Prosecution Insights
Last updated: August 15, 2026
Application No. 17/040,783

BACTERIAL IDENTIFICATION METHOD USING RNA OF SAMPLE BACTERIA, AND KIT THEREFOR

Non-Final OA §103
Filed
Sep 23, 2020
Priority
Mar 26, 2018 — JP 2018-058663 +2 more
Examiner
RAVINDRA, KRISHNA NUGGEHALLI
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Mitsui Chemicals Inc.
OA Round
6 (Non-Final)
53%
Grant Probability
Moderate
6-7
OA Rounds
0m
Est. Remaining
83%
With Interview

Examiner Intelligence

Grants 53% of resolved cases
53%
Career Allowance Rate
8 granted / 15 resolved
-6.7% vs TC avg
Strong +30% interview lift
Without
With
+29.5%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
11 currently pending
Career history
38
Total Applications
across all art units

Statute-Specific Performance

§101
9.9%
-30.1% vs TC avg
§103
33.3%
-6.7% vs TC avg
§102
20.5%
-19.5% vs TC avg
§112
31.8%
-8.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 15 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant' s correspondence received October 16, 2025. Claims 1, 2, 4, 5, and 7 are currently pending. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1,2,4, 5, and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Godfrey et al. (US 20030017482, published January 23, 2003) and Amano et al. (WO2015053293A1, published April 04, 2015). Regarding Claim 1, Claim 1 recites, “the concentration of the primer for reverse transcription supplied from the reaction mixture is not less than 0.08nM and not more than 20nM” in step (2). The instant specification recites, “The following methods can be used to adjust the amount of primers for reverse transcription: (A) When the reaction mixture obtained by reverse transcription in the first reaction system is directly used alone for PCR in the second reaction system. Calculate the amount of the reaction mixture obtained in the first reaction system and the carrying-in concentration of the primer for reverse transfer by the reaction mixture relative to the total amount of the amount of the second reaction system containing this reaction mixture. Note that the amount of primers for reverse transcription consumed in the reverse transcription reaction is not considered in the calculation of this concentration. Therefore, the amount of the reverse transfer primer used in the calculation of this concentration is determined based on the amount of the reverse transfer primer added to the first reaction system. The concentration of the primer for reverse transfer to be added to the first reaction system is set so that the concentration of the primer for reverse transfer brought into the second reaction system thus calculated fails within the range described above.” (p. 12-13, lines 21-3) Therefore, the limitation for RT primer in Claim 1 step (2) is interpreted to be calculated as described in the specification through measurement of RT primer concentration prior reverse transcription, followed by a dilution calculation, and no loss of RT primer is assumed. Regarding Claim 1, Godfrey teaches a method having the following steps (1) to (3) that may be used for identifying bacterial pathogens (p. 1, [0004]). (1) A step of performing a reverse transcription reaction using a first reaction system comprising a primer for reverse transcription to prepare a cDNA containing a base sequence, an RNA extracted from in a sample, and an enzyme with RNA-dependent DNA polymerase activity to obtain a reaction mixture containing the synthesized cDNA and the primers for the reverse transcription (p. 4, [0047]-[0053]), (2) A step of performing PCR using a second reaction system comprising the reaction mixture, a primer pair for synthesis of a double-stranded DNA containing the base sequence and an enzyme with DNA-dependent DNA polymerase activity (p. 4-5, [0047]-[0053]), and (3) a step of detecting the generation of the double-stranded DNA containing the base sequence from the second reaction system after PCR (p. 7, [0007]-[0010], p.4, [0047]-[0059], see also Example 1). Godfrey teaches in Example 1, a method with a RT-PCR reaction with 10 nM RT primer concentration in the final product prior to PCR (p. 9, [0072-0073]). This is within the limitation of Claim 1, “the concentration of the primer for reverse transcription supplied from the reaction mixture is not less than 0.08 nM and not more than 20 nM”. Godfrey does not teach wherein the base sequence for identification of the bacterium of the bacterium of interest is contained in a 16S rDNA and 16S rRNA nor obtained Tm value is compared with the Tm value of the double-stranded DNA. Amano teaches amplification of 16S rRNA and 16S rDNA primer pair sets (pg. 6-7, para. 5-15) a Tm value of the generated double-stranded DNA is measured, and the obtained Tm value is compared with the Tm value of the double-stranded DNA including the sequence for identification of the bacterium of interest that has been measured beforehand, or data obtained secondarily from them, to identify the bacterium in the sample (pg. 7, para 16-20). It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have modified by Godfrey’s rapid multiplex QRT-PCR method for detecting viral and bacterial pathogens to include the known 16s rDNA fragments taught by Amano. One of ordinary skill in the art would have been motivated to make this modification because Amano demonstrates the advantages of identifying bacterial species with primer pair sets in the method and/or kit for RT-PCR amplification ([0001]) and the use of the Tm Values database for determining bacterial species. Therefore, one would have had predictable results and reasonable expectation for success to try Amano’s sequences and the medium of data to confirm findings. Regarding Claim 2, Godfrey teaches a bacterial identification method wherein the steps (1) and (2) are performed sequentially in different reaction vessels or in the same reaction vessel [0005]). Regarding Claim 4, Amano teaches the primer for reverse transcription consist of a based sequence that is 100% identical to the sequence of SEQ ID NO: 1 (see SEQ ID NO: 5 and alignment below): SEQ ID NO: 1 1 AGACCCGGGAACGTATTC 18 |||||||||||||||||||||| Amano, SEQ 5 1 AGACCCGGGAACGTATTC 18 Regarding Claim 5, Amano teaches wherein primer pairs that are 100% identical to the primer pairs recited as SEQ ID NO: 2-15, respectively (see SEQ ID NO: 2-15 and alignments below): SEQ ID NO: 2 1 GCAGGCTTAACACATGCAAGTCG 23 |||||||||||||||||||||||||||| Amano, SEQ 15 1 GCAGGCTTAACACATGCAAGTCG 23 SEQ ID NO: 3 1 CGTAGGAGTCTGGACCGT 18 |||||||||||||||||||||| Amano, SEQ 16 1 CGTAGGAGTCTGGACCGT 18 SEQ ID NO: 4 1 GTCCAGACTCCTACGGGAG 19 ||||||||||||||||||||||| Amano, SEQ 22 19 GTCCAGACTCCTACGGGAG 1 SEQ ID NO: 5 1 CCTACGTATTACCGCGG 17 |||||||||||||||||||| Amano, SEQ 50 1 CCTACGTATTACCGCGG 17 SEQ ID NO: 6 1 AGCAGCCGCGGTAATA 16 |||||||||||||||||||| Amano, SEQ 51 1 AGCAGCCGCGGTAATA 16 SEQ ID NO: 7 1 GGACTACCAGGGTATCTAATCCT 23 ||||||||||||||||||||||||||| Amano, SEQ 52 1 GGACTACCAGGGTATCTAATCCT 23 SEQ ID NO: 8 1 AACAGGATTAGATACCCTGGTAG 23 |||||||||||||||||||||||||||| Amano, SEQ 53 1 AACAGGATTAGATACCCTGGTAG 23 SEQ ID NO: 9 1 AATTAAACCACATGCTCCACC 21 ||||||||||||||||||||||||| Amano, SEQ 57 1 AATTAAACCACATGCTCCACC 21 SEQ ID NO: 10 1 TGGTTTAATTCGATGCAACGC 21 ||||||||||||||||||||||||| Amano, SEQ 62 1 TGGTTTAATTCGATGCAACGC 21 SEQ ID NO: 11 1 GAGCTGACGACAGCCAT 17 ||||||||||||||||||||| Amano, SEQ 70 1 GAGCTGACGACAGCCAT 17 SEQ ID NO: 12 1 GTTAAGTCCCGCAACGAG 18 |||||||||||||||||||||| Amano, SEQ 81 1 GTTAAGTCCCGCAACGAG 18 SEQ ID NO: 13 1 CCATTGTAGCACGTGTGTAGCC 22 |||||||||||||||||||||||||| Amano, SEQ 115 22 CCATTGTAGCACGTGTGTAGCC 1 SEQ ID NO:14 1 GGCTACACACGTGCTACAATGG 22 ||||||||||||||||||||||||||| Amano, SEQ 115 1 GGCTACACACGTGCTACAATGG 22 SEQ ID NO: 15 1 AGACCCGGGAACGTATTC 18 |||||||||||||||||||||| Amano, SEQ 5 1 AGACCCGGGAACGTATTC 18 Regarding Claim 7, Godfrey teaches a bacterial identification method wherein, after the step (1), the reaction mixture is directly alone or diluted and used in the step (2). (para [0042] and [0043]). Response to Arguments on Claim Rejections - 35 USC § 103 Applicant's arguments filed October 16, 2025 have been fully considered but they are not persuasive. Regarding Claim 1, Applicant argues Godfrey does not teach “an RT primer not less than 0.08nM and not more than 20 nM before or during the PCR”. Applicant argues Godfrey teaches the concentration of RT primer in paragraph [0072] for the reaction without a wax layer, but Godfrey does not teach a RT-PCR reaction took place, and the concentrations of paragraph [0072] does not apply to the reaction mixture in paragraph [0073]. As described above, the instant specification teaches that RT primer concentration in step (2) of Claim 1 is calculated before the RT reaction followed by dilution calculations with no loss of RT primer assumed. This is not persuasive because Godfrey does teach RT-PCR took place in paragraph [0074], and the reaction conditions of paragraph [0073] are the conditions of paragraph [0072] in order to compare the effect of the wax layer only. Paragraph [0074] recites the use of a RT-PCR thermocycler and a set of thermocycler conditions one skilled in the art would recognize as routine conditions for RT-PCR. Further, Godfrey compares the results of the RT-PCR and therefore performed the RT-PCR: “To compare the sensitivity of the one-tube RT-PCR with and without the wax… The results of the RT-PCR… Thus, this modified procedure resulted in at least a 20-fold increase in sensitivity” (p. 9, [0076]). If one assumed instead that the top solution in the modified procedure held 10 nM of β-gus RT primer instead of the combined final mixed solution as described, the final concentration of the β-gus RT primer would be (10*45/50) as calculated per the instant specification or 9 nM of β-gus RT primer, which is within the range of “not less than 0.08nM and not more than 20nM”. Applicant further argues, “The results associated with the RT primer concentration at 0.08-20 nM, especially the low-end value of 0.08 nM, in the PCR reaction were unexpected and provided secondary indica that a method for detecting bacteria involving the RT primer concentration at 0.08-20 nM in the PCR reaction was not obvious”. This is not persuasive because the RT concentrations are taught by the primary reference, Godfrey. Godfrey teaches an RT primer concentration of 10 nM in Example 1 prior to PCR as calculated by the instant specifications, and no modification of the procedure is necessary. Therefore, step (2) of Claim 1 including the RT concentration of Claim 1 is anticipated by Godfrey. This is not a limitation that the rejection argues would have been obvious because Godfrey’s method meets this limitation. Therefore, Applicant’s argument that the RT primer concentration was not obvious is not persuasive because it does not address the merits of the rejection. The obviousness rejection addresses the obviousness of combining the method of Godfrey for the RT-PCR reaction described in steps 1 and 2 of Claim 1 with the method of Amano for identifying bacterium of interest with 16S rRNA and performing step 3 of Claim 1. Applicant’s argument about the nonobviousness of the RT primer concentration does not specifically address these grounds of rejection. Conclusion No claims are allowed. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Krishna Nuggehalli Ravindra whose telephone number is (571)272-2758. The examiner can normally be reached M-Th, alternate F, 8a-5p est. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /K.N.R./Examiner, Art Unit 1636 /NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Show 12 earlier events
May 19, 2025
Non-Final Rejection mailed — §103
Jul 03, 2025
Applicant Interview (Telephonic)
Jul 24, 2025
Examiner Interview Summary
Oct 16, 2025
Response Filed
Dec 22, 2025
Final Rejection mailed — §103
Feb 23, 2026
Response after Non-Final Action
Apr 02, 2026
Request for Continued Examination
Apr 03, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12668847
SYSTEM AND METHOD FOR COMBATING INFECTIONS DUE TO PATHOGENS BELONGING TO PHYLUM PROTEOBACTERIA
4y 7m to grant Granted Jun 30, 2026
Patent 12522829
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
1y 2m to grant Granted Jan 13, 2026
Patent 12486520
INSECT EXTRACELLULAR VESICLES FOR DELIVERY OF NUCLEIC ACIDS
3y 9m to grant Granted Dec 02, 2025
Patent 12460189
RNA-GUIDED NUCLEASES AND DNA BINDING PROTEINS
4y 6m to grant Granted Nov 04, 2025
Patent 12441999
HYBRID htiRNA / NANOPARTICLE COMPLEX AND USE THEREOF FOR TREATING A DISEASE OF THE DIGESTIVE SYSTEM
3y 9m to grant Granted Oct 14, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

6-7
Expected OA Rounds
53%
Grant Probability
83%
With Interview (+29.5%)
3y 6m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 15 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month