DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on December 19, 2025 has been entered.
Application Status and Withdrawn Rejections
Applicant’s amendments filed December 19, 2025, amending claims 1, 10, 20 and 38, and canceling claim 24 and 37 is acknowledged. Although the claim classifier for claim 38 is listed as “previously presented”, it clearly has been amended. Claims 1-15, 20, 32-36 and 38 are pending. Claims 32-34 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to nonelected groups, there being no allowable generic or linking claim. Claims 1-15, 20, 35-36 and 38 are under examination.
The amendments to claims 1 and 38 overcome the objections set forth in the previous office action. Applicant’s arguments regarding the written description of “a phlO nucleic acid sequence” are persuasive (see Remarks, pages 6-8). The rejection under §112(a) is withdrawn.
Applicant argues that the present claims “recite subject matter of claim 36, which [] has been indicated to be allowable” (Remarks, page 9). Claim 36 requires the transcriptional activator expression construct to comprise SEQ ID NO 11 (i.e., with no substitutions, deletions or internal additions), which encodes an N-terminal fusion of the SV40 NLS to PhlF. However, all other claims except claims 10-13 encompass a much bigger genus – an expression construct that merely has 90% sequence identity to SEQ ID NO 11. This amendment overcomes the previous §103 rejections that were directed to a generic PhlF coding sequence fused to the coding sequence of a transcriptional activator. However, new §103 rejections that address the percent identity to the SEQ ID NO 11 are recited below.
Any other rejection or objection not reiterated herein has been overcome by amendment. Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Claim Interpretation
As indicated in the previous office action, claims 1-15 and 20 are directed to “A system comprising an orthologous repressible yeast gene expression construct”. “Orthologous” is interpreted as the claimed system does not activate or is not activated by any other regulated promoter systems that are functional in yeast, including those described in the specification – Tet, GAL, etc – or any endogenous promoter system. Additionally, claims 2 and 14 recite active steps, which are interpreted as functional limitations of their respective system components.
Claim Objections
Claims 1, 10, 13 and 20 are objected to because of the following minor informalities:
Claim 1 recites “(ii) a transcriptional activator expression construct comprising comprises a sequence…”, which is grammatically incorrect. “comprises” should be deleted. Appropriate correction is required.
Claim 10 recites “The system of claim 1, wherein the transcription enhancer expression construct comprises SEQ ID NO 11.” Claim 1 does not expressly recite “a transcription enhancer expression construct”. However, of the two expression constructs in claim 1, it is clear that “the transcription enhancer expression construct” is referring back to “a transcriptional activator expression construct” given the recitation of SEQ ID NO 11 in both claims and that transcriptional activators are known to enhance gene expression. To keep consistent claim terminology, it is suggested that claims 10 and 13 be amended to recite “wherein the transcription activator expression construct comprises SEQ ID NO 11” and “wherein the transcription activator expression construct further comprises a promoter sequence comprising the human cytomegalovirus promoter (CMV)”, respectively.
Claim 20 has two recitations of “a” between “comprising” and “sequence” in line 5. One “a” should be deleted. Appropriate correction is required.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 12 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 12 recites “the system of claim 10, further comprising a nucleic acid sequence encoding a nuclear localization signal (NLS).” Claim 10 requires the transcription enhancer expression sequence to comprise SEQ ID NO 11. According to the specification, SEQ ID NO 11 encodes the SV40 NLS fused to PhlF (pages 4-5). Therefore, the expression construct of claim 10 already includes a nucleic acid sequence encoding an NLS. As such, claim 12 fails to further limit the subject matter of claim 10.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(d):
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 11 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 11 recites “the system of claim 10, wherein the transcriptional activation domain comprises at least one VP16 tandem repeat”. “The transcriptional activation domain” lacks clear antecedent basis. An activation domain is not previously recited in claims 1 or 10. Additionally, SEQ ID NO 11 does not inherently encode an activation domain; it only encodes an NLS and PhlF, which is a DNA-binding domain. Although transcriptional activator expression constructs often comprise a coding sequence for a transcriptional activator domain, such as VP16, the transcriptional activation expression construct does not inherently require a transcriptional activator domain. It is possible that the activation expression construct uses alternative means to increase transcription such as recruiting an endogenous transcriptional activator. As such, it is not clear what “the transcriptional activation domain” is referring to.
To remedy the indefiniteness, it is suggested that claim 11 recite “The system of claim 10, wherein the transcriptional activator expression construct further comprises a sequence encoding at least on VP16 tandem repeat.”
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-2, 6-7, 14-15 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Belli (Bellí et al., Nucleic Acids Research (1998), 26: 942-947, of record) in view of Mullick (Mullick et al., BMC Biotechnology (2006), 6: 43, doi:10.1186/1472-6750-6-43, of record), Abbas (Abbas et al., Journal of Bacteriology (2002), 184: 3008-3016, of record), Stanton (Stanton et al. ACS Synthetic Biology (2014), 3: 880-891, and Supplemental material), Michaelis (Michaelis et al., Cell (1997), 91: 35-45), Addgene (Plasmid #40942, pAT222 https://www.addgene.org/40942/, first available in 2011, [retrieved 1/6/2026]), Genbank3 (AF207529.2, Pseudomonas fluorescence PhlA (phlA), PhlF (phlF), PhlG, (phlG, and PhlH (phlH) genes, complete cds, https://www.ncbi.nlm.nih.gov/nuccore/AF207529.2, [retrieved January 2, 2026]), Lanza (Lanza et al., BMC Systems Biology (2014), 8: 33, pages 1-10 and Supplemental Material) and Elena (Elena et al., Frontiers in Microbiology (2014), 5(21): 1-8). This is a new rejection necessitated by amendment.
Regarding claim 1, Belli teaches an activator/repressor expression system (i.e., a system for regulating gene expression) in yeast (Abstract). Belli teaches a construct comprising tetO (i.e., a regulator binding sequence) upstream of the coding sequence for Gene X (i.e., a target gene sequence) (Fig 2a). Belli teaches tetR-VP16 (i.e., a transcriptional activator) binds to tetO to drive expression of Gene X (Fig 2a). Belli also teaches the construct encoding tetR-VP16 (i.e., a transcriptional activator expression construct comprising the tetR nucleic acid sequence) (page 943, ¶3-4). Belli teaches that tetR-VP16 binds to tetO is in the absence of tetracycline, and is inhibited from binding tetO in the presence of tetracycline (Fig 2a). Belli teaches that the tetR-tetracyline system was adapted from the bacterial Tn10 transposon-derived tetO/tetR genes by attaching the transcriptional activator VP16 from herpes simplex virus to the tetR repressor (page 942, ¶2). Belli contrasts the tetO/tetR system to the GAL1 system that uses galactose to regulate transcription (i.e., the tetO/tetR system is orthologous to the GAL1 system) (Figure 1).
Although Belli teaches an engineered repressible gene expression system in yeast with all the functional features of claim 1, Belli does not teach the expression system using a regulator binding system comprising phlO and a transcriptional activator comprising SEQ ID NO 11, which codes for the SV40 nuclear localization signal (NLS) N-terminally fused to PhlF.
Mullick teaches TetR-VP16 was the first bacterial control system adapted to gene expression control in mammalian cells (page 2, ¶2). Mullick teaches that following the paradigm of the TetR system other microbial repressors regulating antibiotic resistance operons can be developed (page 2, ¶3). Mullick teaches engineering bacterial operons cmt and cym to regulate gene expression in eukaryotic cells (Abstract). Mullick teaches that the transcriptional regulator CymR normally acts as a repressor when bound to the operator sequence CuO (Fig 1B). Mullick teaches that when CymR is fused to VP16, the CymR-VP16 fusion binds CuO in the absence of cumate, which can be used to drive expression of a gene of interest in the absence cumate (Fig 1C). Mullick teaches that there is a need for additional heterologous systems for gene expression control (page 2, ¶3). Mullick teaches the tetracycline system is attractive because of the high specificity of the interaction of TetR with the operator sequence and tetracycline’s high affinity for the TetR (i.e., the tetO/tetR system is unlikely to cross talk with other inducible system) (page 2, ¶2). Mullick teaches the Cym/CuO/cumate system demonstrates tight control of gene expression (i.e., the Cym/CuO/cumate system is unlikely to cross talk with other inducible systems) (page 12, ¶2).
Abbas teaches 2,4-Diacetylphloroglucinol (aka PHL or DAPG) is produced by some bacteria using the phl locus (page 3008, ¶1-2). Abbas teaches that phlF encodes a transcriptional repressor that negatively regulates expression of the phlABCD operon (page 3008, ¶2 and 4). Abbas teaches that PhlF binds to a phO sequence within the sequence of the phl promoter (i.e., a regulator binding sequence comprising phlO sequence) (Fig 3). Abbas teaches that PhlF binds to the phO site in the absence of PHL (i.e., DAPG) and is inhibited from binding phO in the presence of PHL (Fig 8A; page 3012, ¶2). Abbas teaches that the PhlF system shows similarities to the tetO/tetR system and as such the PhlF/phlO is predicted to the function in similar ways as the tetO/tetR system (i.e., be specific to its ligand and operator sequence) (page 3014, ¶3).
Stanton teaches prokaryotic regulator systems provide a resource for building genetic sensors and circuits (Abstract). Stanton teaches using several different bacterial repressors and their responsive promoters to either repress or activate transcription in heterologous systems (Abstract). Stanton teaches that the repressor proteins, including PhlF, are modified to include an NLS domain (Abstract). Stanton teaches that activators can be constructed from the bacterial repressor proteins by attaching a VP16 domain in addition to the NLS (Abstract). Stanton teaches using the DAPG-responsive PhlF and its responsive promoter (i.e., phlO) in a genetic circuit (Fig 4). Stanton teaches the nucleic acid sequence encoding the NLS is ccccccaagaaaaagcggaaagtg (Supp Table 3), which translates to PKKKRKV.
Michaelis teaches fusing the SV40 NLS to the N-terminus of TetR to facilitate nuclear localization in Saccharomyces (page 44, ¶5).
Addgene teaches the sequence of the SV40 NLS is PKKKRKV in a yeast expression vector encoding the SV40 NLS fused to a different transcriptional repressor (pages 1 and 12). Addgene teaches the coding sequence for the SV40 NLS is ccaaagaagaagagaaaggtt (page 12), which is 100% identical to nucleotides 4-24 of SEQ ID NO 11.
Genbank3 teaches the nucleic acid sequence encoding PhlF (nucleotides 1580-2182).
Lanza teaches translational efficiency of heterologous genes can be improved by optimizing synonymous codon usage to better match the host organism and is standard tool for protein expression (Abstract). Lanza teaches there are several commercially available gene optimization algorithms (Abstract). Lanza teaches codon optimizing two bacterial coding sequences, one native and one heterologous, for expression in Saccharomyces cerevisiae (pages 4-5). Lanza teaches codon usage in Saccharomyces (Table S1).
Elena reviews the state of the art of codon optimizing genes as of 2014 (Abstract). Elena teaches that codon optimization tools were available from Genewiz and GenScript (page 2, ¶3).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have 1) substituted the TetR repressor gene, tetO sequence, and tetracycline inducer in Belli’s system with a PhlF transcriptional regulator gene, phlO binding sequence, and DAPG inducer taught in Abbas, 2) added an SV40 NLS to the N-terminus of PhlF for nuclear localization in yeast, and 3) codon optimized the resulting NLS-PhlF coding sequence for expression in yeast to arrive at a nucleic acid sequence that is 99% identical to SEQ ID NO 11. It would have merely amounted to simple substitution of one bacterial repressor and its cognate bacterial operator sequence for another and routine protein and nucleic acid engineering (i.e., NLS addition and codon optimization) of the bacterial PhlF coding sequence for eukaryotic expression to obtain predictable results.
Regarding the substitution of the TetR-tetO-tetracycline for the PhlF-phlO-DAPG, the skilled artisan would have predicted that the PhlF and phlO sequences and DAPG inducer could be used to develop a repressible gene expression construct because 1) Mullick demonstrates that additional gene expression systems can be used using the TetR-tetO paradigm, and 2) Abbas’s PhlF-phlO-DAPG system has the same functional components as the TetR-tetO-tetracycline and CymR-CuO-cumate systems. Thus, it was well established in the prior art that bacterial Repressor-Operator-Inducer systems can be adapted for controlling the expression of a gene of interest in eukaryotic cells. The skilled artisan would have been motivated to the adapt the PhlF-phlO-DAPG system in the same way because Mullick demonstrates the ease of which to so and teaches that there is a need for additional gene expression control systems. Because 1) both the TetR-tetO-tetracycline and CymR-CuO-cumate systems are specific for repressor/operator/ligand interactions and therefore deemed orthogonal to the one other and other regulated transcriptional systems in yeast, and 2) Abbas’s phlF/phlO/DAPG has many similarities to the TetR-tetO-tetracycline system, the skilled artisan would predict that the phlF/phlO/DAPG is also orthologous to other regulated transcriptional systems in yeast. Abbas’s phlF/phlO/DAPG would also have been predicted to be functional in yeast because of its similarity to the TetR-tetO-tetracycline, who’s functionality in yeast is well-established.
Regarding the addition of the SV40 NLS to the PhlF, the skilled artisan would have been motivated to include the SV40 PKKKRKV NLS sequence of Addgene with a reasonable expectation of success because Stanton, Michaelis, and Addgene teach that the SV40 NLS sequence can be added to bacterial transcriptional regulators like PhlF, TetR and LacI to promote nuclear localization when expressing the bacterial proteins in eukaryotic cells. PhlF is a bacterial protein, which inherently lacks an NLS. One would have been motivated to have attached an NLS when adapting Abbas’s PhlF/phlO/DAPG system for gene expression activation in eukaryotic cells in order to facilitate transport of PhlF into the nucleus where the transcriptional machinery resides.
Regarding specifically using an NLS-PhlF coding sequence that is at least 90% identical to SEQ ID NO 11, it would have been predictable to have arrived at an optimized NLS-PhlF coding sequence having over 99% identity to SEQ ID NO 11 using the available tools and codon usage tables provided in the prior art as follows. The coding sequence of the native PhlF coding sequence as taught in Genbank3 was codon optimized using codon optimization tools from Genewiz and GenScript, both of which were publicly available as of the effective filing date as evidenced by Elena. A ClustL sequence alignment of the native PhlF sequence (line 1), the Genewiz optimized sequence (line 2), the GenScript optimized sequence (line 3), and SEQ ID NO 11 (line 4) is provided in the Appendix to this Office Action (pages 1-3). Except for 26 codons, each of the codons in SEQ ID NO 11 were either predicted from the Genewiz or GenScript optimization tool. Each of SEQ ID NO 11 and the optimized sequences from Genewiz and GenScript were analyzed of codon content (see OA appendix, pages 4-9). Genewiz and GenScript returned 2 instances of the isoleucine codon ATT, whereas SEQ ID NO 11 uses ATC as the only isoleucine codon. The optimization tools altered 8 codons for threonine to either ACT or ACG, whereas SEQ ID NO 11 uses ACC as the sole threonine codon. The optimization tools altered 1 codon for tyrosine to TAT, whereas SEQ ID NO 11 uses TAC as the sole tyrosine codon. The optimization tools altered 3 codons for aspartic acid to GAT, whereas SEQ ID NO 11 uses GAC as the sole aspartic acid codon. The optimization tools altered 2 codons for lysine to AAA, whereas SEQ ID NO 11 uses AAG as the sole lysine codon. The optimization tools altered 2 codons for phenylalanine to TTT, whereas SEQ ID NO 11 uses TTC as the sole phenylalanine codon. The optimization tools do not use the GGA codon for glycine, but SEQ ID NO 11 has one instance of the GGA codon. However, Lanza teaches that the codons of ATC (isoleucine), ACC (threonine), TTC (phenylalanine), GGA (glycine), AAG (lysine), TAC (tyrosine), and GAC (aspartic acid) are utilized 21-43% of the time in Saccharomyces coding sequences (Table S1), indicating that they are not rare codons or expected to hinder protein expression of a recombinant protein. Therefore, all but 2 codons (corresponding to nucleotide positions 42 and 61) in SEQ ID NO 11 would have been obvious choices for expression of the bacterial PhlF protein in Saccharomyces cerevisiae. As such, a S. cerevisiae optimized NLS-PhlF coding sequence is 622/624 or 99.7% identical to SEQ ID NO 11. The skilled artisan would have been motivated to use the available optimization tools and codon usage tables to arrive at the sequence that is over 99% identical to SEQ ID NO 11, because Lanza teaches expression of recombinant prokaryotic proteins can be improved by optimizing synonymous codon usage to better match the host organism and is standard tool for protein expression.
Regarding claim 2, Belli teaches that tetR-VP16 binding to tetO in the absence of tetracycline results in the expression of the target gene (Fig 2a). Abbas teaches that PhlF binds to phlO in the absence of DAPG (Fig 9).
Regarding claim 6, Abbas teaches the sequence of the phl promoter and that PhlF binds TATGTATGATACGAAACGTACCGTATCGTTAAGGTAGCGT (Fig 3), which is SEQ ID NO 3. Abbas teaches that phO is specifically the underlined portion above (Fig 3), and that PhlF binding to the phO stabilizes its interaction with DNA (Fig 3-4; page 3011, ¶2-5). Abbas teaches that the phO box delineates the sequence of the probe use to determine whether phlF bound to the sequence (page 3011, ¶2).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used a regulator binding sequence that comprises at least SEQ ID NO 3, corresponding to the phO-assigned operator and nucleotides upstream and downstream of phO. It would have amounted to choosing a region of DNA that is known to bind PhlF to control transcription downstream of the operator sequence. The skilled artisan would have predicted that SEQ ID NO 3 could bind PhlF because Abbas teaches that it contains the major PhlF-binding sequence.
Regarding claims 7, Belli teaches the CMV TATA promoter downstream of the tetO binding sequence (Fig 2a).
Regarding claim 14, Belli teaches that the tetR/tetO/tetracycline system can also be adapted to inhibit expression of the target gene in the absence of tetracycline (Fig 2b). Mullick demonstrates that the CymR/CuO/cumate system can also be adapted to inhibit expression of the target gene in the absence of cumate (Fig 1B). The obviousness of adapting the phlF/phlO/DAPG system in ways known for adapting bacterial Repressor-Operator-Inducer systems for use in controlling gene expression in eukaryotic cells is recited above for claim 1.
Regarding claim 15, the teachings of Abbas regarding the phlO sequence and the obviousness of using SEQ ID NO 3 is recited above as for claim 6.
Regarding claim 20, the teachings of Belli, Mullick, Abbas, Stanton, Michaelis, Addgene, Genbank3, Lanza and Elena are recited above. Briefly, Belli teaches the tetR/tetO/tetracyline gene expression control system in yeast (i.e., a cell) (Abstract). Mullick teaches the CymR/CuO/cumate gene expression control system in mammalian cells (Abstract). Abbas teaches the native PhlF/plO/DAPG expression control system in bacteria. Together, Michaelis, Addgene, Genbank3, Lanza and Elena provide predictability and motivation for protein and nucleic acids engineering for using the PhlF-phlO-DAPG system in a eukaryotic cell such as S. cerevisiae.
It also would have been obvious to the skilled artisan before the effective filing date of the claimed invention to have additionally introduced the gene expression control system comprised of PhlF-phlO-DAPG system into a cell because Belli and Mullick demonstrate the functionality of bacterial Repressor-Operator-Inducer systems for controlling gene expression in yeast cells.
Claims 3-5 and 8-9 are rejected under 35 U.S.C. 103 as being unpatentable over Belli (Bellí et al., Nucleic Acids Research (1998), 26: 942-947, of record) in view of Mullick (Mullick et al., BMC Biotechnology (2006), 6: 43, doi:10.1186/1472-6750-6-43, of record), Abbas (Abbas et al., Journal of Bacteriology (2002), 184: 3008-3016, of record), Stanton (Stanton et al. ACS Synthetic Biology (2014), 3: 880-891, and Supplemental material), Michaelis (Michaelis et al., Cell (1997), 91: 35-45), Addgene (Plasmid #40942, pAT222 https://www.addgene.org/40942/, first available in 2011, [retrieved 1/6/2026]), Genbank3 (AF207529.2, Pseudomonas fluorescence PhlA (phlA), PhlF (phlF), PhlG, (phlG, and PhlH (phlH) genes, complete cds, https://www.ncbi.nlm.nih.gov/nuccore/AF207529.2, [retrieved January 2, 2026]), Lanza (Lanza et al., BMC Systems Biology (2014), 8: 33, pages 1-10 and Supplemental Material) and Elena (Elena et al., Frontiers in Microbiology (2014), 5(21): 1-8), as applied to claims 1-2, 6-7, 14-15, and 20 above, and further in view of Gari (Garí et al., Yeast (1997), 13: 837-848, of record). This is a new rejection necessitated by amendment.
The teachings of Belli, Mullick, Abbas, Stanton, Michaelis, Addgene, Genbank3, Lanza and Elena are recited above and applied as for claims 1-2, 6-7, 14-15, and 20.
Belli, Mullick, Abbas, Stanton, Michaelis, Addgene, Genbank3, Lanza and Elena do not teach that that the repressible gene expression construct comprises a transcriptional terminator sequence that is upstream of the regulator binding sequence and which is ADH1 (claims 3-5) or using a CYC1 promoter that lacks an upstream activating sequence (claims 8-9).
Gari teaches a gene expression control system in yeast using a tetR-VP16 activator (Abstract). Gari teaches the promoter region of a repressible expression construct (Fig 1a). Regarding claims 3-5, Gari teaches the promoter contains an ADH1 terminator (ADH1t) upstream of the tetO operator sequences (i.e., a transcription terminator sequence encoding ADH1 located upstream of the regulator binding sequence). Gari teaches that an ADH1 terminator sequence was placed upstream of the tetO sites in order to the avoid possible readthrough from other plasmid sequences (page 843, ¶1). Regarding claims 8-9, Gari teaches that there is a CYC1 TATA (i.e., a promoter) downstream of the tetO regulator binding sequence. Gari teaches that the CYC1 TATA region only has the TATA box from CYC1 (Fig 1a legend), and thus CYC1 TATA promoter lacks an upstream activating sequence. Gari teaches that using the CYC1 TATA region instead of the CMV TATA region increases inducer-mediated expression of the target gene (Figure 3).
Regarding claims 3-5 and 8-9, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have also included Gari’s AHDH1 terminator sequence upstream of the phlO operator sequence and Gari’s CYC1 TATA promoter downstream of the phlO operator sequence when adapting Abbas’s PhlF/phlO/DAPG system for gene expression control in yeast cells. It would have amounted to a simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that the ADH1 terminator and CYC1 TATA elements could be used with the PhlF/phlO/DAPG system because Gari teaches the elements are functional in yeast and demonstrate the utility in the similar TetR/tetO/tetracycline system. One would have been motivated to include the elements because Gari teaches that the ADH1 terminator prevents bleed through transcription and that the CYC1 promotes increased target gene expression.
Claim 35 is rejected under 35 U.S.C. 103 as being unpatentable over Belli (Bellí et al., Nucleic Acids Research (1998), 26: 942-947, of record), in view of Mullick (Mullick et al., BMC Biotechnology (2006), 6: 43, doi:10.1186/1472-6750-6-43, of record), Abbas (Abbas et al., Journal of Bacteriology (2002), 184: 3008-3016, of record), Genbank3 (AF207529.2, Pseudomonas fluorescence PhlA (phlA), PhlF (phlF), PhlG, (phlG), and PhlH (phlH) genes, complete cds, https://www.ncbi.nlm.nih.gov/nuccore/AF207529.2, [retrieved January 2, 2026]), and Genbank2 (BAM10891.1, Fusion protein of reverse tetracycline repressor protein and immediate early protein 1 activation domain, available April 11, 2012, https://www.ncbi.nlm.nih.gov/protein/BAM10891.1, [retrieved November 4, 2024], of record). This is a new rejection.
The teachings of Belli, Mullick and Abbas are recited above in paragraphs 23, 25 and 26 and are incorporated here.
As indicated above in paragraphs 33-34, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have substituted the TetR repressor gene, tetO sequence, and tetracycline inducer in Belli’s TetR-VP16/tetO/tetracycline system with a PhlF transcriptional regulator gene, phlO binding sequence, and DAPG inducer taught in Abbas. Briefly, the skilled artisan would have predicted that the PhlF and phlO sequences and DAPG inducer could be used to develop a repressible gene expression construct because it was well established in the prior art that bacterial Repressor-Operator-Inducer systems can be adapted for controlling the expression of a gene of interest in eukaryotic cells. The skilled artisan would have been motivated to the adapt the PhlF-phlO-DAPG system in the same way because Mullick demonstrates the ease of which to so and teaches that there is a need for additional gene expression control systems.
Belli, Mullick and Abbas do not teach the sequence of the amino acid sequence of PhlF or the VP16 transcriptional activator domain.
Genbank3 teaches the amino acid sequence of PhlF from Pseudomonas fluorescens (page 2), which is 100% identical to amino acids 1-200 of SEQ ID NO 10 (see attached BLAST alignment in OA Appendix, pages 10-11).
Genbank2 teaches the amino acid sequence of TetR-VP16. Amino acids 228-269 of TetR-VP16 (i.e., the activation domain) are 100% identical to amino acids 201-242 of SEQ ID NO 11 (see attached BLAST alignment in OA Appendix, pages 12-13).
It would have been obvious to one skilled in the art to have used the PhlF amino acid sequence reported in Genbank3 and the VP16 amino acid sequence reported in Genbank2 in the PhlF-VP16 transcriptional activator system rendered obvious above. It would have amounted to using known amino acid sequences for known protein domains by known means to yield predictable results. The skilled artisan would have been motivated to specifically use those sequences, with a reasonable expectation of success, because Genbank3 and Genbank2 teaches they are the amino acid sequences for the proteins used in Belli and Abbas.
Claim 38 are rejected under 35 U.S.C. 103 as being unpatentable over Belli (Bellí et al., Nucleic Acids Research (1998), 26: 942-947, of record), Mullick (Mullick et al., BMC Biotechnology (2006), 6: 43, doi:10.1186/1472-6750-6-43, of record), Abbas (Abbas et al., Journal of Bacteriology (2002), 184: 3008-3016, of record), Stanton (Stanton et al. ACS Synthetic Biology (2014), 3: 880-891, and Supplemental material), Michaelis (Michaelis et al., Cell (1997), 91: 35-45), Addgene (Plasmid #40942, pAT222 https://www.addgene.org/40942/, first available in 2011, [retrieved 1/6/2026]), Genbank3 (AF207529.2, Pseudomonas fluorescence PhlA (phlA), PhlF (phlF), PhlG, (phlG, and PhlH (phlH) genes, complete cds, https://www.ncbi.nlm.nih.gov/nuccore/AF207529.2, [retrieved January 2, 2026]), Lanza (Lanza et al., BMC Systems Biology (2014), 8: 33, pages 1-10 and Supplemental Material) and Elena (Elena et al., Frontiers in Microbiology (2014), 5(21): 1-8), as applied to claims 1-2, 6-7, 14-15, and 20 above, and further in view of Genbank2 (BAM10891.1, Fusion protein of reverse tetracycline repressor protein and immediate early protein 1 activation domain, available April 11, 2012, https://www.ncbi.nlm.nih.gov/protein/BAM10891.1, [retrieved November 4, 2024], of record). This is a new rejection necessitated by amendment.
Claim 38 recites the transcriptional activator expression construct comprising a nucleic acid encoding SEQ ID NO 10. According to the Specification SEQ ID NO 10 is the amino acid sequence of PhlF fused to the transcriptional activator domain VP16. It is noted that claim 1 already requires the transcriptional activator expression construct to comprise a specific nucleic acid sequence encoding NLS-PhlF. The nucleic acid sequence rendered obvious above that is 99.7% identical to SEQ ID NO 11, encodes the PhlF portion of SEQ ID NO 10 (see Genbank3 reference citations below). As such, this rejection is directed to the obviousness of adding an additional nucleic acid sequence to SEQ ID NO 11 that encodes the VP16 portion of SEQ ID NO 10.
The teachings of Belli, Mullick, Abbas, Stanton, Michaelis, Addgene, Genbank3, Lanza and Elena are recited above and applied as for claims 1-2, 6-7, 14-15, and 20. Genbank3 also teaches the amino acid sequence of PhlF (page 2), which is 100% identical to amino acids 1-200 of SEQ ID NO 10 (see attached BLAST alignment in OA Appendix, pages 10-11).
Belli, Mullick, Abbas, Stanton, Michaelis, Addgene, Genbank3, Lanza and Elena do not teach the sequence of the amino acid sequence of the VP16 transcriptional activator domain.
Genbank2 teaches the amino acid sequence of TetR-VP16. Amino acids 228-269 of TetR-VP16 (i.e., the activation domain) are 100% identical to amino acids 201-242 of SEQ ID NO 10 (see attached BLAST alignment in OA Appendix, pages 12-13).
It would have been obvious to one skilled in the art to have included a nucleic acid sequence encoding the VP16 amino acid sequence reported in Genbank2 to the nucleic acid sequence of SEQ ID NO 11 rendered obvious above to arrive at a nucleic acid sequence comprising a sequence encoding SEQ ID NO 10. It would have amounted to using known amino acid sequences for known protein domains by known means to yield predictable results. The skilled artisan would have been motivated to specifically use the VP16 amino acid sequence, with a reasonable expectation of success, because Genbank2 teaches the VP16 sequence used in Belli.
Response to Arguments - §103
Applicant argues that the claim amendments overcome the rejections of record (Remarks, page 9). This argument has been fully considered and is persuasive. However, the claims reciting less than 100% identity to SEQ ID NO 11 are still obvious over the prior art based on the well-known methods of fusing NLS domains to bacterial proteins for use in eukaryotic cells and codon-optimization.
Allowable subject matter
Claim 36 is allowable.
Claims 10 and 13 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Claim 11 would be allowable if rewritten to overcome the rejection(s) under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), 2nd paragraph, set forth in this Office action and to include all of the limitations of the base claim and any intervening claims.
Claims 10, 11, 13 and 36 require a transcription enhancer expression construct that comprises SEQ ID NO 11. According to the Specification, SEQ ID NO 11 encodes NLS-PhlF and is the result of codon-optimization using “GeneDesign (Richardson et al., 2006 Genome Res., 16: 550-556) for expression in yeast” (page 24, ¶2). The codon-optimization tool disclosed in Richardson does not appear to be publicly available any longer – the link at www.genedesign.org could not be reached – so Examiner could not verify a nucleotide sequence output by the program used in the Specification. A BLAST and ABSS search of SEQ ID NO 11 resulted in no known nucleotide sequence with over 80% sequence identity. However, as indicated in the §103 rejections above, using known parameters of codon-optimization for Saccharomyces cerevisiae, the model organism used in the working example, the skilled artisan could arrive at a sequence that is 99.7% identical to SEQ ID NO 11.
Upon closer analysis of the alignment, SEQ ID NO 11 has two arginine codons that are CGA (starred and underlined in the ClustL alignment in OA Appendix, page 1). CGA is a rare-codon in S. cerevisiae and other yeast and often causes ribosome-stalling and/or early termination which leads to low protein expression (Sharp et al., Yeast (1991), 7: 657-678, of record; Wada et al., FEBS Journal (2019), 286: 788-802, of record). Although the claims do not recite that SEQ ID NO 11 is to function in yeast, the combination of codons used in SEQ ID NO 11 does not appear to be optimized for any particular class of eukaryotic organism, for which the NLS coding sequence in SEQ ID NO 11 would be required. In each of the model eukaryotic organisms analyzed by Examiner (i.e., human, Drosophila, Arabidopsis), CGA appears to be a used less than 12% of the time (see tables at https://www.genscript.com/tools/codon-frequency-table). As such routine codon optimization of a nucleic acid encoding NLS-PhlF would not predictably result in SEQ ID NO 11. The claims that recite the sequence “comprising SEQ ID NO 11” require all of SEQ ID NO 11 with no substitutions, deletions, or internal additions, and are therefore not obvious in view of the prior art.
Conclusion
Claim 36 is allowed. Claims 1, 10, 13 and 20 are objected to. Claims 1-9, 11-12, 14-15, 20, 35 and 38 are rejected.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Examiner, Art Unit 1635