Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after allowance or after an Office action under Ex Parte Quayle, 25 USPQ 74, 453 O.G. 213 (Comm'r Pat. 1935). Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, prosecution in this application has been reopened pursuant to 37 CFR 1.114. Applicant's submission filed on March 30, 2026 has been entered.
Amendments
Applicant's response and amendments, filed October 6, 2025, is acknowledged. Applicant has cancelled Claims 2-15, 17-33, 35-40, 42-44, 46-50, 52-55, 57-70, 72-94, 96-101, 104-128, 131-134, and 136-137, amended Claims 1, 16, 34, 41, 45, 51, 56, 71, 95, 102-103, 129-130, and 135, and added new claims, Claims 139-147.
Claims 1, 16, 34, 41, 45, 51, 56, 71, 95, 102-103, 129-130, 135, and 138-147 are pending.
Allowable Subject Matter
Applicant is advised that the Notice of Allowance mailed February 4, 2026 is vacated. If the issue fee has already been paid, applicant may request a refund or request that the fee be credited to a deposit account. However, applicant may wait until the application is either found allowable or held abandoned. If allowed, upon receipt of a new Notice of Allowance, applicant may request that the previously submitted issue fee be applied. If abandoned, applicant may request refund or credit to a specified Deposit Account.
Prosecution on the merits of this application is reopened on Claims 1, 16, 34, 41, 45, 51, 56, 71, 95, 102-103, 129-130, 135, and 138-147 considered unpatentable for the reasons indicated below.
As discussed previously, Claims 1 and 56 recite SEQ ID NO:3 (264 nucleotides) and SEQ ID NO:9 (253 nucleotides), which is the reverse-complement of nucleotides 1-253 of SEQ ID NO:3.
SEQ ID NO:3 (264 nucleotides) is disclosed to encode:
a Kozak sequence (nucleotides 1-6);
a spacer sequence for optimal distance between transcription and translation start site (nucleotides 7-29);
a minimal promoter (nucleotides 36-67);
a synthetic NFAT promoter (nucleotides 74-253); and
a spacer sequence for cloning purposes (nucleotides 254-264).
Nucleotides 254-264 of SEQ ID NO:3, for cloning purposes, are not considered to be material to patentability.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Those of ordinary skill in the art have long-recognized and successfully reduced to practice the ability to append their nucleotide sequence of interest to further comprise one or more nucleotides for cloning purposes, as such is merely routine molecular biology.
Liu et al (U.S. 2020/0115448; priority to April 26, 2017; of record) is considered relevant prior art for having disclosed a nucleic acid expression vector encoding a chimeric antigen receptor operably linked to a nucleic acid encoding an NFAT response element (SEQ ID NO:83) and comprising nucleotides 74-253 of instant SEQ ID NO:3 (upper lines), as shown below:
ACGCCTTCTGTATGAAACAGTTTTTCCTCCACGCCTTCTGTATGAAACAGTTTTTCCTCC 133
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ACGCCTTCTGTATGAAACAGTTTTTCCTCCACGCCTTCTGTATGAAACAGTTTTTCCTCC
ACGCCTTCTGTATGAAACAGTTTTTCCTCCACGCCTTCTGTATGAAACAGTTTTTCCTCC 193
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ACGCCTTCTGTATGAAACAGTTTTTCCTCCACGCCTTCTGTATGAAACAGTTTTTCCTCC
ACGCCTTCTGTATGAAACAGTTTTTCCTCCACGCCTTCTGTATGAAACAGTTTTTCCTCC 253
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ACGCCTTCTGTATGAAACAGTTTTTCCTCCACGCCTTCTGTATGAAACAGTTTTTCCTCC
Liu et al do not disclose the NFAT response element comprises nucleotides 1-73 of SEQ ID NO:3.
SEQ ID NO:3 and SEQ ID NO:9 appear to be free of the prior art.
However, as discussed below, instant independent Claims 1, 41, 45, and 51 do not recite nor require the entirety of SEQ ID NO:3 or SEQ ID NO:9, but rather Applicant has amended the independent claims to recite merely the presence of portions and/or subdomains of SEQ ID NO:3 and SEQ ID NO:9, having as few as 2 nucleotides identity to instant SEQ ID NO:3 and/or SEQ ID NO:9.
See 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections below.
In addition, the recitation of SEQ ID NO:3 or SEQ ID NO:9 do not obviate, correct, overcome, or otherwise render moot the other structure/function and/or method step(s)/function deficiencies of the instant claims discussed in the 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections below.
Priority
This application is a 371 of PCT/US2019/026378 filed on April 8, 2019. Applicant’s claim for the benefit of a prior-filed application provisional application 62/655,048 filed on April 9, 2018 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged.
Information Disclosure Statement
Applicant has filed an Information Disclosure Statement on March 30, 2026 that has been considered.
The signed and initialed PTO Forms 1449 are mailed with this action.
The Examiner cites below Applicant's own prior art, not cited in an IDS, to wit:
June et al (WO 12/079000).
Applicant is reminded of their duty to disclose information material to patentability. See MPEP §2001 and 37 C.F.R. 1.56.
The individuals covered by 37 CFR 1.56 have a duty to bring to the attention of the examiner, or other Office official involved with the examination of a particular application, information within their knowledge as to other copending United States applications which are "material to patentability" of the application in question. As set forth by the court in Armour & Co. v. Swift & Co., 466 F.2d 767, 779, 175 USPQ 70, 79 (7th Cir. 1972):
[W]e think that it is unfair to the busy examiner, no matter how diligent and well informed he may be, to assume that he retains details of every pending file in his mind when he is reviewing a particular application . . . [T]he applicant has the burden of presenting the examiner with a complete and accurate record to support the allowance of letters patent.
See MPEP §2001.06(b).
Pursuant to the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.), a copy of the Applicant's own publication(s) are not provided with the instant Office Action because it is presumed that Applicant has a copy of their own publications, as such is routine practice in the art, and that Applicant has provided their representative with a copy of said publications to establish a prosecution record. However, if Applicant’s representative insists upon receiving a copy of the entire references, then the Examiner will make attempts to provide it in the next Office Action.
Specification
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
1. Specific deficiencies and the required response to this Office Action are as follows:
The specification (e.g. pg 15, lines 23-24 and 29-30) and sequence listing disclose SEQ ID NO:1 and SEQ ID NO:2, each of which are only 6 nucleotides in length, and thus do not fulfill the minimal nucleotide sequence length requirements.
The specification is replete with such citations of SEQ ID NO:1 and SEQ ID NO:2.
Applicant should review the entirety of the specification and cancel each of the SEQ ID NO:1 and SEQ ID NO:2 references from throughout the specification and sequence listing.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
2. Claims 1, 16, 34, 41, 45, 51, 129-130, 135, 139-140, 142-143, and 145-146 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 1 and 135 recite the phrases “the sequence set forth in SEQ ID NO”.
Applicant iterates language previously rejected in the Office Action mailed August 29, 2024.
As a first matter, the claims recite the phrases “the…sequence set forth in”, which renders the claims indefinite because the reference SEQ ID NO’s are each composed of a plurality of amino acid or nucleotide sequences or subsequences, respectively, and it is unclear to which sequence or subsequence “set forth in” the reference SEQ ID NO Applicant refers.
The preposition “in”, per “set forth in” does not have the same meaning as the preposition “of”. For example, “in” indicates a location or position within a limit or reference, e.g. a fragment or some portion of the referenced SEQ ID NO.
The house is in Tippecanoe county.
PNG
media_image1.png
120
235
media_image1.png
Greyscale
Three cows are grazing in the field.
PNG
media_image2.png
113
291
media_image2.png
Greyscale
The preposition “of” indicates possession of the reference, characteristic, or trait, that is to say, the entirety of the referenced SEQ ID NO.
As a second matter, a broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claims 1 and 135 recites the broad recitation “nucleic acid sequence”, and the claim also recites “SEQ ID NO”, which is the narrower statement of the range/limitation.
The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
As a third matter, the phrase “the nucleotide acid sequence set forth in SEQ ID NO…” renders the claim indefinite because the referenced SEQ ID NO is composed of a plurality of nucleic acid subsequences, respectively, and it is unclear to which subsequence “sequence set forth in” the reference SEQ ID NO Applicant refers.
The Directors Technology Center 1600 Memorandum, Nucleic Acid and Peptide Claim Interpretation: “A” and “The” (December 29, 2005) informs the TC1600 Examiners that the phrase “A nucleic acid comprising a nucleotide sequence of SEQ ID NO:1” encompasses nucleic acids that comprise any portion of SEQ ID NO:1; whereas, the phrase “A nucleic acid comprising the nucleotide sequence of SEQ ID NO:1” is directed only to nucleic acids that comprise the full length of SEQ ID NO:1.
English has two articles: ‘the’, and ‘a/an’.
‘the’ is a definite article, referring to a specific or particular noun; whereas, ‘a/an’ is an indefinite article, modifying non-specific or non-particular nouns.
To the extent that Applicant is requiring the entirety of the referenced SEQ ID NO, then replacing the phrases “the… sequence set forth in” with the phrase “the… sequence of SEQ ID NO:” would render the rejection moot.
See Applicant’s amendment to the claim set filed October 28, 2024, “the nucleic acid sequence of SEQ ID NO:6”, for example.
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
3. Claims 51, 103, and 142 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 51, 103, and 142 are directed to a method of treating a human patient having a disease, disorder, or condition associated with the expression of a tumor antigen, the method comprising the step of administering to the human patient an effective amount of a pharmaceutical composition comprising an engineered immune cell genetically modified to comprise a viral vector encoding:
i) a constitutive promoter operably linked to a nucleic acid encoding a chimeric antigen receptor (CAR) that binds to the tumor antigen; and
ii) an inducible module comprising an inducible promoter and/or inducible enhancer operably linked to a nucleic acid encoding IL-18.
The claims are broad for reasonably encompassing an enormous genus of physiologically and phenotypically different results, which evokes the question:
A therapeutically effective amount to do what??
The claim(s) also denote(s) that there is an amount of the pharmaceutical composition comprising the recited engineered immune cell(s) genetically modified to comprise a viral vector encoding:
i) a constitutive promoter operably linked to a nucleic acid encoding a chimeric antigen receptor that binds to the tumor antigen; and
ii) an inducible promoter operably linked to a nucleic acid encoding IL-18,
that, upon administration to the human subject, is not, in fact, “a therapeutically effective amount”.
The phrase “an effective amount” has been held to be indefinite when the claim fails to state the function which is to be achieved and more than one effect can be implied from the specification or the relevant art. In reFredericksen, 213 F.2d 547, 102 USPQ 35 (CCPA 1954). MPEP 2173.05(c)
A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)).
A “therapeutically effective amount” is a functional property that is dependent upon many different variable parameters, including, but not limited to:
the type of genetically engineered immune cell [parameter 1];
the administration route by which the genetically engineered immune cell is administered to the human patient [parameter 2];
the dosage of the genetically engineered immune cell is administered to the human patient [parameter 3];
the structure of the minimal promoter, inducible promoter, and/or inducible enhancer by which IL-18 expression is induced when the CAR antigen binding domain binds to the target tumor antigen, and the corresponding amount or degree by which the IL-18 expression is induced [parameter 4];
the structure of the target tumor antigen [parameter 5];
the structure of the CAR tumor antigen-binding domain, and its corresponding binding affinity to said target tumor antigen [parameter 6];
the structure(s) of the CAR intracellular signaling domain(s) [parameter 7];
the disease/disorder/condition to be treated [parameter 8]; and
the phenotypic response to be achieved [parameter 9].
Parameter 1
The claims are broad for reasonably encompassing an genus of biologically and functionally distinct immune cells, including, but not limited to, immortalized T cell lines (Example 2, Jurkat T), T, NK, B, dendritic, and macrophage cells, as recited in Claim 41, or helper T cells, a cytotoxic T cells, memory T cells, regulatory T cells, gamma/delta T cells (e.g. pg 34, lines 18-19).
Rather, the working example is directed to primary human T cells (Example 3; pg 75, line 30, “Primary human T cells were activated, transduced”).
Parameter 2
The claimed methods are recited at a high level of generality for the multitude of anatomically distinct administration routes, including, but not limited to, delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic (e.g. pg 56, lines 16-18; High et al (U.S. 2015/0111955, [0077]).
Rather, the working example is directed to intravenous administration (e.g. pg 59, line 11, “intravenous administration”; Example 21, “Engineered primary T cells will be injected intravenously”).
Parameter 3
The claimed methods are enormously broad for failing to recite the dosage of the engineered immune cells that is/are to be administered to the human patient.
The breadth of the claims would appear to encompass cell dosages of 1, 10^1, 10^2, 10^3, 10^4, 10^5, 10^6, 10^7, 10^8, 10^9, 10^10, 10^11, 10^12, 10^13,…., 10^20 cells, etc…, or more, as there is no upper limit.
While the specification discloses T cell doses of 10^4 to 10^9 cells/kg body weight (e.g. pg 59, line 23), the specification also discloses the effective dose is based on variable factors including, but not limited to, the subject’s size, age, sex, weight, and condition (e.g. pgs 61-62, joining para).
The specification discloses administering 1x10^5, 3x10^5, or 1x10^6 CAR-T cells to a mouse subject (e.g. Example 15, Example 21).
Parameter 4
The claimed genus of minimal promoters is/are recited at a high level of generality.
The phrase “minimal promoter” is a relative term recited at a high level of generality which renders the claim indefinite. The term “minimal promoter” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention.
As discussed above, while it is clear the minimal promoter is to have at least one or two nucleotides that are “set forth in SEQ ID NO:3 or SEQ ID NO:9”, the claimed genus of minimal promoters is broader in scope than the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:9.
A sequence of 300 nucleotides, for example, reasonably encompasses about 4x10^180 structurally and functionally undisclosed polynucleotides.
A sequence of 200 nucleotides, for example, reasonably encompasses about 2x10^120 structurally and functionally undisclosed polynucleotides.
A sequence of 100 nucleotides, for example, reasonably encompasses about 1x10^60 structurally and functionally undisclosed polynucleotides.
A sequence of 75 nucleotides, for example, reasonably encompasses about 1x 10^45 structurally and functionally undisclosed polynucleotides.
A sequence of 50 nucleotides, for example, reasonably encompasses about 1x10^30 structurally and functionally undisclosed polynucleotides.
(calculator.net/exponent-calculator.html; last visited April 21, 2026)
The claims encompass an enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoter nucleotide sequences.
Rather, the specification discloses the minimal promoter of SEQ ID NO:6 (e.g. pg 78, lines 26-27, just 32 nucleotides in length, corresponding to nucleotides 36-67 of SEQ ID NO:3).
The claimed genus of inducible promoters is/are recited at a high level of generality.
The claims encompass an enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoter nucleotide sequences.
Rather, the specification discloses the inducible promoter is a NFAT promoter (e.g. pg 40, lines 21-24), corresponding to nucleotides 74-253 of SEQ ID NO:3.
The claimed genus of inducible enhancers operably linked to the inducible promoters is/are recited at a high level of generality.
The claims encompass an enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoter nucleotide sequences.
At best, the specification discloses NFAT responsive elements naturally present in the inducible NFAT promoter (e.g. pg 40, line 29), corresponding to nucleotides 74-253 of SEQ ID NO:3.
Those of ordinary skill in the art would immediately recognize that it is axiomatic that the degree or amount of IL-18 expression produced from:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
will necessarily vary, resulting in very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect.
Parameter 5
The claimed genus of target tumor antigen(s) is/are enormously broad, being recited at a high level of generality.
The Cleveland Clinic (my.clevelandclinic.org/health/body/24949-oncogenes; last visited July 14, 2025) teaches that there are more than 100 different oncogenes to various kinds of cancer.
Barrow et al (Tumor Antigen Expression in Melanoma Varies According to Antigen and Stage, Clin. Cancer Res. 12(3): 764-771, 2006) is considered relevant prior art for having taught that tumor antigen expression varies according to the antigen itself, and the stage of cancer disease, whereby the antigen expression may be lost, reduced, increased, fluctuates, or absent (e.g. Table 3).
Fritsch et al (U.S. 2018/0153975) is considered relevant prior art for having disclosed that tumor antigen epitopes may be as many as 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length (e.g. [0018, 30, 54]).
20^50 = about 1x10^65 structurally undisclosed peptide antigens.
20^40 = 1x10^52 structurally undisclosed peptide antigens.
20^30 = 1x10^39 structurally undisclosed peptide antigens.
20^20 = 1x10^26 structurally undisclosed peptide antigens.
20^10 = 1x10^13 structurally undisclosed peptide antigens.
The claim lacks adequate written description for the structure/function nexus between the enormously vast genus of structurally undisclosed first and second antigen binding domains that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed peptides from each of the more than 100 structurally different known oncogenes.
Parameter 6
The claimed genus CAR target tumor antigen-binding domains, and their corresponding binding affinities to the genus of target tumor antigens, is/are enormously broad, being recited at a high level of generality.
The specification discloses, for example, an IL-6Ra binding domain (e.g. pg 91, present in SEQ ID NO:22), a CD20 binding domain (e.g. pg 92, present in SEQ ID NO:23), a HER2 binding domain (e.g. pg 92, present in SEQ ID NO:25), each of which appear to be about 238 amino acids in length.
20^240 = an infinite genus of structurally and functionally undisclosed tumor antigen binding domains.
The claims are enormously broad for the essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains having an enormously broad genus of binding affinities, e.g. ranging from 10^1 to 10^-15M, or 1M to 1fM.
Those of ordinary skill in the art would immediately recognize that it is axiomatic that the degree or amount of the target tumor antigen binding affinity of the essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains will necessarily affect the ability of the inducible module comprising the:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
to induce expression of IL-18 when the antigen binding domain binds to the target tumor antigen, and thus will necessarily vary the degree or amount of IL-18 expression, resulting in very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect.
Parameter 7
The claimed genus CAR intracellular signaling domain(s) is/are enormously broad, being recited at a high level of generality.
The specification discloses intracellular signaling domains from a subgenus of 14 costimulatory molecule (e.g. pg 5, lines 1-3), with specific working examples of a chimeric antigen receptor comprising the combination of a human 4-1BB and a human CD3zeta intracellular signaling domains (e.g. pg 92, present in SEQ ID NO’s 23 and 25), resulting in an intracellular signaling domain of about 235 amino acids in length.
20^240 = an infinite genus of structurally and functionally undisclosed intracellular signaling domain(s).
Those of ordinary skill in the art would immediately recognize that it is axiomatic that the degree or amount of signaling from the essentially infinite genus of structurally and functionally unrecited and undisclosed intracellular signaling domain(s) of the essentially infinite genus of chimeric antigen receptors comprising the essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains will necessarily affect the ability of the inducible module comprising the:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
to induce expression of IL-18 when the antigen binding domain binds to the target tumor antigen, and thus will necessarily vary the degree or amount of IL-18 expression, resulting in very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect.
Parameter 8
The Examiner notes that the claims do not require the human subject/patient to actually have cancer, nor express the tumor antigen. Rather, the claims recite “associated with a tumor antigen”, which is broader in scope.
The claims are broad for reasonably encompassing an enormous genus of etiologically and pathologically distinct diseases/disorders/conditions. Espe (Malacards: The Human Disease Database, Resource Review, J. Medical Library Association 106(1): 2 pages, doi: dx.doi.org/10.5195/jmla.2018.253, January, 2018) is considered relevant prior art for having taught that there are at least 26,000 recognized genetic diseases afflicting humans (e.g. pg 1, col. 1). Thus, the claims are broad for encompassing an enormously vast genus of about 1x10^8 different viral pathogens (viruses are known in the art to cause cancer), and about 26,000 etiologically and pathologically different genetic diseases.
The claims are broad for reasonably encompassing an enormous genus of etiologically and pathologically distinct diseases, disorders, and/or conditions associated with a tumor antigen, including, but not limited to, a genus of etiologically and pathologically distinct autoimmune diseases (e.g. pg 24, lines 7-16) and a genus of etiologically and pathologically distinct cancers (e.g. pg 24, lines 23-29), including, but not limited to, hematologic cancer leukemias, acute leukemias, chronic leukemias, lymphomas, B-cell lymphoma, T-cell lymphoma, multiple myeloma, a solid tumor cell, a tumor of the breast, lung, prostate, colon, bladder, ovary, kidney, stomach, colon, rectum, testes, head and/or neck, pancreas, brain, skin, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), myelodysplastic syndromes (MDS), Hodgkin lymphoma, nodular sclerosis Hodgkin lymphoma (NSCHL), mixed cellularity Hodgkin lymphoma (MCcHL), lymphocyte-rich Hodgkin's disease (LRCHL), and lymphocyte-depleted Hodgkin's disease (LDHL), diffuse large B-cell lymphoma (DLBCL), primary mediastinal B cell lymphoma (PMBCL), follicular lymphoma (FL), small lymphocytic lymphoma (SLL), marginal zone lymphoma (MZL), mantle cell lymphoma (MCL), Waldenstrom's macroglobulinemia (WMG), Burkitt lymphoma (BL), peripheral T-cell lymphoma (PTCL ), anaplastic large cell lymphoma (ALCL ), angioimmunoblastic T-cell lymphoma (AITL), cutaneous T cell lymphoma, light chain multiple myeloma (LCMM), non-secretory multiple myeloma (NSMM), solitary plasmacytoma (SP), extramedullary plasmacytoma (EMP), monoclonal gammopathy of undetermined significance (MGUS), smoldering Multiple Myeloma (SMM), Immunoglobulin D multiple myeloma (IgD MM), Immunoglobulin E (IgE) multiple myeloma, colon cancer, colorectal cancer, fallopian tube cancer, gastric cancer, genitourinary cancer, head and neck cancer, liver cancer, lung cancer, melanoma, nasopharyngeal carcinoma (NPC), pancreatic cancer, prostate cancer, ovarian cancer, rectal cancer, renal cancer, skin cancer, stomach cancer, testicular cancer, thyroid cancer, urethral cancer breast cancer, squamous non-small cell lung cancer (NSCLC), non-squamous NSCLC, lung adenocarcinoma, mesothelioma, kidney clear cell carcinoma, kidney papillary cell carcinoma, hepatocellular carcinoma (HCC), castration-resistant prostate cancer, squamous cell carcinoma of the head and neck, carcinomas of the esophagus, carcinomas of the gastrointestinal tract, and endometriosis.
Parameter 9
The claims are broad for reasonably encompassing an enormous genus of physiologically and phenotypically different results, which evokes the question: A therapeutically effective amount to do what?
It is apparent that the amount must be therapeutic. Even so, the various endpoints and extents that define effective treatment are more of a conditional or qualitative nature, especially in the situation when it is not the tumor that is being treated, but the patient. As such, it is not evident what effect is necessarily achieved. Rather, the expected or desired effect that is to be achieved in the practice of the claimed invention to treat the patient is considered highly subjective and would tend to vary substantially.
The recitation implies a genus of unrecited and undisclosed phenotypes by which the therapeutically effective dose is to be determined and/or identified, thereby rendering the claim indefinite. A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)).
The claim(s) also denote(s) that there is an amount of the pharmaceutical composition comprising the engineered immune cell(s) genetically modified to comprise a viral vector encoding:
i) a constitutive promoter operably linked to a nucleic acid encoding a chimeric antigen receptor that binds to the tumor antigen; and
ii) an inducible promoter operably linked to a nucleic acid encoding IL-18,
that, upon administration to the human subject, is not, in fact, “a therapeutically effective amount”.
For example, the specification discloses:
i) achieve a particular biological result or provide a therapeutic or prophylactic benefit (e.g. pg 27, lines 9-10), e.g. relief of symptoms, rather than curing, the disease, condition, or disorder, or minimizing or partially or completely inhibiting development of the disease, condition, or disorder;
ii) decreasing tumor volume, decreasing the number of tumor cells, decreasing the number of metastases, increasing life expectancy, ameliorating various physiological symptoms associated with a cancerous condition (e.g. pg 23, lines 28-32); and
iii) preventing the occurrence of tumor in the first place (e.g. pg 24, line 2).
If there are multiple ways to measure “therapeutically effective dose”, to wit, concentration, time after administration, and/or phenotypic result, yet each yields a different result, then the claim may be indefinite because it is unclear which method is to be performed to determine infringement.
See further discussion below in the 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections.
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claims.
Appropriate correction is required.
4. Claims 51, 103, and 142 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The Examiner incorporates herein the above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection.
Claims 51, 103, and 142 are directed to a method of treating a human patient having a disease, disorder, or condition associated with the expression of a tumor antigen, the method comprising the step of administering to the human patient an effective amount of a pharmaceutical composition comprising an engineered immune cell genetically modified to comprise a viral vector encoding:
i) a constitutive promoter operably linked to a nucleic acid encoding a chimeric antigen receptor (CAR) that binds to the tumor antigen; and
ii) an inducible module comprising an inducible promoter and/or inducible enhancer operably linked to a nucleic acid encoding IL-18.
A “therapeutically effective amount” is a functional property that is dependent upon many different variable parameters, including, but not limited to:
the type of genetically engineered immune cell [parameter 1];
the administration route by which the genetically engineered immune cell is administered to the human patient [parameter 2];
the dosage of the genetically engineered immune cell is administered to the human patient [parameter 3];
the structure of the minimal promoter, inducible promoter, and/or inducible enhancer by which IL-18 expression is induced when the CAR antigen binding domain binds to the target tumor antigen, and the corresponding amount or degree by which the IL-18 expression is induced [parameter 4];
the structure of the target tumor antigen [parameter 5];
the structure of the CAR tumor antigen-binding domain, and its corresponding binding affinity to said target tumor antigen [parameter 6];
the structure of the CAR intracellular signaling domain(s) [parameter 7];
the disease/disorder/condition to be treated [parameter 8]; and
the phenotypic response to be achieved [parameter 9].
The claim(s) also denote(s) that there is an amount of the pharmaceutical composition comprising the engineered immune cell(s) genetically modified to comprise a viral vector encoding:
i) a constitutive promoter operably linked to a nucleic acid encoding a chimeric antigen receptor that binds to the tumor antigen; and
ii) an inducible promoter operably linked to a nucleic acid encoding IL-18,
that, upon administration to the human subject, is not, in fact, “a therapeutically effective amount”.
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is’).
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997).
It is understood that in order to meaningfully treat the subject, and thereby satisfy the requirements of 35 U.S.C. 101 (See MPEP 2107.01 III, Therapeutic or Pharmacological Utility), a therapeutically effective amount or dose of the genetically engineered immune cells must be administered to the subject, thereby achieving some real-world, clinically meaningful effect, and thereby being of “immediate benefit to the public”.
It is apparent that the amount must be therapeutic. Even so, the various endpoints and extents that define effective treatment are more of a conditional or qualitative nature, especially in the situation when it is not the tumor that is being treated, but the patient. As such, it is not evident what effect is necessarily achieved. Rather, the expected or desired effect that is to be achieved in the practice of the claimed invention to treat the patient is considered highly subjective and would tend to vary substantially.
Parameter 1
The claims are broad for reasonably encompassing an genus of biologically and functionally distinct human immune cells, including, but not limited to, immortalized T cell lines (Example 2, Jurkat T), T, NK, B, dendritic, and macrophage cells, as recited in Claim 41, or helper T cells, a cytotoxic T cells, memory T cells, regulatory T cells, gamma/delta T cells (e.g. pg 34, lines 18-19).
Figueroa et al (Chimeric Antigen Receptor Engineering: A Right Step in the Evolution of Adoptive Cellular Immunotherapy, Int. Reviews of Immunol. 34(2): 154-187, available online April 22, 2015) is considered relevant prior art for having taught that the art recognizes different T cell subpopulations to have marked differences in their phenotypic and differentiation states, such that they may each have specific uses, whereby selecting the defined T cell subpopulation for adoptive immunotherapy adds complexity, difficulty, and cost to an already expensive process (e.g. pg 167). Figueroa et al taught, for example, that Th17 helper T cells are more effective in tumor eradication than Th0 or Th1 cells (e.g. pg 168).
Marked differences in phenotypic and differentiation states suggests that distinct populations of T-cells may have specific uses. Characteristics such as suitability for ex vivo expansion, length of engraftment, antigen-dependent proliferative capacity, migratory capability, susceptibility to immunoediting and therapeutic efficacy are critical when defining "optimal" T-cell populations for CAR engineering and clinical use. Nonetheless, selecting defined T-cell subpopulations for ACI engineering purposes adds complexity, difficulty and cost to an already expensive process.
Rather, the working example is directed to primary human T cells (Example 3; pg 75, line 30, “Primary human T cells were activated, transduced”).
Parameter 2
The claimed methods are recited at a high level of generality for the multitude of anatomically distinct administration routes, including, but not limited to, delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic (e.g. pg 56, lines 16-18; High et al (U.S. 2015/0111955, [0077]).
Rather, the working example is directed to intravenous administration (e.g. pg 59, line 11, “intravenous administration”; Example 21, “Engineered primary T cells will be injected intravenously”).
Parameter 3
The claimed methods are enormously broad for failing to recite the dosage of the engineered immune cells that is/are to be administered to the human patient.
The breadth of the claims would appear to encompass cell dosages of 1, 10^1, 10^2, 10^3, 10^4, 10^5, 10^6, 10^7, 10^8, 10^9, 10^10, 10^11, 10^12, 10^13,…., 10^20 cells, etc…, or more, as there is no upper limit.
While the specification discloses T cell doses of 10^4 to 10^9 cells/kg body weight (e.g. pg 59, line 23), the specification also discloses the effective dose is based on variable factors including, but not limited to, the subject’s size, age, sex, weight, and condition (e.g. pgs 61-62, joining para).
Figueroa et al (2015) taught that one of the major unresolved issues in the clinical application of CAR-T cell therapy is the optimal number of cells required for a robust antitumor effect. The use of T cells with restricted proliferative capacity will require much higher "cellular doses" than the use of less differentiated T-cells with greater plasticity and replicative capacity, which also affects the degree of engraftment, persistence, replication, self-renewal, differentiation, and anti-target cells activity, as different T-cell types have different intrinsic properties, being more or less efficacious (e.g. pgs 167-168).
Clinical experience has demonstrated suboptimal homing of effector cells to solid tumors, limited engraftment, and generally disappointing results, including adverse events related to on- target/off-tumor effects and no significant clinical response (e.g. pg 170). The most common systemic toxicity associated with CAR-T cells relates to the systemic inflammatory response, and can result in anaphylaxis, which may be fatal (e.g. pg 172).
The specification discloses administering 1x10^5, 3x10^5, or 1x10^6 CAR-T cells to a mouse subject (e.g. Example 15, Example 21).
Parameter 4
The claimed genus of inducible promoters and/or inducible enhancers operably linked to the inducible promoters is/are recited at a high level of generality.
The phrase “minimal promoter” is a relative term recited at a high level of generality which renders the claim indefinite. The term “minimal promoter” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention.
As discussed above, while it is clear the minimal promoter is to have at least one or two nucleotides that are “set forth in SEQ ID NO:3 or SEQ ID NO:9”, the claimed genus of minimal promoters is broader in scope than the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:9.
A sequence of 300 nucleotides, for example, reasonably encompasses about 4x10^180 structurally and functionally undisclosed polynucleotides.
A sequence of 200 nucleotides, for example, reasonably encompasses about 2x10^120 structurally and functionally undisclosed polynucleotides.
A sequence of 100 nucleotides, for example, reasonably encompasses about 1x10^60 structurally and functionally undisclosed polynucleotides.
A sequence of 75 nucleotides, for example, reasonably encompasses about 1x 10^45 structurally and functionally undisclosed polynucleotides.
A sequence of 50 nucleotides, for example, reasonably encompasses about 1x10^30 structurally and functionally undisclosed polynucleotides.
The claims encompass an enormously vast genus of about 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed nucleotide sequences.
Rather, the specification discloses the minimal promoter of SEQ ID NO:6 (e.g. pg 78, lines 26-27, just 32 nucleotides in length, corresponding to nucleotides 36-67 of SEQ ID NO:3).
The claimed genus of inducible promoters is/are recited at a high level of generality.
The claims encompass an enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoter nucleotide sequences.
Rather, the specification discloses the inducible promoter is a NFAT promoter (e.g. pg 40, lines 21-24), corresponding to nucleotides 74-253 of SEQ ID NO:3.
The claimed genus of inducible enhancers operably linked to the inducible promoters is/are recited at a high level of generality.
The claims encompass an enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoter nucleotide sequences.
At best, the specification discloses NFAT responsive elements naturally present in the inducible NFAT promoter (e.g. pg 40, line 29), corresponding to nucleotides 74-253 of SEQ ID NO:3.
Those of ordinary skill in the art would immediately recognize that it is axiomatic that the degree or amount of IL-18 expression produced from:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
will necessarily vary, resulting in very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect.
Heinz et al (The selection and function of cell type-specific enhancers, Nat Rev Mol Cell Biol 16, 144-154, doi.org/10.1038/nrm3949, available online February 4, 2015) is considered relevant post-filing art for having taught that enhancers, which are functionally defined genetic elements, may be located at distances ranging from hundreds to millions of nucleotides away from a given target gene (pg 144, col. 1). Beyond the simple annotation of regulatory regions in the genome, it is important to understand how cells select the full complement of enhancers that are required for maintaining their identities and functions. Defining functional enhancer- promoter interactions remains an important goal. Despite being informative, chromatin connectivity maps do not directly relate chromatin interactions to the regulation of gene expression. Definitive evidence that a specific enhancer-like region exerts a transcriptional regulatory function requires the study of mutational effects on that region (e.g. pg 152, col. 2).
Maston et al (Transcriptional Regulatory Elements in the Human Genome, Ann. Rev. Genomics Hum. Genet. 7: 29-59, 2006) is considered relevant prior art for having taught that one of the main emerging challenges for genomics research is to identify all functional elements in the genome, including those that regulate gene expression (pg 30, col. 1). The structure of human gene promoters can be quite complex, typically consisting of multiple transcription regulatory elements. The presence of multiple regulatory elements within promoters confers combinatorial control of regulation, which exponentially increases the potential number of unique expression patterns. Such transcriptional regulatory elements include locus control regions (LCRs), insulators, silencers, enhancer, the core promoter, and proximal promoter elements (Figure 1). Although much improved over earlier prediction programs, these methods still have limited sensitivity and specificity when applied to genome-scale sequence data (pg 45, col. 2). While a number of bioinformatics approaches attempt to list potential transcription factor binding sites based on a statistical match between a region in the sequence and a site matrix. This analysis is often hampered by the prediction of a large number of sites, a significant fraction of which are likely false positives. In addition to the false-positive problem, the completeness of these databases is also an issue; it is likely that not all DNA-binding transcription factors have been identified, and even for some known factors, their binding specificity has not yet been fully characterized. (pg 46, col. 2). Transcription factor binding sites are small and degenerate, are often located distantly from the promoter upon which they act, and are not always conserved through evolution. These properties make regulatory elements difficult to identify through computational means alone (pg 48, col. 2).
Similarly, Thakurta (Computational identification of transcriptional regulatory elements in DNA sequence, Nucleic Acids Res. 34(12): 3585-3598, 2006) is considered relevant prior art for having taught that identification and annotation of all the functional elements in the genome, including genes and the regulatory sequences, is a fundamental challenge in genomics and computational biology. Since regulatory elements are frequently short and variable, their identification and discovery using computational algorithms is difficult (Abstract). However, our knowledge of the transcriptional regulatory elements in the genome and their contribution to gene expression in different spatial and temporal contexts is still limited. Given the complex pattern of regulatory interactions, the challenges involved in the complete elucidation of these elements in the genome are substantial (pg 3593, Conclusion).
Parameter 5
The claimed genus of target tumor antigen(s) is/are enormously broad, being recited at a high level of generality.
The Cleveland Clinic (my.clevelandclinic.org/health/body/24949-oncogenes; last visited July 14, 2025) teaches that there are more than 100 different oncogenes to various kinds of cancer.
Barrow et al (Tumor Antigen Expression in Melanoma Varies According to Antigen and Stage, Clin. Cancer Res. 12(3): 764-771, 2006) is considered relevant prior art for having taught that tumor antigen expression varies according to the antigen itself, and the stage of cancer disease, whereby the antigen expression may be lost, reduced, increased, fluctuates, or absent (e.g. Table 3).
Fritsch et al (U.S. 2018/0153975) is considered relevant prior art for having disclosed that tumor antigen epitopes may be as many as 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length (e.g. [0018, 30, 54]).
20^50 = about 1x10^65 structurally undisclosed peptide antigens.
20^40 = 1x10^52 structurally undisclosed peptide antigens.
20^30 = 1x10^39 structurally undisclosed peptide antigens.
20^20 = 1x10^26 structurally undisclosed peptide antigens.
20^10 = 1x10^13 structurally undisclosed peptide antigens.
The claim lacks adequate written description for the structure/function nexus between the enormously vast genus of structurally undisclosed antigen binding domains that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed peptides from each of the more than 100 structurally different known oncogenes.
Figueroa et al (2015) taught that while CAR immunotherapy shares the common goal of specifically targeting and eradicating target disease cells, the different strategies exploit distinct components of the immune system and their generalized success has been hindered by the paucity of specific antigen targets, resulting in suboptimal responses and unpredictable toxicities (e.g. Abstract).
Parameter 6
The claimed genus CAR target tumor antigen-binding domains, and their corresponding binding affinities to the genus of target tumor antigens, is/are enormously broad, being recited at a high level of generality.
The specification discloses, for example, an IL-6Ra binding domain (e.g. pg 91, present in SEQ ID NO:22), a CD20 binding domain (e.g. pg 92, present in SEQ ID NO:23), a HER2 binding domain (e.g. pg 92, present in SEQ ID NO:25), each of which appear to be about
22-260 = about 238 amino acids in length.
20^240 = an infinite genus of structurally and functionally undisclosed tumor antigen binding domains.
Poosarla et al (Computational De Novo Design of Antibodies Binding to a Peptide With High Affinity, Biotech. & Bioengin. 114(6): 1331-1342, 2017) designed scFv fragments that bind to the same 12-mer epitope/antigen, and demonstrate substantial diversity in said antibody amino acid sequences (Figure 3). It appears that even though all antibodies bind to the same 12-mer they bind to different epitopes within it.
Edwards et al (The Remarkable Flexibility of the Human Antibody Repertoire; Isolation of Over One Thousand Different Antibodies to a Single Protein, BLyS, J. Mol. Biol. 334: 103-118, 2003) taught the ability to identify over 1000 antibodies composed of structurally different amino acid sequences that bind to a single antigen (see entire paper).
Given the highly diverse structural nature of antibodies, particularly in the CDRs, one of ordinary skill in the art generally cannot envision the structure of an antibody by knowing its binding characteristics.
It is well established in the art that the formation of an intact antigen-binding site generally requires the association of the complete heavy and light chain variable regions of a given antibody, each of which consists of three CDRs or hypervariable regions which provide the majority of the contact residues for the binding of the antibody to its target epitope. The amino acid sequences and conformations of each of the heavy and light chain CDRs are critical in maintaining the antigen binding specificity and affinity which is characteristic of a given antibody. It is expected that all of the heavy and light chain CDRs in their proper order and in the context of framework sequences, which maintain the required conformation of the CDRs are required in order to produce a protein having antigen-binding function; and further, that proper association of heavy and light chain variable regions is required in order to form functional binding sites.
MacCallum et al (Antibody-antigen Interactions: Contact Analysis and Binding Site Topography, J. Mol. Biol. 262:732-745, 1996) analyzed many different antibodies for interactions with antigen and state that although CDR3 of the heavy and light chain dominate, a number of residues outside the standard CDR definitions make antigen contacts (pg 733, col. 2) and non-contacting residues within the CDRs coincide with residues as important in defining canonical backbone conformations (pg 735, col. 1).
The fact that not just one CDR is essential for antigen binding or maintaining the conformation of the antigen binding site, is underscored by Casset et al (A peptide mimetic of an anti-CD4 monoclonal antibody by rational design, Biochem. Biophys. Res. Comm. 307:198-205, 2003), who constructed a peptide mimetic of an anti-CD4 monoclonal antibody binding site by rational design and the peptide was designed with 27 residues formed by residues from 5 CDRs (see entire document). Casset et al also states that although CDR H3 is at the center of most if not all antigen interactions, clearly other CDRs play an important role in the recognition process (pg 199, col. 1). Thus, while one can make the statement that CDRs from a single antibody chain make a significant contribution in the antigen binding, the CDR domains from a single chain are not the only residues that influence binding, and in fact the prior art does not support that CDR domains from a single chain alone are sufficient to define the binding specificity of an antibody.
Goel et al (Plasticity within the Antigen-Combining Site May Manifest as Molecular Mimicry in the Humoral Immune Response, J. Immunol. 173: 7358-7367, 2004) taught the generation of monoclonal antibodies directed to the same antigen, whereby three antibodies that bind to the same 12-mer epitope/antigen have substantial amino acid diversity in the CDRs (Figure 3) and binding kinetics (Table III, Figure 6).
It has been well-documented that both the FRs and CDRs are required for binding, Sela-Culang et al (The structural basis of antibody-antigen recognition, Frontiers in Immunology 4: Article 302, 13 pages, doi: 10.3389/fimmu.2013.00302; available online October 8, 2013) is considered relevant prior art for having taught that while the six CDRs are widely assumed to be responsible for antigen recognition, recent studies and analyses of a growing number of available antibody structures indicate that this assumption is an oversimplification. Some amino acid positions in the CDRs have been shown to never participate in antigen binding, and some amino acid positions in the framework regions, outside the CDRs, often contribute critically to the interaction with antigen (e.g. Abstract).
Rather, some studies indicate that only 20-30% of the CDR residues participate in antigen binding, while the remaining residues are important for maintaining structural conformations of the hypervariable loops (e.g. pg 4, col. 1).
Sela-Culang et al taught that “it is now well established that some of the FR residues may play an important role in Ag binding.” The FR regions can influence antigen binding both directly and indirectly (e.g. pg 7, col. 1).
Sela-Culang et al taught that the prior art recognized that simply grafting only the CDRs of a mouse antibody onto a human variable region framework usually results in a significant drop, or a complete loss, of antigen binding. In order to restore antigen binding, one needs to mutate back some of the framework residues to the original mouse antibody (e.g. pg 7, col. 1).
Some of these framework residues that contact and bind the antigen are close in sequence to the CDRs, while other framework residues are far from the CDRs in the primary sequence, but closer proximity in the 3-D structure (e.g. pg 7, col’s 1-2, joining para).
A second category of framework residues that affect antigen binding are those that affect antigen binding indirectly, e.g.:
i) by providing a structural support to the CDRs, enabling them to adopt the right conformation and orientation, shaping the binding site required for antigen binding; or
ii) maintaining the overall structure of the Fv domains by directing the relative orientation of the VH vs VL domains, and thus the orientation of the CDRs relative to each other (e.g. pg 7, col. 2).
The claims are enormously broad for the essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains having an enormously broad genus of binding affinities, e.g. ranging from 10^1 to 10^-15M, or 1M to 1fM.
Srivastava and Riddell (Engineering CAR-T cells: Design concepts, Trends Immunol. 36(8): 494-502; available online July 15, 2015) is considered relevant prior art for having taught that it remains to be determined whether CARs can be designed with avidity thresholds that are sufficiently tuned to distinguish target cells based on high and low levels of target antigen expression. It seems likely that, with such targets, toxicity will be a potentially serious issue (e.g. pg 496, col. 2). While the biochemical principles of (Kon)/ (Koff) rates, and binding affinity were recognized in the art for being important parameters when designing CARs (Table 2), such values must be determined empirically to optimally activate T cells for tumor recognition (pgs 500-501, joining para). The spatial distance between CARs and their target antigens is important for effective initiation of T cell signaling, but depends on an entirely different set of structural elements related to the location of the epitope on the target molecule and the spacer domain between the CAR antigen binding domain and the T cell membrane. For example, in some studies, the same epitope can activate CAR-T cells with greater efficiency when expressed in a more membrane- proximal position than a membrane-distal position (e.g. pg 498, col. 2).
Rudikoff et al (Single Amino Acid Substitution Altering Antigen-binding Specificity, PNAS 79:1979-1983, 1982) taught that a single amino acid substitution is sufficient to alter the antigen-binding specificity, and thus alters antigen-binding affinity constants.
Vu et al (U.S. 2015/0368351) disclosed that the same antigen binding domain will have different binding affinity values, corresponding (Koff) values, and corresponding (Kon) values, depending upon the target antigen (Table 6). Thus, knowing the structure of an antigen binding domain does not immediately lead to knowing the corresponding values of binding affinity and kinetics to the corresponding target antigen. Rather, each of the values must be determined empirically.
Given the highly diverse structural nature of antigen binding domains one of ordinary skill in the art generally cannot envision the structure of a tumor antigen binding domain by knowing its binding characteristics.
Those of ordinary skill in the art would immediately recognize that it is axiomatic that the degree or amount of the target tumor antigen binding affinity of the essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains, and their corresponding binding affinities, will necessarily affect the ability of the inducible module comprising the:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
to induce expression of IL-18 when the antigen binding domain binds to the target tumor antigen, and thus will necessarily vary the degree or amount of IL-18 expression, resulting in very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect.
Ramos et al (In Vivo Fate and Activity of Second- versus Third-Generation CD19-Specific CAR-T Cells in B Cell Non-Hodgkin’s Lymphomas, Molecular Therapy 26(12): 2727-2737, doi: 10.1016/j.ymthe.2018.09.009; available online December 5, 2018) is considered relevant post-filing art for having taught a novel chimeric antigen receptor not disclosed by Applicant.
Zhang et al (Recombination of a dual-CAR-modified T lymphocyte to accurately eliminate pancreatic malignancy, J. Hematol. Oncol. 11: Article 102, doi.org/10.1186/s13045-018-0646-9, available online August 13, 2018) is considered relevant post-filing art for having taught a novel chimeric antigen receptor not disclosed by Applicant.
Those of ordinary skill in the art would immediately recognize that Applicant is simply not in possession of the essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising the essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains, and their corresponding binding affinities, that will necessarily affect the ability of the inducible module comprising the:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
to induce expression of IL-18 when the antigen binding domain binds to the target tumor antigen.
Parameter 7
The claimed genus CAR intracellular signaling domain(s) is/are enormously broad, being recited at a high level of generality.
The specification discloses intracellular signaling domains from a subgenus of 14 costimulatory molecule (e.g. pg 5, lines 1-3), with specific working examples of a chimeric antigen receptor comprising the combination of a human 4-1BB and a human CD3zeta intracellular signaling domains (e.g. pg 92, present in SEQ ID NO’s 23 and 25), resulting in an intracellular signaling domain of about 235 amino acids in length.
20^240 = an infinite genus of structurally and functionally undisclosed intracellular signaling domain(s).
Those of ordinary skill in the art would immediately recognize that it is axiomatic that the degree or amount of signaling from the essentially infinite genus of structurally and functionally unrecited and undisclosed intracellular signaling domain(s) of the essentially infinite genus of chimeric antigen receptors comprising the essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains will necessarily affect the ability of the inducible module comprising the:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
to induce expression of IL-18 when the antigen binding domain binds to the target tumor antigen, and thus will necessarily vary the degree or amount of IL-18 expression, resulting in very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect.
Figueroa et al (2015) taught that CARs are designed to comprise intracellular co-stimulatory signaling domains that may promote sequential rounds of T-cell proliferation. T-cell activation and proliferation requires signaling through both the T-cell receptor and co-stimulatory molecules. Once target antigens are recognized, the function and survival of the CAR-T cells depends on the activation of chimeric co-stimulatory receptors (e.g. pg 159).
However, some CAR designs demonstrate low proliferative capacity, leading to apoptosis, consequent anergy, and only transient persistence, resulting in limited efficacy against the target cell (e.g. pg 158). Other factors that contribute to poor efficacy includes the T-cell's functional characteristics (e.g. pg 158, para 2).
Srivastava and Riddell (2015) taught that many challenges remain in improving CAR-T safety and efficacy, as a major challenge is to ensure elimination of target cells, e.g. tumor cells, while sparing healthy tissue and minimizing toxicity (e.g. pg 494, col. 2). The mechanisms underlying TCR sensitivity and concomitant specificity are not fully understood (e.g. pg 498, col. 2). The type and number of intracellular signaling domains strongly influences the T cell's ability to differentiate and acquire full effector functions (e.g. Abstract), and remains an unresolved issue (e.g. Table 2), as another mechanism of signal amplification in TCR recognition that is lacking with CARs involves the interaction of coreceptors. Whether the CAR forms a synapse and clusters in a manner similar to TCRs or interacts with endogenous TCR/CD3 complexes and coreceptors remains unresolved (e.g. pg 499, col. 2).
Moreira et al (Hot spots—A review of the protein–protein interface determinant amino-acid residues, Proteins 68: 803-812, 2007) is considered relevant prior art for having taught Protein–protein interactions are very complex and can be characterized by their size,
shape, and surface complementarity (e.g. pg 803, Protein-Protein). The hydrophobic and electrostatic interactions they establish, as well as the flexibility of the molecules involved, are very significant.
Moreira et al taught that in a protein–protein interface, a small subset of the buried amino acids typically contribute to the majority of binding affinity as determined by the change in the free energy of binding. Although there is no purely geometric reason, these energetic determinants are compact, centralized regions of residues crucial for protein association (e.g. pg 804, col. 2).
Moreira et al taught that most interfaces are optimal tight-fitting regions characterized by complementary pockets scattered through the central region of the interface, and enriched in structurally conserved residues. These pockets are classified as ‘‘complementary’’ because there is a large complementarity both in shape and in the juxtaposition of hydrophobic and hydrophilic hot spots, with buried charged residues forming salt bridges and hydrophobic residues from one surface fitting into small nooks on the opposite face. Usually, the hot spot of one face packs against the hot spot of the other face establishing a region determinant for complex binding (e.g. pg 806, col. 1). Complementarity is basically affected by the size of the buried surface, alignment of polar and nonpolar residues, number of buried waters, and the packing densities of atoms involved in the protein–protein interface. Packing defects at the protein–protein interface result in these gaps or pockets, and it is unclear whether unfilled pockets contain water molecules or how the dynamics of water molecules entering and escaping these pockets may affect binding stability (e.g. pg 807, col. 2). Moreira et al taught that common methodology to determine hot spot locations on the artisan’s protein of interest, alanine-scanning mutagenesis is slow and labor-intensive (e.g. pg 804, col. 1). Similarly, systematic mutagenesis is very laborious and time-consuming to perform, as individual mutant proteins must be purified and analyzed separately (e.g. pg 808, col. 2).
Ng et al (Predicting the Effects of Amino Acid Substitutions on Protein Function, Annual Review Genomics Human Genetics 7: 61-80, 2006) is considered relevant prior art for having taught that non-synonymous nucleotide changes which introduce amino acid changes in the corresponding protein have the largest impact on human health. Most algorithms to predict amino acid substation consequences of protein function indicate about 25% to 30% of amino acid changes negatively affect protein function (Abstract). Existing prediction tools primarily focus on studying the deleterious effects of single amino acid substitutions through examining amino acid conservation at the position of interest among related sequences, an approach that is not directly applicable to multiple amino acid changes, including insertions or deletions. Ng et al taught that 83% of disease-causing mutations affect protein stability (e.g. pg 63, col. 1), which in this case, would affect the ability of:
the degree or amount of signaling from the essentially infinite genus of structurally and functionally unrecited and undisclosed intracellular signaling domain(s) of the essentially infinite genus of chimeric antigen receptors comprising the essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains, and their corresponding binding affinities, will necessarily affect the ability of the inducible module comprising the:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
to induce expression of IL-18 when the antigen binding domain binds to the target tumor antigen, and thus will necessarily vary the degree or amount of IL-18 expression, resulting in very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect.
Prediction of protein structure by homology and/or algorithm is notoriously difficult, as one of ordinary skill in the art would immediately understand.
Consequently, the gap between the number of as-yet to be discovered, essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors, minimal promoters, inducible promoters, and/or inducible enhancers, respectively, encompassed by the claims, is considered to be tremendous, notoriously difficult, slow, very laborious and time-consuming for the ordinary artisans to determine for themselves that which Applicant has failed to disclose.
Disclosure of putative structures having a theorized function in the absence of experimental data demonstrating the theorized function is insufficient to demonstrate possession of a representative number of species by disclosure of relevant, identifying characteristics (i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics), sufficient to show the applicant was in possession of the claimed invention.
Parameter 8
The Examiner notes that the claims do not require the human subject/patient to actually have cancer, nor express the tumor antigen. Rather, the claims recite “associated with a tumor antigen”, which is broader in scope.
The claims are broad for reasonably encompassing an enormous genus of etiologically and pathologically distinct diseases/disorders/conditions. Espe (Malacards: The Human Disease Database, Resource Review, J. Medical Library Association 106(1): 2 pages, doi: dx.doi.org/10.5195/jmla.2018.253, January, 2018) is considered relevant prior art for having taught that there are at least 26,000 recognized genetic diseases afflicting humans (e.g. pg 1, col. 1). Thus, the claims are broad for encompassing an enormously vast genus of about 1x10^8 different viral pathogens (viruses are known in the art to cause cancer), and about 26,000 etiologically and pathologically different genetic diseases.
The claims are broad for reasonably encompassing an enormous genus of etiologically and pathologically distinct diseases, disorders, and/or conditions associated with a tumor antigen, including, but not limited to, a genus of etiologically and pathologically distinct autoimmune diseases (e.g. pg 24, lines 7-16) and a genus of etiologically and pathologically distinct cancers (e.g. pg 24, lines 23-29), including, but not limited to, hematologic cancer leukemias, acute leukemias, chronic leukemias, lymphomas, B-cell lymphoma, T-cell lymphoma, multiple myeloma, a solid tumor cell, a tumor of the breast, lung, prostate, colon, bladder, ovary, kidney, stomach, colon, rectum, testes, head and/or neck, pancreas, brain, skin, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), myelodysplastic syndromes (MDS), Hodgkin lymphoma, nodular sclerosis Hodgkin lymphoma (NSCHL), mixed cellularity Hodgkin lymphoma (MCcHL), lymphocyte-rich Hodgkin's disease (LRCHL), and lymphocyte-depleted Hodgkin's disease (LDHL), diffuse large B-cell lymphoma (DLBCL), primary mediastinal B cell lymphoma (PMBCL), follicular lymphoma (FL), small lymphocytic lymphoma (SLL), marginal zone lymphoma (MZL), mantle cell lymphoma (MCL), Waldenstrom's macroglobulinemia (WMG), Burkitt lymphoma (BL), peripheral T-cell lymphoma (PTCL ), anaplastic large cell lymphoma (ALCL ), angioimmunoblastic T-cell lymphoma (AITL), cutaneous T cell lymphoma, light chain multiple myeloma (LCMM), non-secretory multiple myeloma (NSMM), solitary plasmacytoma (SP), extramedullary plasmacytoma (EMP), monoclonal gammopathy of undetermined significance (MGUS), smoldering Multiple Myeloma (SMM), Immunoglobulin D multiple myeloma (IgD MM), Immunoglobulin E (IgE) multiple myeloma, colon cancer, colorectal cancer, fallopian tube cancer, gastric cancer, genitourinary cancer, head and neck cancer, liver cancer, lung cancer, melanoma, nasopharyngeal carcinoma (NPC), pancreatic cancer, prostate cancer, ovarian cancer, rectal cancer, renal cancer, skin cancer, stomach cancer, testicular cancer, thyroid cancer, urethral cancer breast cancer, squamous non-small cell lung cancer (NSCLC), non-squamous NSCLC, lung adenocarcinoma, mesothelioma, kidney clear cell carcinoma, kidney papillary cell carcinoma, hepatocellular carcinoma (HCC), castration-resistant prostate cancer, squamous cell carcinoma of the head and neck, carcinomas of the esophagus, carcinomas of the gastrointestinal tract, and endometriosis.
Figueroa et al (2015) taught that CAR T cell therapy to treat solid tumors has been much less encouraging that for treatment of hematologic malignancies, for reasons including the relative lack of specific antigenic targets in solid tumors, suboptimal homing of effector cells, as well as the complex, dynamic, and immunosuppressive microenvironments of solid tumors. Clinical experience has been limited and generally disappointing, including no significant clinical responses. (e.g pg 170).
Parameter 9
The claims are broad for reasonably encompassing an enormous genus of physiologically and phenotypically different results, which evokes the question: A therapeutically effective amount to do what?
It is apparent that the amount must be therapeutic. Even so, the various endpoints and extents that define effective treatment are more of a conditional or qualitative nature, especially in the situation when it is not the tumor that is being treated, but the patient. As such, it is not evident what effect is necessarily achieved. Rather, the expected or desired effect that is to be achieved in the practice of the claimed invention to treat the patient is considered highly subjective and would tend to vary substantially.
The recitation implies a genus of unrecited and undisclosed phenotypes by which the therapeutically effective dose is to be determined and/or identified, thereby rendering the claim indefinite. A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)).
The claim(s) also denote(s) that there is an amount of the pharmaceutical composition comprising the engineered immune cell(s) genetically modified to comprise a viral vector encoding:
i) a constitutive promoter operably linked to a nucleic acid encoding a chimeric antigen receptor that binds to the tumor antigen; and
ii) an inducible promoter operably linked to a nucleic acid encoding IL-18,
that, upon administration to the human subject, is not, in fact, “a therapeutically effective amount”.
For example, the specification discloses:
i) achieve a particular biological result or provide a therapeutic or prophylactic benefit (e.g. pg 27, lines 9-10), e.g. relief of symptoms, rather than curing, the disease, condition, or disorder, or minimizing or partially or completely inhibiting development of the disease, condition, or disorder;
ii) decreasing tumor volume, decreasing the number of tumor cells, decreasing the number of metastases, increasing life expectancy, ameliorating various physiological symptoms associated with a cancerous condition (e.g. pg 23, lines 28-32); and
iii) preventing the occurrence of tumor in the first place (e.g. pg 24, line 2).
If there are multiple ways to measure “therapeutically effective dose”, to wit, concentration, time after administration, and/or phenotypic result, yet each yields a different result, then the claim may be indefinite because it is unclear which method is to be performed to determine infringement.
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”).
Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) (“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). “A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed.” In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004)
The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005).
For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014)
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper.
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
In the instant case, knowing that the initial chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO:25 (anti-HER2 CAR with human 4-1BB and human CD3zeta intracellular signaling domains) and the inducible promoter/enhancer module comprises the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:9, does not tell you anything at all about:
a) the broad genus of biologically and functionally distinct immune cells [parameter 1] that are to be genetically modified to express;
b1) an essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising an essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains [parameter 6] that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed tumor antigens [parameter 5], said chimeric antigen receptors also comprising an essentially infinite genus of structurally and functionally undisclosed intracellular signaling domain(s) [parameter 7]; and
b2) the enormously vast genus of inducible modules [parameter 4] comprising:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
resulting in IL-18 expression that will necessarily vary in function, by very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect;
c) the enormously broad genus of immune cell dosages of about 10^1 to 10^20 cells, or more, to be administered [parameter 3] to the human subject/patient via;
d) the enormously broad genus of anatomically distinct administration routes, including, but not limited to, delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic [parameter 2]; so as to necessarily and predictably achieve a real-world, clinically meaningful therapeutic result [parameter 9] for the enormously vast genus of etiologically and pathologically distinct diseases/disorders/conditions associated with expression of a tumor antigen [parameter 8].
In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”.
“The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.”
“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
In the instant case, the record reflects that Applicant seeks to claim for themselves:
a) the broad genus of biologically and functionally distinct immune cells [parameter 1] that are to be genetically modified to express;
b1) an essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising an essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains [parameter 6] that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed tumor antigens [parameter 5], said chimeric antigen receptors also comprising an essentially infinite genus of structurally and functionally undisclosed intracellular signaling domain(s) [parameter 7]; and
b2) the enormously vast genus of inducible modules [parameter 4] comprising:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
resulting in IL-18 expression that will necessarily vary in function, by very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect;
c) the enormously broad genus of immune cell dosages of about 10^1 to 10^20 cells, or more, to be administered [parameter 3] to the human subject/patient via;
d) the enormously broad genus of anatomically distinct administration routes, including, but not limited to, delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic [parameter 2]; so as to necessarily and predictably achieve a real-world, clinically meaningful therapeutic result [parameter 9] for the enormously vast genus of etiologically and pathologically distinct diseases/disorders/conditions associated with expression of a tumor antigen [parameter 8].
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
Those of ordinary skill in the art would immediately recognize that Applicant simply does not possess:
a) the broad genus of biologically and functionally distinct immune cells [parameter 1] that are to be genetically modified to express;
b1) an essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising an essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains [parameter 6] that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed tumor antigens [parameter 5], said chimeric antigen receptors also comprising an essentially infinite genus of structurally and functionally undisclosed intracellular signaling domain(s) [parameter 7]; and
b2) the enormously vast genus of inducible modules [parameter 4] comprising:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
resulting in IL-18 expression that will necessarily vary in function, by very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect;
c) the enormously broad genus of immune cell dosages of about 10^1 to 10^20 cells, or more, to be administered [parameter 3] to the human subject/patient via;
d) the enormously broad genus of anatomically distinct administration routes, including, but not limited to, delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic [parameter 2]; so as to necessarily and predictably achieve a real-world, clinically meaningful therapeutic result [parameter 9] for the enormously vast genus of etiologically and pathologically distinct diseases/disorders/conditions associated with expression of a tumor antigen [parameter 8].
Applicant is essentially requiring the ordinary artisans to discover for themselves that which Applicant fails to disclose.
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claims.
5. Claims 51, 103, and 142 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The Examiner incorporates herein the above 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections.
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper.
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
In the instant case, knowing that the initial chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO:25 (anti-HER2 CAR with human 4-1BB and human CD3zeta intracellular signaling domains) and the inducible promoter/enhancer module comprises the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:9, does not tell you anything at all about:
a) the broad genus of biologically and functionally distinct immune cells [parameter 1] that are to be genetically modified to express;
b1) an essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising an essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains [parameter 6] that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed tumor antigens [parameter 5], said chimeric antigen receptors also comprising an essentially infinite genus of structurally and functionally undisclosed intracellular signaling domain(s) [parameter 7]; and
b2) the enormously vast genus of inducible modules [parameter 4] comprising:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
resulting in IL-18 expression that will necessarily vary in function, by very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect;
c) the enormously broad genus of immune cell dosages of about 10^1 to 10^20 cells, or more, to be administered [parameter 3] to the human subject/patient via;
d) the enormously broad genus of anatomically distinct administration routes, including, but not limited to, delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic [parameter 2]; so as to necessarily and predictably achieve a real-world, clinically meaningful therapeutic result [parameter 9] for the enormously vast genus of etiologically and pathologically distinct diseases/disorders/conditions associated with expression of a tumor antigen [parameter 8].
In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”.
“The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.”
“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
In the instant case, the record reflects that Applicant seeks to claim for themselves:
a) the broad genus of biologically and functionally distinct immune cells [parameter 1] that are to be genetically modified to express;
b1) an essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising an essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains [parameter 6] that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed tumor antigens [parameter 5], said chimeric antigen receptors also comprising an essentially infinite genus of structurally and functionally undisclosed intracellular signaling domain(s) [parameter 7]; and
b2) the enormously vast genus of inducible modules [parameter 4] comprising:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
resulting in IL-18 expression that will necessarily vary in function, by very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect;
c) the enormously broad genus of immune cell dosages of about 10^1 to 10^20 cells, or more, to be administered [parameter 3] to the human subject/patient via;
d) the enormously broad genus of anatomically distinct administration routes, including, but not limited to, delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic [parameter 2]; so as to necessarily and predictably achieve a real-world, clinically meaningful therapeutic result [parameter 9] for the enormously vast genus of etiologically and pathologically distinct diseases/disorders/conditions associated with expression of a tumor antigen [parameter 8].
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
Applicant is essentially requiring the ordinary artisans to discover for themselves that which Applicant fails to disclose.
The Quantity of Any Necessary Experimentation to Make or Use the Invention
It is generally recognized in the art that biological compounds often react unpredictably under different circumstances (Nationwide Chem. Corp. v. Wright, 458 F. supp. 828, 839, 192 USPQ95, 105(M.D. Fla. 1976); Affd 584 F.2d 714, 200 USPQ257 (5th Cir. 1978); In re Fischer, 427 F.2d 833, 839, 166 USPQ 10, 24(CCPA 1970)). The relative skill of the artisan and the unpredictability of the pharmaceutical art are very high. Where the physiological activity of a chemical or biological compound is considered to be an unpredictable art (Note that in cases involving physiological activity such as the instant case, "the scope of enablement obviously varies inversely with the degree of unpredictability of the factors involved" (See In re Fischer, 427 F.2d 833, 839, 166 USPQ 10, 24(CCPA 1970))), the skilled artisan would have not known how to formulate and/or administer a therapeutically effective amount of the essentially infinite genus of structurally and functionally undisclosed pharmaceutical compositions encompassed by the claims so as to necessarily and predictably achieve a real-world, clinically-meaningful, therapeutic result for the enormously vast genus of etiologically and pathologically distinct diseases/disorders/conditions associated with expression of a tumor antigen.
The courts have stated that reasonable correlation must exist between scope of exclusive right to patent application and scope of enablement set forth in patent application. 27 USPQ2d 1662 Exparte Maizel. In the instant case, in view of the lack of guidance, working examples, breadth of the claims, the level of skill in the art and state of the art at the time of the claimed invention was made, it would have required undue experimentation to make and/or use the invention as claimed.
As In re Gardner, Roe and Willey, 427 F.2d 786,789 (C.C.P.A. 1970), the skilled artisan might eventually find out how to use the invention after “a great deal of work”. In the case of In re Gardner, Roe and Willey, the invention was a compound which the inventor claimed to have antidepressant activity, but was not enabled because the inventor failed to disclose how to use the invention based on insufficient disclosure of effective drug dosage. The court held that “the law requires that the disclosure in the application shall inform them how to use, not how to find out how to use for themselves”.
At best, the specification discloses administering about 1x10^6 CAR T cells to a mouse subject (e.g. pg 95, Example 15).
Applicant is essentially requiring the ordinary artisans to discover for themselves that which Applicant fails to disclose.
Reliance on animal models is not predictive of clinical outcome. This has been complicated by the inability to extrapolate delivery methods in animals with those in humans or higher animals.
Mingozzi and High (Immune responses to AAV vectors: overcoming barriers to successful gene therapy, Blood 122(1): 23-36, 2013) demonstrate that the human findings are not recapitulated from the animal studies (page 26, col 2, “it seemed logical that one could model the human immune response in these animals, but multiple attempts to do so have also failed”). Hence, lessons learned from small animals such as the mice studies could not recapitulate the ability to deliver adequately in humans.
Ferdowsian et al (Primates in Medical Research: A Matter of Convenience, not Sound Science, The Hastings Center, www.thehastingscenter.org/primates-in-medical-research-convenience-not-sound-science/; July 8, 2022) is considered relevant art for having taught that, “Today, unlike in the 17th century, scientists easily recognize the truth in the saying “mice lie and monkeys exaggerate,” which points to a well-known problem in biomedical research: using nonhuman primates and other animals in research fails more often than it succeeds.”
Perrin (Make Mouse Studies Work, Nature (507): 423-425, 2014) taught that the series of clinical trials for a potential therapy can cost hundreds of millions of dollars. The human costs are even greater (pg 423, col. 1). For example, while 12 clinical trials were tested for the treatment of ALS, all but one failed in the clinic (pg 423, col. 2). Experiments necessary in preclinical animal models to characterize new drugs or therapeutic compounds are expensive, time-consuming, and will not, in themselves, lead to new treatments. But without this upfront investment, financial resources for clinical trials are being wasted and [human] lives are being lost (pg 424, col. 1). Animal models are highly variable, and require a large number of animals per test group. Before assessing a drug’s efficacy, researchers should investigate what dose animals can tolerate, whether the drug reaches the relevant tissue at the required dose and how quickly the drug is metabolized or degraded by the body. We estimate that it takes about $30,000 and 6–9 months to characterize the toxicity of a molecule and assess whether enough reaches the relevant tissue and has a sufficient half-life at the target to be potentially effective. If those results are promising, then experiments to test whether a drug can extend an animal’s survival are warranted — this will cost about $100,000 per dose and take around 12 months. At least three doses of the molecule should be tested; this will help to establish that any drug responses are real and suggest what a reasonable dosing level might be. Thus, even assuming the model has been adequately characterized, an investment of $330,000 is necessary just to determine whether a single drug has reasonable potential to treat disease in humans. It could take thousands of patients, several years and hundreds of millions of dollars to move a drug through the clinical development process. The investment required in time and funds is far beyond what any one lab should be expected to do. (pg 425, col.s 2-3). The human costs are even greater: patients with progressive terminal illnesses may have just one shot at an unproven but promising treatment. Clinical trials typically require patients to commit to year or more of treatment, during which they are precluded from pursuing other experimental options (pg 423, col.2 1-3).
Greenberg (Gene Therapy for heart failure, Trends in Cardiovascular Medicine 27: 216-222, 2017) is considered relevant prior art for taught that despite success in experimental animal models, translating gene transfer strategies from the laboratory to the clinic remains at an early stage (Abstract). The success of gene therapy depends on a variety of factors that will ultimately determine the level of transgene expression within the targeted cells. These factors include the vector used for delivery, the method and conditions of delivery of the vector to the [target tissue], the dose that is given and interactions between the host and the vector that alter the efficiency of transfection of [target] cells (e.g. pg 217, col. 1). Failure of therapeutic results may arise because the vector DNA levels were at the lower end of the threshold for dose-response curves in pharmacology studies, and/or only a small proportion of target cells were expressing the therapeutic transgene (e.g. pg 220, col. 1). Although the use of AAVs for gene therapy is appealing, additional information about the best strain of AAVs to use in human patients is needed. Experience indicates that there is a need to carefully consider the dose of the gene therapy vector; however, this has proved to be difficult in early phase developmental studies due to the complexity and cost of such studies (e.g. pg 221, col. 1).
Maguire et al (Viral vectors for gene delivery to the inner ear, Hearing Research 394: e107927, 13 pages, doi.org/10.1016/j.heares.2020.107927, 2020) is considered relevant post-filing art for taught that despite the progress with AAV vectors in the inner ear, little is known regarding the mechanism of transduction of specific cells by AAV within the cochlea (e.g. pg 2, col. 2). There are limitations to what experiments in mice can tell us about the true translation potential of a new therapeutic (e.g. pg 8, col. 2), e.g. species-related physiological differences between mice and humans (e.g. pg 9, col. 1). The AAV dosage is a significant factor in achieving transduction of the target cell, as insufficient dosage may achieve no transduction of the target cells (e.g. pg 9, col. 2).
Tobias (Mouse Study Used in Research, Multiple Sclerosis News Today, multiplesclerosisnewstoday.com/news-posts/2023/09/08/lets-not-get-overexcited-about-any-mice-study-used-research/; September 8, 2023) is considered relevant art for having taught that, “Mice exaggerate and monkeys lie, some researchers jokingly say. (Or is it the other way around?)” The odds of an experimental treatment making it from mouse or monkey to human are very low. Less than 8% of cancer treatments make it from animal studies into a clinical setting, where they’re tested on people, and only 10% of the medications in those clinical trials make it through to government approval. No wonder some researchers joke about mice and monkeys lying and exaggerating.
Applicant is essentially requiring the ordinary artisans to discover for themselves that which Applicant fails to disclose.
Accordingly, this limited information is not deemed sufficient to reasonably convey to one skilled in the art that the applicant is in possession of, nor enabling for:
a) the broad genus of biologically and functionally distinct immune cells [parameter 1] that are to be genetically modified to express;
b1) an essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising an essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains [parameter 6] that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed tumor antigens [parameter 5], said chimeric antigen receptors also comprising an essentially infinite genus of structurally and functionally undisclosed intracellular signaling domain(s) [parameter 7]; and
b2) the enormously vast genus of inducible modules [parameter 4] comprising:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
resulting in IL-18 expression that will necessarily vary in function, by very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect;
c) the enormously broad genus of immune cell dosages of about 10^1 to 10^20 cells, or more, to be administered [parameter 3] to the human subject/patient via;
d) the enormously broad genus of anatomically distinct administration routes, including, but not limited to, delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic [parameter 2]; so as to necessarily and predictably achieve a real-world, clinically meaningful therapeutic result [parameter 9] for the enormously vast genus of etiologically and pathologically distinct diseases/disorders/conditions associated with expression of a tumor antigen [parameter 8].
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claims.
6. Claims 1, 16, 34, 41, 45, 56, 71, 95, 102, 129-130, 135, 138-141, 143-147 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The Examiner incorporates herein the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections.
Claims 1, 41, 45, and 56 are directed to a pharmaceutical composition comprising:
a) a broad genus of biologically and functionally distinct immune cells [parameter 1] that are to be genetically modified with a broad genus of viral vectors to express;
b1) an essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising an essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains [parameter 6] that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed tumor antigens [parameter 5], said chimeric antigen receptors also comprising an essentially infinite genus of structurally and functionally undisclosed intracellular signaling domain(s) [parameter 7]; and
b2) the enormously vast genus of inducible modules [parameter 4] comprising:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
resulting in IL-18 expression.
Ramos et al (In Vivo Fate and Activity of Second- versus Third-Generation CD19-Specific CAR-T Cells in B Cell Non-Hodgkin’s Lymphomas, Molecular Therapy 26(12): 2727-2737, doi: 10.1016/j.ymthe.2018.09.009; available online December 5, 2018) is considered relevant post-filing art for having taught a novel chimeric antigen receptor not disclosed by Applicant.
Zhang et al (Recombination of a dual-CAR-modified T lymphocyte to accurately eliminate pancreatic malignancy, J. Hematol. Oncol. 11: Article 102, doi.org/10.1186/s13045-018-0646-9, available online August 13, 2018) is considered relevant post-filing art for having taught a novel chimeric antigen receptor not disclosed by Applicant.
Those of ordinary skill in the art would immediately recognize that Applicant is simply not in possession of the essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising the essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains, and their corresponding binding affinities, that will necessarily affect the ability of the inducible module comprising the:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
to induce expression of IL-18 when the antigen binding domain binds to the target tumor antigen.
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper.
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
In the instant case, knowing that the initial chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO:25 (anti-HER2 CAR with human 4-1BB and human CD3zeta intracellular signaling domains) and the inducible promoter/enhancer module comprises the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:9, does not tell you anything at all about:
a) the broad genus of biologically and functionally distinct immune cells [parameter 1] that are to be genetically modified to express;
b1) an essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising an essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains [parameter 6] that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed tumor antigens [parameter 5], said chimeric antigen receptors also comprising an essentially infinite genus of structurally and functionally undisclosed intracellular signaling domain(s) [parameter 7]; and
b2) the enormously vast genus of inducible modules [parameter 4] comprising:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
resulting in IL-18 expression.
In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”.
“The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.”
“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
In the instant case, the record reflects that Applicant seeks to claim for themselves:
a) the broad genus of biologically and functionally distinct immune cells [parameter 1] that are to be genetically modified to express;
b1) an essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising an essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains [parameter 6] that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed tumor antigens [parameter 5], said chimeric antigen receptors also comprising an essentially infinite genus of structurally and functionally undisclosed intracellular signaling domain(s) [parameter 7]; and
b2) the enormously vast genus of inducible modules [parameter 4] comprising:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
resulting in IL-18 expression.
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
Those of ordinary skill in the art would immediately recognize that Applicant simply does not possess:
a) the broad genus of biologically and functionally distinct immune cells [parameter 1] that are to be genetically modified to express;
b1) an essentially infinite genus of structurally and functionally undisclosed chimeric antigen receptors comprising an essentially infinite genus of structurally and functionally undisclosed tumor antigen binding domains [parameter 6] that are to have the functional properties of binding the about 1x10^65, 1x10^52, 1x10^39, 1x10^26, and/or 1x10^13 structurally undisclosed tumor antigens [parameter 5], said chimeric antigen receptors also comprising an essentially infinite genus of structurally and functionally undisclosed intracellular signaling domain(s) [parameter 7]; and
b2) the enormously vast genus of inducible modules [parameter 4] comprising:
i) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed minimal promoters operably linked to;
ii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible promoters operably linked to;
iii) the enormously vast genus of about 4x10^180, 2x10^120, 1x10^60, 1x10^45, and/or 1x10^30 structurally unrecited and functionally undisclosed inducible enhancers,
resulting in IL-18 expression that will necessarily vary in function, by very little amounts/concentration, to minor amounts/concentration, to small amounts/concentration, to moderate amounts/concentration, etc…, each resulting in a biologically different ability to modulate the function and/or activity of the human subject’s physiology, including endogenous and heterologous immune cells, which, in turn, results in a biologically different therapeutic effect.
Applicant is essentially requiring the ordinary artisans to discover for themselves that which Applicant fails to disclose.
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claims.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
As discussed above, Applicant has amended independent Claim 1 to broaden the scope of the invention, and thus the previous rejections under AIA 35 U.S.C. 103 are now re-applied.
7. Claims 1, 16, 34, 41, 45, 129, 135, 138-140, 143, and 145-146 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Wang et al (U.S. 2018/0057822; filed August 31, 2017; priority to 62/533,858 filed July 18, 2017; of record) in view of Chmielewski-1 (2015; of record), Chmielewski-2 (2017; of record), June et al (WO 16/126608; published August 11, 2016; Applicant’s own work not cited in an IDS), and June et al (WO12/079000; Applicant’s own work not cited in an IDS).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 1, Wang et al is considered relevant prior art for having disclosed a viral vector, e.g. lentiviral vector, encoding the CAR transgene and a payload transgene to be delivered when the CAR is activated [0012], whereby the CAR transgene is operably linked to a constitutive promoter [0136], whereby the payload transgene is operably linked to an inducible promoter [0012].
Wang et al disclosed the use of a Pmin (SEQ ID NO:31; lower line) comprising a nucleotide sequence that is 100% identical to instant SEQ ID N:6 (upper line), as shown below:
tagagggtatataatggaagctcgacttccag
tagagggtatataatggaagctcgacttccag
Wang et al disclosed the payload transgene may be a cytokine, e.g. IL-12 or IL-18 [0187].
Wang et al disclosed a working example wherein the transgene expression cassette encodes an NFAT promoter to drive expression of the payload transgene IL-12, whereby expression of the IL-12 is induced upon CAR stimulation (e.g. Example 18, [0290]).
The specification need not contain an example if the invention is otherwise disclosed in such manner that one skilled in the art will be able to practice it without an undue amount of experimentation. In re Borkowski, 422 F.2d 904, 908, 164 USPQ 642, 645 (CCPA 1970).
A reference contains an "enabling disclosure" if the public was in possession of the claimed invention before the date of invention. "Such possession is effected if one of ordinary skill in the art could have combined the publication's description of the invention with his [or her] own knowledge to make the claimed invention." In re Donohue, 766 F.2d 531, 226 USPQ 619 (Fed. Cir. 1985).
Thus, no undue experimentation is required to make a transgene expression cassette encoding an NFAT promoter to drive expression of IL-18, whereby expression of the IL-18 is induced upon CAR stimulation.
Similarly, Chmielewski-1 is considered relevant prior art for having taught T cells genetically modified to express a chimeric antigen receptor, wherein said CAR T cells are further modified to express IL-12 operably linked to an inducible promoter, to wit, an NFAT promoter, thereby achieving CAR-inducible expression of the IL-12 cytokine (pg 1147, col. 2; Figure 1, legend, “TRUCK T cells are the fourth generation CAR T cells which are additionally modified with a constitutive or inducible expression cassette for a transgenic protein, for instance a cytokine, which is released by the CAR T cell to modulate the T-cell response”).
Chmielewski-1 taught that the TRUCK CAR T cells may also be armed with additional cytokines, such as IL-18, e.g. so as to sustain IL-12-mediated functions (pg 1151, col. 2). Chmielewski-1 taught that IL-18 promotes Th1 and Th2 responses, and synergizes with IL-12, thereby enhancing innate immune cell activity. “These properties make CAR T cells with inducible IL-18, with or without additional IL-12, a good candidate for an anti-tumor attack.” (pg 1150, col. 2).
Similarly, Chmielewski-2 is considered relevant prior art for having taught a CAR T cell that expresses a heterologous IL-18 transgene, wherein the IL-18 transgene is operably linked to an inducible promoter, to wit, a NFAT promoter (e.g. graphical abstract), e.g. an IL-2 minimal promoter combined with at least 6 NFAT binding sites (Figure 2b).
Chmielewski-2 taught that CAR T cells engineered with inducible IL-18 release exhibited superior activity against tumors that were refractory to CAR T cells without cytokines (Abstract), that inducible IL-18 CAR T cells, with or without additional inducible IL-12, produced a superior anti-tumor effect and prolonged survival of immune-competent mice with an initially high tumor burden (e.g. pg 3209, col. 2), and that production of IL-18 in the tumor tissue by CAR T cells improved the overall survival of mice with a large tumor burden, whereas IL-12 had some, but a far lower, effect at this stage of the disease (e.g. pg 3213, col. 1).
With respect to Claim 1, Wang et al disclosed wherein the first and second transgene expression cassettes are transcribed in opposite directions (Example 18, [0288]).
Applicant themselves (June et al) is considered relevant prior art for having disclosed a nucleic acid molecule encoding a first transgene encoding a chimeric antigen receptor operably linked to a constitutive promoter and a second transgene encoding an effector, e.g. a second chimeric antigen receptor or a cytokine, operably linked to the inducible promoter (e.g. Abstract; pgs 1-2, joining para; pg 2, lines 7-17), wherein said nucleic acid molecule is within a viral vector (e.g. pg 9, lines 23-26).
June et al disclosed the transgene operably linked to the inducible promoter may be a chimeric antigen receptor or a cytokine (e.g. Abstract; pgs 1-2, joining para), wherein the transgene expression cassette encodes an NFAT promoter to drive expression of IL-12 upon the recognition of tumor-specific antigen binding (e.g. pg 60, lines 4-6).
June et al disclosed that patients receiving the CAR-expressing cells may also be administered a cytokine, e.g. IL-18 (e.g. pg 247, lines 1-2).
June et al disclosed wherein the CAR transgene is transcribed in the same or different direction as the effector transgene (e.g. pg 240, lines 7-9).
Furthermore, the ordinary artisan would have immediately recognized that it is natural law of physics and biology there are only two possible orientations of the first and second promoters relative to each other. The promoters either drive transcription in the same direction or in different directions, both of which (syn. finite number) were previously identified to be predictable solutions.
It would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.”
Wang et al disclosed wherein the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain,
wherein the intracellular signaling domain comprises a costimulatory domain, e.g. a CD28 intracellular domain, and an ITAM-containing signaling domain comprising a CD3zeta signaling domain (e.g. Figure 1).
Chmielewski-1 taught wherein the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain,
wherein the intracellular signaling domain comprises a costimulatory domain, e.g. a CD28 intracellular domain, and an ITAM-containing signaling domain comprising a CD3zeta signaling domain (e.g. Figure 1).
Chmielewski-2 taught wherein the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain,
wherein the intracellular signaling domain comprises a costimulatory domain, e.g. a CD28 intracellular domain, and an ITAM-containing signaling domain comprising a CD3zeta signaling domain (e.g. Figure 1c; pg 3215, col. 2, Methods, Expression Constructs).
June et al disclosed wherein the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain,
wherein the intracellular signaling domain comprises a costimulatory domain, e.g. a CD27 intracellular domain, and an ITAM-containing signaling domain comprising a CD3zeta signaling domain (e.g. Figure 33A).
Instant NFAT promoter SEQ ID NO:5 comprises 6 NFAT binding sites (aggaaaaac).
Chmielewski-2 taught combining an NFAT promoter comprising 6 NFAT binding sites to a minimal promoter (Figure 2b).
Applicant themselves (June et al) disclosed the NFAT promoter comprises as many as 6 NFAT binding sites (e.g. pg 59, lines 15-16) combined with a minimal IL-2 promoter (e.g. pgs 59-60, joining para; pg 62, lines 1-2; pg 287, lines 26-27).
Those of ordinary skill in the art would have recognized that combining an NFAT promoter comprising 6 NFAT binding sites, and being 99% identical to (1 mismatch) instant SEQ ID NO:5, per Wang et al, with a minimal promoter, per Wang et al, would yield an inducible transcription module substantially similar to the minimal promoter combined with as many as 6 NFAT binding sites (Chmielewski-2; June et al), as the ordinary artisan would have recognized that such modifications of the minimal promoter would confer the NFAT-inducible regulation, as successfully reduced to practice by Applicant themselves (June et al) and Chmielewski-2.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology, immunotherapy, and the design and use of viral expression vectors to deliver chimeric antigen receptors to primary human immune cells. Therefore, the level of ordinary skill in this art is high.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute an IL-12 transgene operably linked to an inducible NFAT promoter in the vector of Wang et al with an IL-18 transgene operably linked to an inducible NFAT promoter, as taught/disclosed by Chmielewski-1, Chmielewski-2 and/or June et al, in a viral expression vector encoding a constitutive promoter operably linked to a chimeric antigen receptor with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention.
M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute an IL-12 transgene operably linked to an inducible NFAT promoter with an IL-18 transgene operably linked to an inducible NFAT promoter in a viral expression vector encoding a constitutive promoter operably linked to a chimeric antigen receptor because:
i) Wang et al disclosed the payload transgene may be a cytokine, e.g. IL-12 or IL-18 [0187];
ii) Applicant themselves (June et al) disclosed the payload transgene may be cytokine, e.g. IL-12 or IL-18 (e.g. pg 77, lines 11-12; pg 78, lines 14-15);
iii) Chmielewski-1 taught that the TRUCK CAR T cells may also be armed with additional cytokines, such as IL-18, e.g. so as to sustain IL-12-mediated functions (pg 1151, col. 2), as IL-18 promotes Th1 and Th2 responses, and synergizes with IL-12, thereby enhancing innate immune cell activity, stating, “[T]hese properties make CAR T cells with inducible IL-18, with or without additional IL-12, a good candidate for an anti-tumor attack.” (pg 1150, col. 2); and
iv) Chmielewski -2 successfully demonstrated a CAR T cell that expresses a heterologous IL-18 transgene, wherein the IL-18 transgene is operably linked to an inducible promoter, to wit, a NFAT promoter (e.g. graphical abstract), whereby said CAR T cells engineered with inducible IL-18 release exhibited superior activity against tumors that were refractory to CAR T cells without cytokines (Abstract), that inducible IL-18 CAR T cells, with or without additional inducible IL-12, produced a superior anti-tumor effect and prolonged survival of immune-competent mice with an initially high tumor burden (e.g. pg 3209, col. 2), and that production of IL-18 in the tumor tissue by CAR T cells improved the overall survival of mice with a large tumor burden, whereas IL-12 had some, but a far lower, effect at this stage of the disease (e.g. pg 3213, col. 1).
Chmielewski-1 taught that an advantage of the inducible production over constitutive cytokine delivery is that the cytokine product is produced and released as long as the modified T cells engage target and stay activated (e.g. pgs 1147-1148, joining para).
Prior to the effective filing date of the instantly claimed invention, it also would have been obvious to one of ordinary skill in the art to combine a first transgene expression cassette encoding a chimeric antigen receptor operably linked to a constitutive promoter and a second transgene expression cassette encoding a cytokine operably linked to an inducible promoter into a single viral vector with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention. Those of ordinary skill in the art had previously recognized the scientific and technical concepts of:
i) a transgene expression cassette encoding a chimeric antigen receptor operably linked to a constitutive promoter may be expressed from a viral vector, as successfully demonstrated by Wang et al;
ii) a transgene expression cassette encoding a cytokine operably linked to an inducible promoter, e.g. IL-12 or IL-18, transgene operably linked to an NFAT promoter, may be expressed from a viral vector, improves T cell activation, as the cytokine is produced and released as long as the CAR T cells engage their cognate antigen and stay activated, as successfully demonstrated by Chmielewski- and Chmielewski-2; and
iii) combining a first transgene expression cassette encoding a chimeric antigen receptor operably linked to a constitutive promoter and a second transgene expression cassette encoding IL-12 operably linked to an inducible promoter, to wit, the NFAT promoter, into an engineered T cell was a known and successfully reduced to practice viral expression vector design, as successfully demonstrated by Wang et al.
The motivation to combine can arise from the expectation that the prior art elements will perform their expected functions to achieve their expected results when combined for their common known purpose. MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it also would have been obvious to one of ordinary skill in the art to combine an NFAT promoter with a minimal promoter to form an inducible transcription module with a reasonable expectation of success because all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded predictable results to one of ordinary skill in the art at the time of the invention.
The motivation to combine can arise from the expectation that the prior art elements will perform their expected functions to achieve their expected results when combined for their common known purpose. MPEP §2144.
Instant NFAT promoter SEQ ID NO:5 comprises 6 NFAT binding sites (aggaaaaac).
Chmielewski-2 taught combining an NFAT promoter comprising 6 NFAT binding sites to a minimal promoter (Figure 2b).
Applicant themselves (June et al) disclosed the NFAT promoter comprises as many as 6 NFAT binding sites (e.g. pg 59, lines 15-16) combined with a minimal IL-2 promoter (e.g. pgs 59-60, joining para; pg 62, lines 1-2; pg 287, lines 26-27).
Those of ordinary skill in the art would have recognized that combining an NFAT promoter comprising 6 NFAT binding sites, and being 99% identical to (1 mismatch) instant SEQ ID NO:5, per Wang et al, with a minimal promoter, per Wang et al, would yield an inducible transcription module substantially similar to the minimal promoter combined with as many as 6 NFAT binding sites (Chmielewski-2; June et al), as the ordinary artisan would have recognized that such modifications of the minimal promoter would confer the NFAT-inducible regulation, as successfully reduced to practice by Applicant themselves (June et al), and Chmielewski-2.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
The specification discloses the “spacer” may simply be nucleotides used for cloning purposes (e.g. pg 68, line 25).
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Those of ordinary skill in the art have long-recognized that restriction cloning sites, e.g. “spacer” are routinely used to clone the artisan’s nucleic acid molecules of interest. The specification fails to disclose an element of criticality for a spacer recited at a high level of generality as it pertains to the functionality of the inducible module driving expression of the IL-18 cytokine transgene.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 16 and 146, Wang et al disclosed a chimeric antigen receptor transgene operably linked to a constitutive promoter, e.g. the EF-1alpha promoter (e.g. Figure 1; [0136]).
June et al disclosed wherein the constitutive promoter is an EF-1alpha promoter (e.g. pg 2, lines 15-17; Table 1).
With respect to Claim 16, Wang et al disclosed wherein the transgene expression cassette encodes an NFAT promoter to drive expression of IL-12, whereby expression of the IL-12 is induced upon CAR stimulation (e.g. Example 18, [0290]).
Chmielewski-1 taught wherein the inducible promoter comprises NFAT-responsive elements (e.g. pg 1147, col. 2).
Chmielewski-2 taught wherein the inducible promoter comprises NFAT-responsive elements (e.g. graphical abstract).
June et al disclosed wherein the transgene expression cassette encodes an NFAT promoter to drive expression of IL-12 upon the recognition of tumor-specific antigen binding (e.g. pg 60, lines 4-6).
With respect to Claims 34 and 145, Wang et al disclosed an expression vector, e.g. a viral expression vector, e.g. lentiviral or retroviral vectors (e.g. [0012, 155]).
Chmielewski-1 taught wherein most common production processes of such CAR T cells are taking advantage of retroviral or lentiviral vectors for genetic modification of T cells (e.g. pg 1146, col. 1).
Chmielewski-2 taught wherein the NFAT-IL-18 expression cassette was introduced into the CAR T cells via retroviral vectors (e.g. pg 3215, col. 2, Methods, Retroviral Modifications).
June et al disclosed wherein retroviral or lentiviral vectors are used to transduce the CAR-expression transgene into the host cell (e.g. pg 9, lines 23-26; pg 69, lines 23-24).
With respect to Claims 41 and 139-140, Wang et al disclosed wherein the engineered CAR-expressing cell is a human T cell (e.g. Example 12, [0267], “primary human T lymphocytes”; Example 18, [0289]).
Chmielewski-1 taught wherein the engineered CAR-expressing cell is a human T cell (e.g. pg 1146, col. 1, “patient’s T cells were isolated”; pg 1150, col. 2, “CAR T cells with inducible IL-18”).
Chmielewski-2 taught wherein the engineered CAR-expressing cell is a human T cell (entire paper).
June et al disclosed wherein the engineered immune cell is a human T cell (e.g. pg 11, lines 17-22).
With respect to Claims 41 and 45, Wang et al disclosed a method of generating a cell comprising the CAR transgene and the cytokine transgene (e.g. Example 18), whereby said cells are used to treat diseases or disorders such as cancer [0125].
Chmielewski-1 taught a method of generating a cell comprising the CAR transgene and the NFAT-inducible IL-12 transgene.
Chmielewski-1 also taught wherein the engineered CAR-expressing cell is a T cell (e.g. pg 1150, col. 2, “CAR T cells with inducible IL-18”).
Chmielewski-2 taught a method of generating a cell comprising the CAR transgene and the NFAT-inducible IL-18 transgene.
June et al disclosed a method of making an engineered immune cell, i.e. a T cell, comprising the vector of claim 1. Those of ordinary skill in the art immediately recognize that such engineered CAR T cells are used for immunotherapy methods to treat diseases such as cancer (e.g. pg 11, lines 9-16).
With respect to Claim 129, Wang et al disclosed wherein the antigen-binding domain of the CAR binds to CD19 (Example 18) or CD20 (e.g. Figure 1).
Chmielewski-1 taught wherein the antigen-binding domain of the CAR binds to CD19 (e.g. pg 1150, col. 2).
With respect to Claim 135, Applicant (June et al) previously disclosed an EF-1alpha promoter that is 1184 nucleotides in length and 99.7% identical to instant SEQ ID NO:7 (2 disparate mismatches), as shown below:
TTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACTGAGTACCGGGCGCCGTCCAGGCACC
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
TTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACC
TCGATTAGTTCTCGTGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATG
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
TCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATG
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
The specification fails to disclose an element of criticality for the two, disparate, nucleotide mismatches, and those of ordinary skill in the art would immediately recognize that such might simply reflect a nucleotide sequencing error or typographical data entry error.
With respect to Claims 138 and 143, Wang et al disclosed wherein the chimeric antigen receptor comprises:
i) an extracellular human CD8alpha hinge domain;
ii) a human CD8alpha transmembrane domain;
iii) a human 4-1BB or human CD28 intracellular costimulatory domain; and
iv) a human CD3zeta intracellular signaling domain (e.g. Figure 1).
While Wang et al do not disclose ipsis verbis that the domains are “human”, Wang et al disclosed the Smart-CARs are administered to human subjects (e.g. Example 2), and thus the ordinary artisan would have reasonably understood or inferred said domains to be “human”.
Wang et al refer to art-recognized CAR elements (e.g. Example 4, WO12/079000 (Applicant’s own work not cited in an IDS), whereby Applicant previously disclosed the CAR comprises:
i) an extracellular human CD8alpha hinge domain;
ii) a human CD8alpha transmembrane domain;
iii) a human 4-1BB or human CD28 intracellular costimulatory domain; and
iv) a human CD3zeta intracellular signaling domain (e.g. pg 6, lines 2-3; Figure 1).
Chmielewski-2 taught the CAR comprises:
ii) a human CD8alpha transmembrane domain;
iii) human CD28 intracellular costimulatory domain; and
iv) a human CD3zeta intracellular signaling domain (e.g. pg 3215, col. 2, Expression Constructs).
June et al (2016) disclosed the CAR comprises:
i) an extracellular human CD8alpha hinge domain;
ii) a human CD8alpha transmembrane domain;
iii) a human 4-1BB or human CD28 intracellular costimulatory domain; and
iv) a human CD3zeta intracellular signaling domain (e.g. pg 19, lines 3-4, “fully human CAR”; pg 34, lines 5-6; pg 153, lines 5-7; Figure 33A).
M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).”
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Conclusion
8. Claims 1, 16, 34, 41, 45, 51, 56, 71, 95, 102-103, 129-130, 135, and 138-147 are rejected.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
KEVIN K. HILL
Examiner
Art Unit 1638
/KEVIN K HILL/Primary Examiner, Art Unit 1638
Prosecution Insights