Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Application
Claims 1-7, 9, 10, 13-15, 17,19,36 and 87 are pending and under examination.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Vitak et al., Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al.
Claims 1-7, 9, 10, 13-15, 17, 36 and 87 are rejected under 35 U.S.C. 103 as being unpatentable over Vitak et al. (BioRxiv (2016): 065482; 18 pages; published 23 July 2016), as evidenced by Amini et al. (Nature genetics 46.12 (2014): 1343), in view of Wang et al. (Nature protocols 8.10 (2013): 2022-2032.); Smallwood et al. (Nature methods 11.8 (2014): 817-820.), Schroeder et al.(US20150011396) and Drmanac et al.(WO2014145820).
Vitak et al. disclose a method of sequencing comprising isolating nuclei, subjecting nuclei to treatment with Lithium diiodosalycylate or crosslinking and xSDS treatment to deplete nucleosomes; distributing the nucleosome-depleted nuclei to individual wells of a first 96 well plate and subjecting to a first barcoding step mediated by transposomes; pooling the resultant products, redistributing to a second 96 well plate and subjecting to a second barcoding step done by PCR (e.g. entire Vitak reference and especially Fig. 1, pg. 3 of 18; SCI-seq with nucleosome depletion, pg. 4-6 of 18; Methods section pg. 12-15 of 18).
Vitak et al. disclose uniquely barcoded adaptors for the first indexing step by transposition, i.e. tagmentation; barcoded primers for the second indexing step by PCR and sequencing primers as described by Amini et al. (e.g. Combinatorial indexing via tagmentation and PCR to Sequence Read Processing sections, Methods section, pg. 12-13).
As evidenced by Amini et al., the adaptors associated with the transposome complex comprise universal connector sequences, i.e. to facilitate attachment of P5 or P7 sequences, as well as unique barcode sequences. Furthermore, barcoded primers in the second indexing step comprise P5 and P7 compatible sequences as well as barcode sequences (e.g. Assembly of 96 indexed transposome complexes to Cluster generation and sequencing sections , Online Methods section, pg. 8 of 9; Supp Fig. 3, pg. 4 of 15, Amini Supp).
Therefore, Vitak et al. render obvious the limitations: a method comprising: (a) providing isolated nuclei from a plurality of cells; (b) subjecting the isolated nuclei to a chemical treatment to generating nucleosome-depleted nuclei, while maintaining integrity of the isolated nuclei; (c) distributing subsets of the nucleosome-depleted nuclei into a first plurality of compartments comprising a transposome complex, wherein the transposome complex in each compartment comprises a first index sequence that is different from first index sequences in the other compartments; (d) fragmenting nucleic acids in the subsets of nucleosome-depleted nuclei into a plurality of nucleic acid fragments and incorporating the first index sequences into at least one strand of the nucleic acid fragments to generate indexed nuclei (i.e. indexing using transposases ); (e) combining the indexed nuclei to generate pooled indexed nuclei; (f) distributing subsets of the pooled indexed nuclei into a second plurality of compartments; (h) incorporating a second index sequence into the amplified fragment-adapter molecules to generate dual-index fragment-adapter molecules, wherein the second index sequence in each compartment is different from second index sequences in the other compartments(i.e. indexing by PCR); and (i) combining the dual-index fragment-adapter molecules, thereby producing a sequencing library of nucleic acids from the plurality of single cells as recited in claim 1.
Furthermore, as Vitak et al. teach lithium-mediated nucleosome depletion (e.g. Nucleosome depletion section, Methods section pg. 12 of 18), they render obvious claims 2 and 3.
Furthermore, as Vitak et al. teach nucleosome depletion by crosslinking isolated nuclei with formaldehyde and treating xSDS (e.g. Nucleosome depletion section, Methods section pg. 12 of 18), they render obvious claims 4-7.
As Vitak et al. teach distribution of 2000 prepared single nuclei into each well of a 96 well plate and subsequent tagmentation of the contents of individual wells (e.g. Combinatorial indexing via tagmentation and PCR section, Methods section, pg. 12-13), they render obvious claims 9 and 10.
As Vitak et al. teach wells comprising tagmented single nuclei are pooled and re-distributed into another 96-well plate prior to a second indexing step by PCR, wherein each well comprises approximately 22 tagmented nuclei (e.g. Combinatorial indexing via tagmentation and PCR section, Methods section, pg. 12-13) , they render obvious claims 13-15.
As Vitak et al. teach distribution into 96-well plates, they render obvious claim 17.
Regarding claim 36:
As noted above, Vitak et al. teach using transposome-associated barcoded adaptors; barcoded primers and sequencing primers for an Illumina sequencing platform as described by Amini et al., wherein the resultant prepared target DNA molecules of Vitak et al. comprise sequences that are capable of capture onto flowcell-immobilized oligonucleotides comprising P5 and P7 complementary sequences during the sequencing process (e.g. Combinatorial indexing via tagmentation and PCR to Sequence Read Processing sections, Methods section, pg. 12-13).
Therefore, the teaching of Vitak et al., as evidenced by Amini et al., render obvious the requirement of enrichment of target nucleic acids using a plurality of capture oligonucleotides having specificity for the target nucleic acids, wherein the capture oligonucleotides are immobilized on a surface of a solid substrate(i.e. P5 and P7 complementary sequences) as recited in claim 36.
Therefore, Vitak et al. teach a method of labelling target nucleic acid by dual indexing, by transposition and by PCR, to prepare a sequencing library.
Furthermore, Vitak et al. disclose their method may be used to facilitate other nucleic acid applications, including DNA methylation analysis (e.g. While further optimization is possible, as with any new method, we believe that the throughput provided by SCI-seq will open the door to deep quantification of mammalian somatic genome stability as well as serve as a platform to assess other properties of single cells including DNA methylation and chromatin architecture as in 3rd para, Discussion section, pg. 11 of 18).
However, they do not expressly teach nucleic acid treatment followed by linear amplification as required by claim 1.
Therefore, Vitak et al. do not expressly teach the limitations: subjecting the indexed nuclei to treatment to identify methylated nucleotides and generate treated nucleic acid fragments; (g) amplifying the treated nucleic acid fragments in each compartment by four rounds of linear amplification with a plurality of primers comprising a universal nucleotide sequence at the 5’ end and a random nucleotide sequence at the 3’ end to generate amplified fragment-adapter molecules;
(h) incorporating a second index sequence into the amplified fragment-adapter molecules to generate dual-index fragment-adapter molecules, wherein the second index sequence in each compartment is different from second index sequences in the other compartments; and (i) combining the dual-index fragment-adapter molecules, thereby producing a sequencing library for determining the methylation status of nucleic acids from the plurality of single cells as recited in claim 1.
Prior to the effective filing date of the claimed invention, Wang et al. also teach a method of preparing a sequencing library using transposition and PCR. Furthermore, they teach the products of the transposition reaction are subjected to bisulfite treatment prior to a PCR reaction that adds an index sequence to facilitate subsequent sequencing (e.g. Fig. 1, pg. 2023).
Therefore, Wang et al. render obvious the requirement of subjecting samples modified by transposases to bisulfite treatment followed by an indexing PCR as required by claim 1.
Like Wang et al., Smallwood et al. teach preparing a bisulfite-treated library for sequencing.
Furthermore, Smallwood et al. teach their method of preparing libraries for sequencing comprises treating samples with a bisulfite solution and subjecting the bisulfite treated samples to a few rounds of linear amplification using an oligo comprising the universal sequence of a sequencing adaptor as well as a 3’ sequence of random nucleotides, followed by an indexing PCR (e.g. 2nd para, Introduction section, pg. 817, pg. 1 of 8; indexing PCR as in Fig. 1, pg. 818 (pg 2 of 6); Bisulfite conversion was performed … incubation at 65 °C for 3 min followed by 4 °C pause. 50 U of Klenow exo– (Sigma) were added and the samples incubated at 4 °C for 5 min, +1 °C/15 s to 37 °C, 37 °C for 30 min. Samples were incubated at 95 °C for 1 min and transferred immediately to ice before addition of fresh oligo 1 (10 pmol), Klenow exo– (25 U), and dNTPs (1 nmol) in 2.5 μl total. The samples were incubated at 4 °C for 5 min, +1 °C/15 s to 37 °C, 37 °C for 30 min. This random priming and extension was repeated a further three times (five rounds in total)… Samples were incubated at 95 °C for 45 s and transferred immediately to ice before addition of 100 U Klenow exo– (Sigma) and incubation at 4 °C for 5 min, +1 °C/15 s to 37 °C, 37 °C for 90 min. Beads were washed with 10 mM Tris-Cl (pH 8.5) and resuspended in 50 μl of 0.4 mM dNTPs, 0.4 μM PE1.0 forward primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT), 0.4 μM indexed iPCRTag reverse primer20, 1 U KAPA HiFi HotStart DNA Polymerase (KAPA Biosystems) in 1× HiFi Fidelity Buffer. Libraries were then amplified by PCR as follows: 95 °C 2 min, 12–13 repeats of (94 °C 80 s, 65 °C 30 s, 72 °C 30 s), 72 °C 3 min and 4 °C hold as in Single-cell library preparation section, Online Methods section, pg. 5 of 6).
Furthermore, Smallwood et al. teach methylation analysis from the reads of the resultant sequencing library (e.g. Sequencing data processing and data analysis section, Online Methods section, pg. 5 of 6).
Regarding the requirement of amplifying by four rounds of linear amplification as recited in claim 1:
Prior to the effective filing date of the claimed invention, Schroeder et al. teach that subjecting target nucleic acid sample to bisulfite treatment and then amplification is known in the art, wherein the amplification is linear amplification which is optimized over a limited number of rounds such as 4 rounds of amplification (e.g. Entire Schroeder reference and especially a method comprising treating sample with bisulfite and then amplifying the treated product as in para 0022-0025, pg. 2-4; “…Amplification can be by isothermal amplification, e.g., isothermal linear amplification. A hot start PCR can be performed wherein the reaction is heated to 95° C. for two minutes prior to addition of the polymerase or the polymerase can be kept inactive until the first heating step in cycle 1. Hot start PCR can be used to minimize nonspecific amplification... In some cases, the amplification methods can be performed under limiting conditions such that only a few rounds of amplification (e.g., 1,2,3,4,5,6,7…” as in para 0115, pg. 23).
The instant specification indicates that the results of four rounds of linear amplification are preferred to results from fewer rounds(e.g. Example 7, lines 21-22, pg. 52, instant specification). Therefore, the requirement of amplifying by a few rounds of linear amplification is interpreted to mean that the number of rounds of linear amplification can be optimized according to user’s choice, as taught by Schroeder et al.
Therefore, as noted in In re Aller, 105 USPQ 233 at 235, More particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation.
Routine optimization is not considered inventive and no evidence has been presented that the selection of optimizing conditions performed was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art.
Additionally, the step of using a limited number of rounds of amplification of claim 1 is considered a result-effective variable. See MPEP 2144.05. II. B. There is a Motivation to Optimize Result-Effective Variables.
Therefore, as the number of rounds of amplification can be optimized, the requirement of a limited number of rounds of amplification is not considered inventive.
Therefore, the claim limitations: amplifying by four rounds of linear amplification as required by claim 1, is made obvious over the teaching of Schroeder et al.
Additionally, prior to the effective filing date of the claimed invention, Drmanac et al. teach analysis of picogram quantities of nucleic acid (e.g. para 0182,pg. 34), including methylation analysis using bisulfite(e.g. para 0245-0248,pg. 47-48).
Furthermore, Drmanac et al. teach that it is known in the art to modulate the bisulfite treatment to minimize excessive fragmenting of target DNA (e.g. para 0248, pg. 48).
Therefore, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date to modify the method of Wang et al. comprising a first transposition step, a bisulfite treatment step and a subsequent indexing PCR step to include bisulfite treatment and linear amplification prior to the indexing PCR as taught by Smallwood because these are particular known techniques recognized as part of the ordinary capabilities of one skilled in the art that was recognized for achieving the predictable result of a method of preparing a bisulfite-treated sequencing library.
Furthermore, as Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al. all disclose methods for preparing sequencing libraries comprising bisulfite treatment of sample, a skilled artisan would appreciate that the method of the combined teachings of Wang et al. and Smallwood et al. can be modified such that the number of rounds of linear amplification are optimized to four rounds as taught by Schroeder et al. and such that the bisulfite treatment is optimized to minimize excessive fragmenting of the starting DNA sample as taught by Drmanac et al. because these are particular known techniques recognized as part of the ordinary capabilities of one skilled in the art that was recognized for achieving the predictable result of a method of preparing a bisulfite-treated sequencing library.
As Vitak et al., Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al. all disclose methods for preparing sequencing libraries, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date to modify the method of Vitak et al. comprising dual-indexing of sequencing libraries to include bisulfite treatment and linear amplification after the transposition step and prior to the indexing PCR step as taught by Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al. because these are particular known techniques recognized as part of the ordinary capabilities of one skilled in the art that was recognized for achieving the predictable result of a method of preparing a sequencing library. Furthermore, Vitak et al. teach their method can be used to facilitate DNA methylation analysis (e.g. While further optimization is possible, as with any new method, we believe that the throughput provided by SCI-seq will open the door to deep quantification of mammalian somatic genome stability as well as serve as a platform to assess other properties of single cells including DNA methylation and chromatin architecture as in 3rd para, Discussion section, pg. 11 of 18; Vitak 2016).
Therefore, the combined teachings of Vitak et al., as evidenced by Amini et al., Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al. render obvious the limitations: subjecting the indexed nuclei to treatment to identify methylated nucleotides and generate treated nucleic acid fragments; (g) amplifying the treated nucleic acid fragments in each compartment by four rounds of linear amplification with a plurality of primers comprising a universal nucleotide sequence at the 5’ end and a random nucleotide sequence at the 3’ end to generate amplified fragment-adapter molecules; and producing a sequencing library for determining the methylation status of nucleic acids from the plurality of single cells as recited in claim 1.
Therefore, considering the teachings discussed above, the combined teachings of Vitak et al., as evidenced by Amini et al., Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al. render obvious claims 1-7, 9,10, 13-15, 17 and 36.
Furthermore, the combined teachings of Vitak et al., as evidenced by Amini et al., Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al. render obvious the limitation: wherein the treatment to identify methylated nucleotides comprises bisulfite as recited in claim 87.
Vitak et al., Wang et al. Smallwood et al., Schroeder et al., Drmanac et al.
and Coll Mulet et al.
Claim 19 is rejected under 35 U.S.C. 103 as being unpatentable over Vitak et al., as evidenced by Amini et al., Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al., as applied to claims 1-7, 9, 10, 13-15, 17, 36 and 87 above, and further in view of Coll Mulet et al.(WO2015104302).
The combined teachings of Vitak et al., as evidenced by Amini et al., Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al. as applied in the previous rejection above are incorporated in this rejection.
The combined teachings of Vitak et al., as evidenced by Amini et al., Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al. disclose a method of dual-indexing target nucleic acid molecules , wherein their method also comprises bisulfite treatment and linear amplification prior to the indexing PCR reaction, wherein bisulfite treatment is optimized to prevent excessive fragmenting of the starting DNA sample.
Furthermore, Vitak et al. disclose a first indexing step comprising attaching barcoded adapters using transposomes (e.g. entire Vitak reference and especially Fig. 1, pg. 3 of 18; SCI-seq with nucleosome depletion, pg. 4-6 of 18; Methods section pg. 12-15 of 18).
Therefore, Vitak et al. render obvious the limitation: wherein each of the transposome complexes comprises transposases and transposons, each of the transposons comprising a transferred strand as required by claim 19.
As noted by Wang et al. (e.g. Bisulfite conversion section, pg. 2024, Wang), bisulfite treatment of target DNA results in conversion of unmethylated cytosine to uracils.
It is further noted that Wang et al. teach using transposase- incorporated adaptors comprising methylated cytosines which are not modified by bisulfite treatment is known in the art (e.g. entire Wang reference and especially Whereas conventional protocols require several steps for DNA fragmentation, end polishing, A-tailing and sequencing adapter ligation (e.g., ref. 12), tagmentation does this in a single reaction by using a hyperactive Tn5 transposase in combination with a DNA adapter11. T-WGBS uses a methylated adapter to prevent its conversion by bisulfite treatment10 as in Development of the protocol section, pg. 2022).
However, combined teachings of Vitak et al., as evidenced by Amini et al., Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al. do not expressly teach using adaptors that do not contain cytosine residues.
Prior to the effective filing date of the claimed invention, Coll Mulet et al. disclose a method of preparing a sequencing library for determining the methylation status of nucleic acids (e.g. Abstract) comprising attaching adaptors to target DNA molecules prior to bisulfite treatment and PCR amplification ( e.g. lines 7-25,pg. 9), wherein the adaptors do not contain cytosine residues (e.g. The adaptors, hairpin sequences and/or barcode sequences may contain nonmethylated cytosines and/or methylated cytosines. The adaptors, hairpin sequences and/or barcode sequences may not contain non-methylated cytosines. For example, the adaptors, hairpin sequences and/or barcode sequences do not contain cytosines as in lines 12-15, pg. 18).
Furthermore, Coll Mulet et al. teach that adaptor ligation may be mediated by a transposase (e.g. The first step of the present embodiment comprising fragmentation and ligation of the hemiadapter to the double stranded DNA molecules may be performed, for example, by in vitro transposition wherein a transposable element is introduced from a donor DNA (the hemiadapter molecules) into a target DNA (the population of double stranded DNA molecules) as in lines 14-18, pg. 55; lines 14-32, pg. 55-lines 1-32, pg. 56).
Therefore, as Coll Mulet et al. disclose a method comprising attaching adaptors that do not contain cytosine residues by in vitro transposition and subjecting target DNA to which these adaptors are attached to bisulfite treatment is known in the art, they render obvious the limitation: wherein each of the transposome complexes comprises transposases and transposons, each of the transposons comprising a transferred strand, wherein the transferred strand does not comprise a cytosine residue as required by claim 19.
Like Wang et al., Coll Mulet et al. disclose a method of preparing a sequencing library comprising attaching adaptors by in vitro transposition to target DNA prior to bisulfite treatment, wherein the adaptors are not modified by bisulfite treatment.
Therefore, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date to modify the method of Vitak et al., as evidenced by Amini et al., Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al. to include adaptors that do not contain cytosine residues as taught by Coll Mulet et al. because these claim elements were known in the art and one of skill in the art could have combined these elements by known methods with no change in their respective functions, and the combination would have yielded the predictable outcome of a method of preparing a bisulfite-treated sequencing library.
Therefore, the combined teachings of Vitak et al., as evidenced by Amini et al., Wang et al., Smallwood et al., Schroeder et al., Drmanac et al. and Coll Mulet et al. render obvious claim 19.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
U.S.Patent No. 11,535,883
Claims 1-7, 9, 10, 13-15, 17, 19, 36 and 87 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-14 of U.S. Patent No. 11,535,883 in view of Vitak et al. (BioRxiv (2016): 065482; 18 pages; published 23 July 2016), as evidenced by Amini et al. (Nature genetics 46.12 (2014): 1343), Wang et al. (Nature protocols 8.10 (2013): 2022-2032.);Smallwood et al. (Nature methods 11.8 (2014): 817-820.); Schroeder et al.(US20150011396);Drmanac et al.(WO2014145820) and Coll Mulet et al.(WO2015104302).
Claims 1-14 of U.S. Patent No. 11,535,883 disclose a method comprising subjecting nucleosome-depleted nuclei to in vitro transposition in a first indexing step in a first set of compartments, subsequently pooling the resultant tagged target sequences; redistributing the tagged products in a second set of compartments and subjecting to a second indexing step to prepare a sequencing library.
However, claims 1-14 of U.S. Patent No. 11,535,883 do not expressly teach bisulfite treatment of the tagmented DNA followed by linear amplification and prior to the second indexing step by PCR as required by claims 1-7, 9, 10, 13-15, 17, 19, 36 and 87.
However, as noted in the current rejections, this feature is known in the art, as taught by the combined teachings of Vitak et al., Wang et al., Smallwood et al., Schroeder et al. and Drmanac et al. Furthermore, the combined teachings of Vitak et al., as evidence by Amini et al., Wang et al., Smallwood et al., Schroeder et al., Drmanac et al. and Coll Mulet et al. render obvious claims 1-7, 9, 10, 13-15, 17, 19, 36 and 87.
Therefore, it would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date to modify the method of claims 1-14 of U.S. Patent No. 11,535,883 to include the teachings of Vitak et al., as evidenced by Amini et al., Wang et al., Smallwood et al., Schroeder et al., Drmanac et al. and Coll Mulet et al. because these are particular known techniques recognized as part of the ordinary capabilities of one skilled in the art that was recognized for achieving the predictable result of a method of preparing a bisulfite-treated sequencing library.
Response to the Arguments
Any rejection not reiterated or specifically addressed has been overcome by amendment. New rejections are set forth to address the amended claims.
However, previously cited references teach art relevant to the amended claims and therefore are included in the new rejections.
Regarding Applicants' arguments that the previously cited art does not meet the requirements of the amended claims: these arguments are not persuasive.
Regarding Applicants’ arguments in reference to the unexpected results: Examiner respectfully submits that these arguments are not persuasive.
Regarding Applicants’ argument that Examiner has dismissed the assertion of unexpected results: this argument is unpersuasive. As discussed in the previous action, see MPEP 716.02.
MPEP 716.02: Allegations of Unexpected Results
Any differences between the claimed invention and the prior art may be expected to result in some differences in properties. The issue is whether the properties differ to such an extent that the difference is really unexpected. In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986) (differences in sedative and anticholinergic effects between prior art and claimed antidepressants were not unexpected). In In re Waymouth, 499 F.2d 1273, 1276, 182 USPQ 290, 293 (CCPA 1974), the court held that unexpected results for a claimed range as compared with the range disclosed in the prior art had been shown by a demonstration of “a marked improvement, over the results achieved under other ratios, as to be classified as a difference in kind, rather than one of degree.” Compare In re Wagner, 371 F.2d 877, 884, 152 USPQ 552, 560 (CCPA 1967) (differences in properties cannot be disregarded on the ground they are differences in degree rather than in kind); Ex parte Gelles, 22 USPQ2d 1318, 1319 (Bd. Pat. App. & Inter. 1992) (“we generally consider a discussion of results in terms of ‘differences in degree’ as compared to ‘differences in kind’ . . . to have very little meaning in a relevant legal sense”).
As indicated in MPEP 716.02, unexpected results are considered in terms of differences in property that are actually unexpected.
Regarding the instant case, Applicant argues:
“…The inventors found that "[f]our rounds of linear amplification typically significantly increases the
read alignment rate and library complexity compared to fewer rounds" (specification, page 52,
lines 21-22, emphasis added). The elements of claim 1 work to significantly increase read
alignment rate.…”.
However, as stated in MPEP 716, Applicants’ assertion of unexpected results requires objective evidence , i.e. data. See MPEP 716, especially
MPEP 716.01 (a): Objective Evidence of Nonobviousness .
OBJECTIVE EVIDENCE MUST BE CONSIDERED WHEN TIMELY PRESENT Affidavits or declarations, when timely presented, containing evidence of criticality or unexpected results, commercial success, long-felt but unsolved needs, failure of others, skepticism of experts, etc., must be considered by the examiner in determining the issue of obviousness of claims for patentability under 35 U.S.C. 103…
Also: MPEP 716.01( c): Probative Value of Objective Evidence
TO BE OF PROBATIVE VALUE, ANY OBJECTIVE EVIDENCE SHOULD BE SUPPORTED BY ACTUAL PROOF
Objective evidence which must be factually supported by an appropriate affidavit or declaration to be of probative value includes evidence of unexpected results, commercial success, solution of a long-felt need, inoperability of the prior art, invention before the date of the reference, and allegations that the author(s) of the prior art derived the disclosed subject matter from the inventor or at least one joint inventor. See, for example, In re De Blauwe, 736 F.2d 699, 705, 222 USPQ 191, 196 (Fed. Cir. 1984) ("It is well settled that unexpected results must be established by factual evidence." "[A]ppellants have not presented any experimental data showing that prior heat-shrinkable articles split. Due to the absence of tests comparing appellant’s heat shrinkable articles with those of the closest prior art, we conclude that appellant’s assertions of unexpected results constitute mere argument."). See also In re Lindner, 457 F.2d 506, 508, 173 USPQ 356, 358 (CCPA 1972); Ex parte George, 21 USPQ2d 1058 (Bd. Pat. App. & Inter. 1991).
ARGUMENTS BY APPLICANT CANNOT TAKE THE PLACE OF EVIDENCE
Arguments presented by the applicant cannot take the place of evidence in the record. In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965) and In re De Blauwe, 736 F.2d 699, 705, 222 USPQ 191, 196 (Fed. Cir. 1984). Examples of statements which are not evidence and which must be supported by an appropriate affidavit or declaration include statements regarding unexpected results, commercial success, solution of a long-felt need, inoperability of the prior art, invention before the date of the reference, and allegations that the author(s) of the prior art derived the disclosed subject matter from the inventor or at least one joint inventor.
Furthermore, see MPEP 716.02 (b).I. : BURDEN ON APPLICANT TO ESTABLISH RESULTS ARE UNEXPECTED AND SIGNIFICANT …The evidence relied upon should establish "that the differences in results are in fact unexpected and unobvious and of both statistical and practical significance."
In the instant case, Applicant has not provided evidence that amplifying by four rounds of linear amplification will establish differences in results that are in fact unexpected and unobvious and of both statistical and practical significance.
Additionally, as discussed in the current rejections, Schroeder et al. teach that methods are known in the art comprising subjecting target nucleic acid sample to bisulfite treatment and then linear amplification, wherein linear amplification is optimized over a limited number of rounds such as 4 rounds of amplification(e.g. Entire Schroeder reference and especially a method comprising treating sample with bisulfite and then amplifying the treated product as in para 0022-0025, pg. 2-4; “…Amplification can be by isothermal amplification, e.g., isothermal linear amplification. A hot start PCR can be performed wherein the reaction is heated to 95° C. for two minutes prior to addition of the polymerase or the polymerase can be kept inactive until the first heating step in cycle 1. Hot start PCR can be used to minimize nonspecific amplification... In some cases, the amplification methods can be performed under limiting conditions such that only a few rounds of amplification (e.g., 1,2,3,4,5,6,7…” as in para 0115, pg. 23). Therefore, as discussed above, as noted in In re Aller, 105 USPQ 233 at 235, More particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the selection of optimizing conditions performed was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art.
Therefore, the current rejections, including the teaching of Schroeder et al. , are maintained.
Furthermore, regarding the rejection of claims 1-7, 9, 10, 13-15, 17, 19, 36 and 87 on the grounds of non-statutory double patenting, Applicants‘ arguments and the amendment have been fully considered and deemed unpersuasive for the reasons that follow. Applicants have not submitted arguments or documentation (i.e. terminal disclaimer) in response to the double patenting rejection. Therefore, the previous rejection of non-statutory double patenting is maintained.
Conclusion
No claims are allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAHANA S KAUP whose telephone number is (571)272-6897. The examiner can normally be reached on M-F 7-10 EST.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, HEATHER CALAMITA can be reached on 571-272-2876. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SAHANA S KAUP/Primary Examiner, Art Unit 1684
Prosecution Insights