid of SEQ ID NO: 177 having 100% sequence homology to the nucleic acid encoding the Cas9 comprising the SEQ ID NO: 311, wherein each thymidine is replaced with a modified or unmodified uridine (claims 5, 8, 37; paras 0069-0077; and OA.Appendix for sequence alignment).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify Kanjolia’s methods of gene editing the TTR gene with the nucleic acid encoding the improved Cas9 of Dombrowski also having modified or unmodified uridines. The ordinary artisan could have substituted Dombrowski’s SEQ ID NO: 177 encoding Cas9 with that of Kanjolia to improve editing efficiency, reduce immunogenicity, or other benefits, as discussed above. The ordinary artisan would have had a reasonable expectation of success because it would have amounted to a simple substitution with predictable results. Thus, the claimed invention as a whole is prima facie obvious.
Regarding claim 27, Kanjolia teaches the sgRNA and the nucleic acid encoding the Cas9 are associated with a lipid nanoparticle (LNP) (claims 1-66).
Regarding claims 28-29, Kanjolia teaches the LNP comprising the CCD lipid, wherein the CCD lipid is Lipid A (claims 1-68; paras 0479-0483).
Regarding claims 30-31, Kanjolia teaches LNP formulations comprising Lipid A (which is a CCD lipid and an amine lipid) or its acetal analog, cholesterol, DSPC, and PEG-DMG; and wherein the N/P ratio is about 1-10, which teaches the elected N/P range in (iv) of 3-10. Kanjolia further teaches the lipid component comprising about 40-60 mol-% amine lipid; about 5-15 mol-% neutral lipid (teaching part of the claimed range of 0-10%); and about 1.5-10 mol-% PEG lipid (stealth lipid), wherein the remainder of the lipid component is helper lipid (ranging between 25-55%), and wherein the N/P ratio of the LNP composition is about 3-10, which teaches the range about 1.5-10% mol-% stealth lipid taught in elected part (iv) (para 0551). Kanjolia further teaches the mol-% of the neutral lipid may be from about 5 mol-% to about 15 mol-% and the neutral lipid mol-% of the LNP batch will be ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target neutral lipid mol-% and, in certain embodiments, LNP inter-lot variability will be less than 15%, less than 10% or less than 5%, which teaches the range of 0-15% (paras 0514). Therefore, Kanjolia teaches the LNP compositions of part (iv).
Regarding claim 32, Kanjolia teaches the N/P ration of the LNP composition is about 6 (±0.5%) (para 0518).
Regarding claim 34, Kanjolia teaches the LNP further comprising distearoylphosphatidylcholine (DSPC), PEG2K-DMG, and cholesterol (paras 0500 and 0510-0517).
Regarding claim 35, Kanjolia further teaches the LNP comprising about 48-53 mol-% Lipid A; about 8-10 mol-% DSPC; and 1.5-10 mol-% PEG lipid, wherein the remainder of the lipid component is (helper) cholesterol, and wherein the N/P ratio of the LNP composition is 3-8±0.2 (para 0551).
Regarding claim 38, Kanjolia teaches the Cas9 comprising a nuclear localization signal (NLS) (claim 81 and paras 0092 and 0414).
Regarding claim 40, Kanjolia teaches that the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable excipient (claims 65 and 83; paras 0076, and 0094).
Regarding claims 58 and 60, Kanjolia teaches each thymidine in SEQ ID NO: 311 is replaced with N1-methyl-pseudouridine (paras 0291-0292, 0337-0338; Examples 1 and 10).
Regarding claim 61, Kanjolia teaches a 5’ UTR having the sequence of SEQ ID NO: 236 with 100% sequence identity with Applicant’s elected SEQ ID NO: 236 and teaches a 3’ UTR having the sequence of SEQ ID NO: 237 with 100% sequence identity with Applicant’s elected SEQ ID NO: 237 (see below).
(Qy: Applicant’s elected SEQ ID NO: 236)
Qy 1 AAGCTCAGAATAAACGCTCAACTTTGGCC 29
|||||||||||||||||||||||||||||
Db 1 AAGCTCAGAATAAACGCTCAACTTTGGCC 29
(Db: Kanjolia - SEQ ID NO: 236)
(Qy: Applicant’s elected SEQ ID NO: 237)
Qy 1 ACCAGCCTCAAGAACACCCGAATGGAGTCTCTAAGCTACATAATACCAACTTACACTTTA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ACCAGCCTCAAGAACACCCGAATGGAGTCTCTAAGCTACATAATACCAACTTACACTTTA 60
Qy 61 CAAAATGTTGTCCCCCAAAATGTAGCCATTCGTATCTGCTCCTAATAAAAAGAAAGTTTC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 CAAAATGTTGTCCCCCAAAATGTAGCCATTCGTATCTGCTCCTAATAAAAAGAAAGTTTC 120
Qy 121 TTCACATTCT 130
||||||||||
Db 121 TTCACATTCT 130
(Db: Kanjolia - SEQ ID NO: 237)
Regarding claim 62, Kanjolia teaches that the 5′ and 3′ UTRs that are from the same source, e.g., a constitutively expressed mRNA such as actin, albumin, or a globin such as HBA, HBB, or XBG (para 0341).
Regarding claim 63, Kanjolia teaches an mRNA comprising a 5′ cap, such as a Cap0, Cap1, or Cap2 (paras 0353-0356).
Regarding claims 64 and 65, Kanjolia teaches mRNA comprising at least 10% of the uridine is substituted with a modified uridine and further teaches wherein the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine, 5-methoxyuridine, or 5-iodouridine (paras 0270, 0292, and 0337-0338).
Regarding claims 66 and 68, Dombrowski teaches a nucleic acid of SEQ ID NO: 177 having 100% sequence homology to the nucleic acid encoding the Cas9 comprising the SEQ ID NO: 377, wherein each uridine is modified or unmodified (claims 1 and 77; and OA.Appendix for sequence alignment).
Regarding claims 67 and 70, Kanjolia teaches mRNA comprising at least 10% of the uridine is substituted with a modified uridine and further teaches wherein the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine, 5-methoxyuridine, or 5-iodouridine (paras 0270, 0292, and 0337-0338).
Regarding claim 69, Kanjolia teaches an mRNA comprising a 5′ cap, such as a Cap0, Cap1, or Cap2 (paras 0353-0356) and that each thymidine in an open reading frame is replaced with a modified or unmodified uridine (paras 0337-0339).
Therefore the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 27-29, 34, 40, 54, 58, 60, and 64-67 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 92-110 of copending Application No. 19/295369 (reference application).
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims and conflicting claims are drawn to a composition comprising a mRNA comprising an ORF encoding Cas9 and an sgRNA, where the Cas9 and sgRNA are modified.
Claims 1 and 102 of the ‘369 application teaches a pharmaceutical formulation comprising (i) a sgRNA comprising the sequence mA*mA*mA*GGCUGCUGAUGACA CCUGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 87), wherein a * indicates a phosphorothioate (PS) linkage and a lower case "m" indicates that the nucleotide is 2'-O-Me modified and (ii) a messenger RNA (mRNA) comprising an open reading frame (ORF) that is at least 98% identical to SEQ ID NO: 311, wherein the ORF encodes a Cas9 and each thymidine in SEQ ID NO: 311 is replaced with a modified or unmodified uridine (claims 1 and 40). Claim 108 of the ‘369 application teaches the sgRNA and the mRNA are associated with a lipid nanoparticle (LNP) comprising a CCD lipid (claims 27-28). Claims 110 teaches that the CCD lipid is Lipid A and that the lipid further comprises DSPC, PEG2K-DMG, and cholesterol (claims 29 and 34). Claim 102 of the ‘369 application teaches the ORF comprises SEQ ID NO: 311, wherein each thymidine in SEQ ID NO: 311 is replaced with a modified or unmodified uridine (claim 54). Claims 103 and 105 of the ‘369 application teaches that each thymidine in SEQ ID NO: 311 is replaced with N1-methyl-pseudouridine, -pseudouridine, pseudouridine, 5 -methoxyuridine, or 5-iodouridine (claims 58, 60, and 65). Claim 104 teaches at least 10% of the uridine in the mRNA is modified uridine (claim 64). Claims 106-107 teach that the mRNA is at least 95% identical to SEQ ID NO: 377, wherein each uridine in SEQ ID NO: 377 is modified or unmodified and that each uridine in SEQ ID NO: 377 is N1-methyl-pseudouridine (claims 66-67).
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 30-32, 35, 38, 61-63, and 68-70 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 92-110 of copending Application No. 19/295369 in view of Kanjolia (US20200248180A1; published June 6, 2020, with priority date September 29, 2017; Cite No. 13 on page 3 of 15 page IDS filed 3/26/2026) and Dombrowski (US20200354702A1; published November 12, 2020; with priority date September 29, 2017; Cite No. 14 on page 3 of 15 page IDS filed 3/26/2026).
The teachings of claims 1 and 92-110 of the ‘369 are applied to claims 30-32, 35, 38, 61-63, and 68-70 as they have been applied to 1, 27-29, 34, 40, 54, 58, 60, and 64-67 in the NSDP rejection above.
The copending claims do not teach LNP compositions of elected part (iv) (claim 30-31), that the N/P ration of the LNP composition is about 6 (±0.5%) (claim 32), the percentages of LNP compositions comprising Lipid A, DSPC, PEG2K-DMG and cholesterol (claim 35), that the Cas9 comprises an NLS (claim 38), the mRNA comprising 5’ UTR with at least 90% identity to elected SEQ ID NO: 236 and 3’ UTR with at least 90% identity to elected SEQ ID NO: 237 (claim 61), and that the mRNA comprises a 5’ UTR and a 3’ UTR from the same source that is constitutively expressed (claim 62), that the mRNA comprises a 5’ cap selected from Cap0, Cap1, and Cap2 (claims 63 and 69), the composition comprises mRNA comprising SEQ ID NO: 377 (claim 68), and wherein each uridine in SEQ ID NO: 377 is N1-methyl-pseudouridine (claim 70).
In particular, Kanjolia teaches the limitations of claims 30-32, 35, 38, and 61-63 and Dombrowski teaches the limitations of 68-70 as described in the 103 discussion above.
It would have been obvious to one of ordinary skill in the art to have modified the composition of the copending claims with the LNP compositions, the 5’ UTR and 3’ UTR sequences, the 5’ cap, and N1-methyl-pseudouridine modifications as taught in Kanjolia and Dombrowski because Kanjolia and Dombrowski also teach pharmaceutical formulations comprising improved Cas9 and sgRNA components.
This is a provisional nonstatutory double patenting rejection.
Conclusion
No claims is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KHALEDA B HASAN whose telephone number is (571)272-0239. The examiner can normally be reached IFP, Monday - Friday 7:30am-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KHALEDA B HASAN/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Prosecution Insights