Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Detailed Action
This action is in response to the papers filed July 24, 2025.
Amendments
Applicant's response and amendments, filed July 24, 2025, to the prior Office Action is acknowledged. Applicant has cancelled Claims 1-30, 36-40, and 42, amended Claims 31, 41, 43-44, 49, and 52-56.
Claims 31-35, 41, and 43-57 are pending.
Election/Restrictions
Applicant has elected without traverse the invention of Group II, claims 17-26, directed to a composition for gene delivery recombinant adeno-associated virus (rAAV).
Within Group II, Applicant has elected the following species, wherein:
i) the target sequence comprises “at least two target sequences specific for miR-183”.
Claims 31-35, 41, and 43-57 are pending and under examination.
Priority
This application is a continuation of PCT/US2019/067872 filed on December 20, 2019.
This application is claiming the benefit under 35 U.S.C. 119(e) of prior-filed provisional applications 62/783,956, filing date 12/21/2018; 62/924,970 filing date 10/23/2019 and 62/934,915 filing date 11/13/2019
Thus, the earliest possible priority for the instant application is December 21, 2018.
Information Disclosure Statement
Applicant has filed an Information Disclosure Statement on July 24, 2025 that has been considered.
The signed and initialed PTO Forms 1449 are mailed with this action.
Specification
1. The use of the term “SOLUTOL”, “LABRASOL”, and “TWEEN” (pg 36, lines 32-33) which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Appropriate correction is required. See, for example, Pluronic® F68 (pg 36, line 27).
Claim Objections
2. The prior objections to Claim 49 and 52 are withdrawn in light of Applicant’s amendment to the claims.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
3. Claim 43 is rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception without significantly more.
Claim 43 has been amended to recite the limitation wherein the miR-183 target sequences are at least 99% complementary to the full-length miR-183 sequence”.
The claim attempts to capture embodiments that are as little as 99%, and less than 100%, identical to the full-length miR-183 sequence.
As discussed in the prior Office Action, GenBank NR_029615.1 (Homo sapiens miR-183, November 12, 2024) evidences that the full-length miR-183 primary transcript is composed of 110 nucleotides.
Instant specification fails to disclose “full-length miR-183”, being directed to the full-length miR-183 primary transcript is composed of 110 nucleotides. See also 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejection below.
Krol et al (2010; of record) taught the mature miR-183 is 22 nucleotides in length, wherein the miR-183 seed sequence is only 7 nucleotides, to wit, AUGGCAC (Figure 1b). See also Fogerty et al (2019; of record; Figure 1b).
Instant specification discloses miR-183 target sequence of 22 nucleotides, comprising a sequence complementary to the miR-183 seed sequence of only 7 nucleotides (e.g. pg 12, last para, SEQ ID NO:1).
21/22 = 95%, and thus is outside the claimed range.
99% identity is 21.78 nucleotides.
Because there is no such thing as partial nucleotide, instant Claim 43 makes no sense and violates natural law of biology and chemistry. Thus, at best, the claim is considered to be directed to the judicial exception of abstract thought.
This judicial exception is not integrated into a practical application because it makes no sense and violates natural law of biology and chemistry. The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception.
See also 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections below.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
4. The prior rejection of Claim 42 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s cancellation of the claim.
5. The prior rejection of Claim(s) 53-55 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement, is withdrawn in light of Applicant’s amendments to the claims.
6. Claim(s) 31-35 and 43 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 31 has been amended to recite the phrase “which comprises the miR-183 seed sequence that are complementary to the miR-183”, which renders the claim indefinite because “which comprises” is a dangling modifier. Does it refer back to the “miR-target sequences” or the “miR-183 in the DRG cells”?
While it is clear the miR sponge (syn. at least two miR-target sequences) is to be 12-28 nucleotides in length, and the DRG-expressed miR-183 comprises the miR-183 seed sequence,
the claim does not require the miR-target to comprise a sequence complementary to the miR-183 seed sequence. Rather, see Claim 41, instead, reciting the at least two miR-183 target sequences…comprise at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence.
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
7. Claim 41 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 41 has been amended to recite the limitation wherein the at least two miR-183 target sequences are each 12 nucleotides to 28 nucleotides in length and comprise at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence”.
Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999). The phrase “at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence” renders the claim indefinite because the specification does not clearly redefine the term “miR-183 seed sequence”.
Instant specification discloses miR-183 target sequence of 22 nucleotides, comprising a sequence complementary to the miR-183 seed sequence of only 7 nucleotides (e.g. pg 12, last para, SEQ ID NO:1).
Krol et al (2010; of record) taught the mature miR-183 is 22 nucleotides in length, wherein the miR-183 seed sequence is only 7 nucleotides, to wit, AUGGCAC (Figure 1b). See also Fogerty et al (2019; of record; Figure 1b).
Thus, recitation of a miR-183 seed sequence of 8 nucleotides is broader in scope than the art-recognized miR-183 seed sequence.
The specification fails to disclose an 8-nucleotide miR-183 seed sequence.
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
8. Claim(s) 43-57 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement.
The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 43 and 44 have been amended to recite the limitation “the full-length miR-183 sequence”.
Clear support for the new limitation(s) cannot be found in the instant application or priority documents. Accordingly, the amendment(s) to Claims 43-44 are considered to constitute new matter.
MPEP 2163.06 notes “If new matter is added to the claims, the examiner should reject the claims under 35 U.S.C. 112, first paragraph - written description requirement. In re Rasmussen, 650 F.2d 1212, 211 USPQ 323 (CCPA 1981).” MPEP 2163.02 teaches that “Whenever the issue arises, the fundamental factual inquiry is whether a claim defines an invention that is clearly conveyed to those skilled in the art at the time the application was filed...If a claim is amended to include subject matter, limitations, or terminology not present in the application as filed, involving a departure from, addition to, or deletion from the disclosure of the application as filed, the examiner should conclude that the claimed subject matter is not described in that application”. MPEP 2163.06 further notes “When an amendment is filed in reply to an objection or rejection based on 35 U.S.C. 112, first paragraph, a study of the entire application is often necessary to determine whether or not “new matter” is involved. Applicant should therefore specifically point out the support for any amendments made to the disclosure” (emphasis added).
As discussed in the prior Office Action, GenBank NR_029615.1 (Homo sapiens miR-183, November 12, 2024) evidences that full-length miR-183 primary transcript is composed of 110 nucleotides.
Krol et al (2010; of record) taught the mature miR-183 is 22 nucleotides in length, wherein the miR-183 seed sequence is only 7 nucleotides, to wit, AUGGCAC (Figure 1b). See also Fogerty et al (2019; of record; Figure 1b).
Applicant fails to articulate and point explicitly where “full-length miR-183”, being the primary transcript 110 nucleotides in length and encoding the unprocessed form of miR-183, is disclosed in the instant application.
A key-word search fails to identify “full-length miR-183”.
If Applicant believes that support for “full-length miR-183”, is present and clearly envisaged in the instant application or earlier filed priority documents, applicant must, in responding to this Office Action, point out with particularity, where such support may be found.
Applicant does not indicate where these limitations are supported by the original specification, or how, as is Applicant's burden. See MPEP §714.02, last sentence of the third paragraph from the end and MPEP §2163.06 (I) last sentence.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
9. Claim 43 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 43 has been amended to recite the limitation wherein the miR-183 target sequences are at least 99% complementary to the full-length miR-183 sequence”.
The claim attempts to capture embodiments that are as little as 99%, and less than 100%, identical to the full-length miR-183 sequence.
Krol et al (2010; of record) taught the mature miR-183 is 22 nucleotides in length, wherein the miR-183 seed sequence is only 7 nucleotides, to wit, AUGGCAC (Figure 1b). See also Fogerty et al (2019; of record; Figure 1b).
21/22 = 95%, and thus is outside the claimed range.
99% identity is 21.78 nucleotides.
Because there is no such thing as partial nucleotide, instant Claim 43 makes no sense and violates natural law of biology and chemistry. Thus, the claim is considered to be directed to the judicial exception of abstract thought.
To the extent “full-length miR-183” refers to the primary transcript of miR-183, being the primary transcript 110 nucleotides in length and encoding the unprocessed form of miR-183, then see 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, New Matter rejection above.
To the extent “full-length miR-183” refers to the mature form of miR-183, then, as discussed above, the miR-183 sequence is only 22 nucleotides.
99% identity is 21.78 nucleotides.
Because there is no such thing as partial nucleotide, instant Claim 43 makes no sense and violates natural law of biology and chemistry.
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
10. Claim(s) 31-35, 41, and 43-57 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 31 has been amended to recite the phrase “an AAV capsid which transduces a cell targeted for delivery of the vector genome and a dorsal root ganglia (DRG) cell”.
Claim 44 has been amended to recite the phrase “an AAV capsid which transduces a cell targeted for delivery of the vector genome and a dorsal root ganglia (DRG) cell”.
As a first matter, a broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claims 31 and 44 recite the broad recitation a cell targeted for delivery of the vector genome, and the claim also recites a dorsal root ganglia (DRG) cell which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
As a second matter, the term “a cell targeted for delivery of the vector genome” in Claims 31 and 44 is a relative term which renders the claim indefinite. The term “a cell targeted for delivery of the vector genome” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The phrase “a cell targeted for delivery of the vector genome” is considered an arbitrary and subjective determination. The claims fail to recite, and the specification fails to disclose those cells that is/are not “targeted for delivery of the vector genome”, as opposed to those cells that is/are “targeted for delivery of the vector genome”.
As a third matter, the phrase “an AAV capsid which transduces a cell targeted for delivery…” renders the claim indefinite because the referenced cell is itself variable.
A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)).
If there are multiple target cells, yet each yields a different AAV capsid structure(s) and transduction ability, then the claim may be indefinite because it is unclear which target cell is to be used to determine infringement.
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
11. Claim(s) 44-57 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 44 has been amended to recite the phrase “miR-183 target sequences each comprising 2 nucleotides to 28 nucleotides in length and at least 8 consecutive nucleotides”, which renders the claim indefinite because it is unclear to what the range of 2-28 nucleotides refers. If the miR-183 target sequence is only 2 nucleotides in length, then it cannot comprise at least 8 consecutive nucleotides.
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
12. Claim(s) 52 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The claim has been amended to recite wherein the at least four miRNA target sequences consist of 200 to 1200 nucleotides in length, which renders the claim indefinite because Claims 44 and 52 recite wherein the vector genome comprises at least four miR target sequences, which is open language, allowing for additional, unrecited elements in the claims (MPEP 2111.03), and it is unclear if the limitation “consists of” is referring back to the length of each individual miR target sequence or the sum of the miR target sequences comprising the at least four miR target sequences.
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
13. Claim(s) 56 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 56 has been amended to recite the phrase “100% complementary to the miR-183 sequence comprising the seed sequence”.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claim 56 recites the broad recitation “the miR-183 sequence”, and the claim also recites “the seed sequence” which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. It is unclear which sequence the 8 consecutive nucleotides are to be 100% complementary.
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
14. Claim(s) 31-35, 41, and 43-57 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement.
The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 31 has been amended to recite the phrase “an AAV capsid which transduces a cell targeted for delivery of the vector genome and a dorsal root ganglia (DRG) cell”.
Claim 44 has been amended to recite the phrase “an AAV capsid which transduces a cell targeted for delivery of the vector genome and a dorsal root ganglia (DRG) cell”.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997).
The claims are broad for reasonably encompassing an enormously vast genus of structurally undisclosed AAV capsids that have the functional property of transducing an enormously vast genus of structurally undisclosed target cells “for delivery of the vector genome” and a dorsal root ganglia (DRG) cell.
As discussed above, the phrase “a cell targeted for delivery of the vector genome” is considered an arbitrary and subjective determination. The claims fail to recite, and the specification fails to disclose those cells that is/are not “targeted for delivery of the vector genome”, as opposed to those cells that is/are “targeted for delivery of the vector genome”.
The phrase “an AAV capsid which transduces a cell targeted for delivery…” renders the claim indefinite because the referenced cell is itself variable.
The claims are broad for reasonably encompassing an enormous genus of human and non-human animals, including mammals (e.g. pg 1, line 25, “animals and humans”).
The claims are broad for encompassing about 1,000,000 species of animals (Kingdoms of Life, waynesword.palomar.edu/trfeb98.htm, last visited April 8, 2021), wherein the mammalian sub-genus reasonably encompasses some 6,400 species (including humans), distributed in about 1,200 genera, about 152 families and about 29 orders (Mammal, en.wikipedia.org/wiki/Mammal, last visited August 31, 2022).
Wikipedia (List of distinct cell types in the human body; last accessed June 13, 2024) teaches that there at least 1000 different cell types with different anatomical locations and functions just within the human body.
A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)).
If there are multiple target cells, yet each yields a different AAV capsid structure(s) and transduction ability, then the claim may be indefinite because it is unclear which target cell is to be used to determine infringement.
The specification discloses AAV capsids such as AAV1, 2, 3, 4, 5, 6, 6.2, 7, 8, 8b, 9, rh10, hu37, 7M8, and Anc80 (e.g. pg 24, lines 1-3) and discloses an AAV9 capsid and an AAVhu68 capsid that is able to transduce DRG cells (e.g. pg 80, Example 6).
The specification discloses the capsid may have an amino acid sequences as little as 70% identity relative to a reference sequence (e.g. pg 24, lines 11-12), e.g. the AAV9 capsid of SEQ ID NO:17, which is 736 amino acids in length.
Thus, the claims encompass as many as 221 amino acid substitutions, insertions, and/or deletions.
20^221 = about 3x10^287 structurally and functionally undisclosed AAV capsid variants.
(calculator.net/exponent-calculator.html; last visited July 30, 2025)
The claims fail to recite, and the specification fails to disclose, the structure/function nexus between the enormously vast genus of about 3x10^287 structurally and functionally undisclosed AAV capsid variants that necessarily and predictably have the functional properties of transducing the enormously vast genus of structurally different target cells “for delivery of the vector genome” and/or DRG cells.
At best, the specification supports two AAV capsid species that transduce, at least, DRG cells, to wit, an AAV9 capsid and an AAVhu68 capsid that is able to transduce DRG cells (e.g. pg 80, Example 6).
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”).
Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) (“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). “A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed.” In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004)
The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005).
For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014)
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is’).
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper.
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
In the instant case, knowing that the initial AAV capsid is AAV9 or AAVhu68 does not tell you anything at all about the enormously vast genus of about 3x10^287 structurally and functionally undisclosed AAV capsid variants that necessarily and predictably have the functional properties of transducing the enormously vast genus of structurally different target cells “for delivery of the vector genome” and/or DRG cells.
In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”.
“The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.”
“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
In the instant case, the record reflects that the claims encompass an enormously vast genus of about 3x10^287 structurally and functionally undisclosed AAV capsid variants that necessarily and predictably have the functional properties of transducing the enormously vast genus of structurally different target cells “for delivery of the vector genome” and/or DRG cells.
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
The only AAV capsid species disclosed is AAV9 or AAVhu68.
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
15. Claim(s) 55 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement.
The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 55 has been amended to recite the phrase “artificial cerebrospinal fluid”.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997).
The claims are broad for reasonably encompassing an enormously vast genus of structurally undisclosed pharmaceutical carriers [structures] described using functional language “artificial cerebrospinal fluid”.
While the specification discloses Eliott’s formulation buffer and Harvard apparatus perfusion fluid (e.g. pg 36, lines 11-14), instant claim is broader in scope than either two species, and reasonably encompasses an enormously vast genus of structurally undisclosed formularies.
The claim fails to recite, and the specification fails to disclose, what pharmaceutical carrier formulary(ies) objectively fulfill “artificial cerebrospinal fluid”, as opposed to what pharmaceutical carrier formulary(ies) do not objectively fulfill “artificial cerebrospinal fluid”.
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”).
The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005).
For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014)
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is’).
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
16. Claim(s) 31-35, 41, and 43-56 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement.
The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 31 has been amended to recite a nucleic acid encoding at least two miRNA target sequences specific for miR-183,
wherein the at least two miRNA target sequences for miR-183 comprise at least 12-28 nucleotides in length [structure] having the functional property of specifically binding to a miR-183 in dorsal root ganglia [function], and
wherein the at least two miRNA target sequences for miR-183 repress expression of the gene product in dorsal root ganglia [function].
While it is clear the miRNA target sequence is to comprise at least 12 nucleotides, the claim does not require the miRNA target sequence to comprise a sequence that is complementary to the miR-183 seed sequence.
Rather, see Claim 41 that positively recites the miRNA target sequence is at least 12 nucleotides in length and comprises at least 8 nucleotides that are 100% complementary to the miR-183 seed sequence.
Claim 44 has been amended to recite a nucleic acid encoding at least four miRNA target sequences that repress expression of the gene product in dorsal root ganglia [function], and
wherein the at least two of the four miRNA target sequences comprise target sequences specific for miR-183 that are at least 12-28 nucleotides in length (no upper limit) and each comprising at least 8 nucleotides that are complementary to the full-length miR-183 [structure], which is equivalent to just 36% identity.
Claim 44 does not require the miR target sequence to comprise 100% identity to the miR-183 seed sequence.
Claim 56 has been amended to recite wherein the miR target sequence comprises:
a) at least 12 nucleotides 100% complementary to the full-length miR-183 sequence, which is equivalent to a total of only 55% identity to miR-183; or
b) at least 8 nucleotides that are complementary to the full-length miR-183 [structure], which is equivalent to just 36% identity to miR-183.
Claim 56(b) does not require the miR target sequence to comprise 8 nucleotides that are 100% identity to the miR-183 seed sequence.
There is a lack of adequate written description regarding the nexus of the enormous genus of structurally undisclosed miRNA target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia.
There is a lack of adequate written description regarding the nexus of the enormous genus of structurally undisclosed miRNA target sequences that necessarily and predictably have the functional properties of specifically binding miR-183.
There is a lack of adequate written description regarding the nexus of the enormous genus of structurally undisclosed miRNA target sequences that necessarily and predictably have the functional properties of specifically binding miR-182.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997).
The claims are broad for reasonably encompassing an enormously vast genus of structurally undisclosed miRNA target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia.
The claims are broad for reasonably encompassing an enormously vast genus of structurally undisclosed miRNA target sequences that necessarily and predictably have the functional properties of specifically binding miR-183 or miR-182, respectively.
While it is clear that the miRNA target sequence is to comprise a sequence complementary to a miRNA seed sequence, the term “target” is broader in scope than, and not synonymous with, “seed”. The claims do not require the miRNA target sequence to comprise a sequence 100% complementary to the miR-183 seed sequence, nor 100% complementary to the miR-182 seed sequence.
The specification discloses the miRNA target sequence may be as large as 7, 10, 12, 20, 22, 24, 26, or 28 nucleotides in length (e.g. pg 10, lines 15-18).
(4)^7 = 1x10^4 structurally and functionally undisclosed nucleic acid sequences.
(4)^10 = 1x10^6 structurally and functionally undisclosed nucleic acid sequences.
(4)^12 = 1x10^7 structurally and functionally undisclosed nucleic acid sequences.
(4)^20 = 1x10^12 structurally and functionally undisclosed nucleic acid sequences.
(4)^22 = 2x10^13 structurally and functionally undisclosed nucleic acid sequences.
(4)^24 = 3x10^14 structurally and functionally undisclosed nucleic acid sequences.
(4)^26 = 4x10^15 structurally and functionally undisclosed nucleic acid sequences.
(4)^28 = 7x10^16 structurally and functionally undisclosed nucleic acid sequences.
(https://www.calculator.net/exponent-calculator.html; last visited February 20, 2025)
While the claims recite the miR-183 target sequence need only comprise at least 7 or 8 nucleotides complementary to miR-183, GenBank NR_029615.1 (Homo sapiens miR-183, November 12, 2024) evidences that full-length miR-183 transcript is composed of 110 nucleotides.
7/110 = 6% identity to miR-183, allowing for 103 undisclosed nucleotides of varied sequences.
(4)^103 = 4x10^62 structurally and functionally undisclosed nucleic acid sequences.
Krol et al (2010; of record) taught the mature miR-183 is 22 nucleotides in length, wherein the miR-183 seed sequence is only 7 nucleotides, to wit, AUGGCAC (Figure 1b). See also Fogerty et al (2019; of record; Figure 1b).
Even if one were to argue that the miR-183 target sequence is not more than 28 nucleotides in length, and at least 7 or 8 of which are complementary to miR-183, 7/28 = only 25%, for which the remaining 21 nucleotides are structurally undisclosed.
(4)^20 = 1x10^12 structurally and functionally undisclosed nucleic acid sequences.
(4)^22 = 2x10^13 structurally and functionally undisclosed nucleic acid sequences.
Claim 56(b) suffers the same/similar deficiencies as it relates to the structure/function of miR-183 target sequences.
Claim 35 suffers the same/similar deficiencies as it relates to the structure/function of miR-182 target sequences.
Claim 56(a) at least recites at least 7 nucleotides that are 100% complementary to the miR-183 seed sequence.
Claim 41 has been amended to recite wherein the miR-183 target sequence is 12-28 nucleotides in length and comprise at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence.
The claim is broad for encompassing embodiments such as:
xx[seed complement]xxxxxxxxxxxxxxxxxxx;
xxxx[seed complement]xxxxxxxxxxxxxxxxx;
xxxxxx[seed complement]xxxxxxxxxxxxxxx;
xxxxxxxx[seed complement]xxxxxxxxxxxxx;
xxxxxxxxxx[seed complement]xxxxxxxxxxx;
xxxxxxxxxxxx[seed complement]xxxxxxxxx;
xxxxxxxxxxxxxx[seed complement]xxxxxxx;
xxxxxxxxxxxxxxxx[seed complement]xxxxx;
xxxxxxxxxxxxxxxxxx[seed complement]xxx; and
xxxxxxxxxxxxxxxxxxxx[seed complement]x, for example.
However, 8 nucleotides of complementarity to miR-183 is only 36% identity.
(4)^20 = 1x10^12 structurally and functionally undisclosed nucleic acid sequences.
The art uses miR-183 target sites that are perfectly complementary to the entirety of the mature miR-183 oligonucleotide of 22 nucleotides, but for a central bulge of 3 nucleotides to prevent cleavage of the sponge RNA (e.g. Krol et al, Methods).
The prior art does not teach, and the specification fails to disclose, that an 8-nucleotide sequence is dispositive for and controlling over all the remaining 20 or more (no upper limit in the claims), including, but not limited to, 200-1200 nucleotides in length, structurally undisclosed nucleotides of the target sequence(s).
The prior art does not teach, and the specification fails to disclose, miR-183 target sequences having only 36% identity to miR-183 yet still retain the ability to specifically bind to miR-183 [functional property], and thereby necessarily and predictably downregulate expression of an operably linked target gene in DRG cells [functional property].
The prior art does not teach, and the specification fails to disclose, miR-183 target sequences having only 100% identity to the 7-nucleotide miR-183 seed sequence alone, absent complementarity to the remaining nucleotides of the mature miR-183, is minimally sufficient to retain the ability to specifically bind to miR-183 [functional property], and thereby necessarily and predictably downregulate expression of an operably linked target gene in DRG cells [functional property].
Rather, the only miR-183 target species demonstrated to have the recited functional properties is SEQ ID NO:1, recited in Claim 57.
Similarly, the only miR-182 target species demonstrated to have the recited functional properties is SEQ ID NO:2, recited in Claim 57.
The claims fail to recite, and the specification fails to disclose, the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, nor are specific for miR-183, nor are specific for miR-182.
The claims fail to recite, and the specification fails to disclose, a first miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, as opposed to a second miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that does not necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia.
The claims fail to recite, and the specification fails to disclose, how to transform or otherwise modify a first miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that does not necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, into a second miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that now necessarily and predictably has the functional properties of repressing expression of the gene product in dorsal root ganglia.
The claims fail to recite, and the specification fails to disclose, a first miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of being specific for miR-183, as opposed to a second miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that does not necessarily and predictably have the functional properties of being specific for miR-183.
The claims fail to recite, and the specification fails to disclose, how to transform or otherwise modify a first miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that does not necessarily and predictably have the functional properties of being specific for miR-183, into a second miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that now necessarily and predictably has the functional properties of being specific for miR-183.
The claims fail to recite, and the specification fails to disclose, a first miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of being specific for miR-182, as opposed to a second miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that does not necessarily and predictably have the functional properties of being specific for miR-182.
The claims fail to recite, and the specification fails to disclose, how to transform or otherwise modify a first miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that does not necessarily and predictably have the functional properties of being specific for miR-182, into a second miRNA target sequence of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that now necessarily and predictably has the functional properties of being specific for miR-182.
Before the effective filing date of the claimed invention, it was known in the art that “MicroRNA is a single-stranded RNA molecule of 21-25 nucleotides, which regulates gene expression in eukaryotes. Specifically, it is known to bind to 3' UTR (untranslated region) of mRNA for a specific gene to inhibit its translation. All the animal microRNAs studied heretofore decrease protein expression without affecting the level of mRNA for a specific gene.” (Park et al., US Pub. 2010/0240058, paragraph [0002]; of record). Additionally, Park et al. discloses “microRNA is attached to RISC (RNA-induced silencing complex) to complementarily bind with a specific mRNA, but the center of microRNA remains mismatched, so it does not degrade mRNA, unlike conventional siRNAs” (paragraph [0003]) and that “pre-miRNA is transported into cytoplasm and cleaved by an enzyme, Dicer, finally to form mature microRNA of 21-25 nucleotides” (paragraph [0005]).
Additionally, Fogerty et al., (2019; Sci. Rep. 9, 10302; pp. 1-15; of record), discloses that the RISC complex facilitates mRNA targeting, typically within its 3′ untranslated region (page 1, para 1). Thus, the prior art support binding of endogenous expression of mature microRNA (miR) 183 complex to the miR183 sequence target of SEQ ID NO: 1 within the 3′ untranslated region of the transgene messenger RNA, e.g., GFP, for the transgene-derived mRNA for ablating transgene expression in DRG neurons.
Post-filing art by inventors, Hordeaux et al., (2020, Sci. Transl. Med. Pp. 1-14; of record IDS filed on 1/18/2021) states “cloning miRNA targets that are solely expressed in DRG neurons into the 3′ untranslated regions (UTRs) of the transgene (fig. S2B). Any mRNA expressed from the vector would be destroyed by the endogenously expressed miRNA” and that the miRNA183 cluster containing three miRNAs (96, 182, and 183), all expressed from a polycistronic pri-miRNA is specifically expressed in DRG and conserved across species, e.g., (see miRBase trackers for miR183: MI0000273, MI0003084, and MI0000225; miR182: MI0000272, MI0000224, MI0002815 (page 1, column). Thus, post-filing art by inventors supports the specific miR target sequences comprising the full length of SEQ ID NOS: 1 and 2. Hordeaux et al does not teach other miR183 target sequences of an undisclosed number of nucleotides that are effective at binding the endogenous expression of microRNA (miR) 183 complex to reduce transgene expression and toxicity in DRG. In relation to four repeat concatemers of the target miRNA sequences in the 3′ untranslated region of the mRNA of the transgene, Hordeaux et al., teaches that “the redundancy of the of the miR183 cluster with common targets for miR183, 182, and 96 may decrease this theoretical risk [toxicity limited to heavily transduced cells that express miR183 (DRGs)], as suggested in complete cluster versus single miRNA knockout models”.
Indeed , Fogerty et al., (2019; Sci. Rep. 9, 10302; pp. 1-15; of record IDS filed on 12/31/2020), teaches that in the retina, the three mir-183/96/182 in the cluster are ultimately required in photoreceptors and a single miRNA from the cluster compensates for the loss of another (abstract), where loss of one of the three miRNA impairs function in mice differently, for example, “In mice, the loss of miR-183 and miR-96 in addition to miR-182 produces a more severe retinal phenotype than loss of miR-182 alone but the contribution of each miRNA remains unclear” (page 3, para 5). Moreover, Fogerty et al., discloses that in zebrafish several mutants of the cluster mir-183/96/182 lead to reduced expression (“It is notable that the mir-96 mutation in the mir-96lri60 and mir-96/182lri79 alleles, which is a net insertion of only 2 nucleotides and decreased expression by 90 percent and 88 percent, respectively, was nearly as disruptive as the much larger mir-182lri61 mutation (11bp deletion)” (page 4; para.1). Thus, the prior art supports the relevance of the redundancy of the of the miR183 cluster to preserve the cluster’s structure/function and prevent components from being lost (page 8, last paragraph) and the critical full length of SEQ ID NO:1 where single point mutations result in reduced activity.
Rather, the only species disclosed is:
i) the miR-183 target sequence of SEQ ID NO:1, as recited in Claim 57; and
ii) the mirR-182 target sequence of SEQ ID NO:2, as recited in Claim 57.
Recently, the U.S. Court of Appeals for the Federal Circuit (Federal Circuit) decided Amgen v. Sanofi, 872 F.3d 1367 (Fed. Cir. 2017), which concerned adequate written description for claims drawn to antibodies. These claims are usually handled in Technology Center 1600. The Federal Circuit explained in Amgen that when an antibody is claimed, 35 U.S.C. § 112(a) requires adequate written description of the antibody itself. Amgen, 872 F.3d at 1378-79. The Amgen court expressly stated that the so-called "newly characterized antigen" test, which had been based on an example in USPTO-issued training materials and was noted in dicta in several earlier Federal Circuit decisions, should not be used in determining whether there is adequate written description under 35 U.S.C. § 112(a) for a claim drawn to an antibody. Citing its decision in Ariad Pharmaceuticals, Inc. v. Eli Lilly & Co., the court also stressed that the "newly characterized antigen" test could not stand because it contradicted the quid pro quo of the patent system whereby one must describe an invention in order to obtain a patent. Amgen, 872 F.3d at 1378-79, quotingAriad Pharmaceuticals, Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1345 (Fed. Cir. 2010). In view of the Amgen decision, adequate written description of a newly characterized antigen alone should not be considered adequate written description of a claimed antibody to that newly characterized antigen, even when preparation of such an antibody is routine and conventional. Id. The Amgen decision will be added to the MPEP in due course.
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”).
Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) (“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). “A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed.” In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004)
The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005).
For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014)
Since the genetic code is widely known, a disclosure of an amino acid sequence would provide sufficient information such that one would accept that an inventor was in possession of the full genus of nucleic acids encoding a given amino acid sequence, but not necessarily any particular species. Cf. In re Bell, 991 F.2d 781, 785, 26 USPQ2d 1529, 1532 (Fed. Cir. 1993) and In re Baird, 16 F.3d 380, 382, 29 USPQ2d 1550, 1552 (Fed. Cir. 1994).
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is’).
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper.
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
In the instant case, knowing that the initial nucleic acid sequence is to bind a miRNA, or, even more specifically miR-183 or miR-182, does not tell you anything at all about the structure (nucleic acid sequences) of the enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, nor are specific for miR-183, nor are specific for miR-182.
In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”.
“The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.”
“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
In the instant case, the record reflects that the claims encompass an enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, nor are specific for miR-183, nor are specific for miR-182.
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
The only species disclosed is:
i) the miR-183 target sequence of SEQ ID NO:1, as recited in Claim 57; and
ii) the mirR-182 target sequence of SEQ ID NO:2, as recited in Claim 57.
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
Response to Arguments
Applicant argues that the claims require the miR-183 target sequence to comprise a sequence complementary to the miR-183 seed sequence.
Applicant’s argument(s) has been fully considered, but is not persuasive. Instant claim language is obfuscatory and does not require the miR-183 target sequence(s) to comprise a sequence complementary to the miR-183 seed sequence. See 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejections discussed above.
Furthermore, even Claim 41 reasonably encompasses an enormously vast genus of about 1x10^12 structurally and functionally undisclosed nucleic acid sequences.
The art uses miR-183 target sites that are perfectly complementary to the entirety of the mature miR-183 oligonucleotide of 22 nucleotides, but for a central bulge of 3 nucleotides to prevent cleavage of the sponge RNA (e.g. Krol et al, Methods).
The prior art does not teach, and the specification fails to disclose, that an 8-nucleotide sequence is dispositive for and controlling over all the remaining 20 or more (no upper limit in the claims), including, but not limited to, 200-1200 nucleotides in length, structurally undisclosed nucleotides of the target sequence(s).
The prior art does not teach, and the specification fails to disclose, miR-183 target sequences having only 36% identity to miR-183 yet still retain the ability to specifically bind to miR-183 [functional property], and thereby necessarily and predictably downregulate expression of an operably linked target gene in DRG cells [functional property].
The prior art does not teach, and the specification fails to disclose, miR-183 target sequences having only 100% identity to the 7-nucleotide miR-183 seed sequence alone, absent complementarity to the remaining nucleotides of the mature miR-183, is minimally sufficient to retain the ability to specifically bind to miR-183 [functional property], and thereby necessarily and predictably downregulate expression of an operably linked target gene in DRG cells [functional property].
Rather, the only miR-183 target species demonstrated to have the recited functional properties is SEQ ID NO:1, recited in Claim 57.
Similarly, the only miR-182 target species demonstrated to have the recited functional properties is SEQ ID NO:2, recited in Claim 57.
Applicant argues that the claims are not directed to a cluster or family, but rather to a specific member of the cluster, i.e. miR-183, for which the specification provides more than adequate written description and enablement. The claims define the minimum sequence required to target a miR-183 to be at least 7 consecutive nucleotides that are complementary to miR-183.
Applicant’s argument(s) has been fully considered, but is not persuasive.
As a first matter, only Claims 41, 44(b), and 56 require the minimum number of 7 or 8 nucleotides to be consecutive and 100% complementary to a miR-183 sequence. Claims 31-35 and 42-43 do not.
As a second matter, while it is clear that the miRNA target sequence is to comprise a sequence complementary to a miRNA seed sequence, the term “target” is broader in scope than, and not synonymous with, “seed”. The claims do not require the miRNA target sequence to comprise a sequence 100% complementary to the miR-183 seed sequence, nor 100% complementary to the miR-182 seed sequence.
Claim 56(a) at least recites at least 7 nucleotides that are 100% complementary to the miR-183 seed sequence.
Even if one were to argue that the miR-183 target sequence is not more than 28 nucleotides in length, and at least 7 or 8 of which are complementary to miR-183, 7/28 = only 25%, for which the remaining 21 nucleotides are structurally undisclosed.
(4)^20 = 1x10^12 structurally and functionally undisclosed nucleic acid sequences.
(4)^22 = 2x10^13 structurally and functionally undisclosed nucleic acid sequences.
Thus, the claims reasonably encompass an enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, are specific for miR-183, or are specific for miR-182.
Claim 56(b) suffers the same/similar deficiencies as it relates to the structure/function of miR-183 target sequences.
Claim 35 suffers the same/similar deficiencies as it relates to the structure/function of miR-182 target sequences.
The only species disclosed is:
i) the miR-183 target sequence of SEQ ID NO:1, as recited in Claim 57; and
ii) the mirR-182 target sequence of SEQ ID NO:2, as recited in Claim 57.
Per In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023)), the claims do not satisfy 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, written description and enablement requirements.
17. Claim(s) 31-35, 41, and 43-56 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, while being enabling for the miR-183 target sequence of SEQ ID NO:1 and the mirR-182 target sequence of SEQ ID NO:2, does not reasonably provide enablement for an enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, and are specific for miR-183, or are specific for miR-182, respectively.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to practice the invention commensurate in scope with these claims.
The Examiner incorporates herein the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, written description rejection.
Per In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023)), the claims do not satisfy 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, written description and enablement requirements.
Response to Arguments
Applicant argues that methods for assessing the claimed rAAV are known in the art.
Applicant’s argument(s) has been fully considered, but is not persuasive.
In the instant case, the record reflects that the claims encompass an enormously vast genus of about 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, nor are specific for miR-183, nor are specific for miR-182.
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
The only species disclosed is:
i) the miR-183 target sequence of SEQ ID NO:1, as recited in Claim 57; and
ii) the mirR-182 target sequence of SEQ ID NO:2, as recited in Claim 57.
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
18. Claim(s) 31-33, 35, 41, 44, 47-50, 52, and 56 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Krol et al (Characterizing Light-Regulated Retinal MicroRNAs Reveals Rapid Turnover as a Common Property of Neuronal MicroRNAs, Cell 141: 618-631, 2010), as evidenced by Mason et al (Comparison of AAV Serotypes for Gene Delivery to Dorsal Root Ganglion Neurons, Molecular Therapy 18(4): 715-724, 2010).
With respect to Claims 31 and 44, Krol et al is considered relevant prior art for having taught a rAAV virus (e.g. pg 629, col. 2, Methods, “AAV2….viruses”; Figure 2F) whose genome comprises:
a) a coding sequence for a gene product operably linked to regulatory sequences which control expression of the gene product in a cell containing the vector genome; and
b) at least four miR-183 target sequences and at least four miR-182 target sequences in the coding sequence 3’ UTR (Figure 2F).
Krol et al taught wherein the miR-183 target sequence comprises a nucleotide sequence that is 100% complementary to the 7-nucleotide miR-183 seed sequence (e.g. Figure S3c, S3f).
Krol et al do not teach wherein the miR-183 target sequences result in repressed expression of the gene product in the dorsal root ganglia.
However, "Products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art product comprising four miR-183 target sites and/or four miR-182 target sites does not inherently possess the same properties as the instantly claimed product.
Mason et al evidence that the AAV2 virus Krol et al is capable of tranducing dorsal root ganglia cells (e.g. Figure 4a-c).
With respect to Claim 32, Krol et al taught wherein the vector genome comprises four target sequences specific for miR-183 (Figure 2F).
With respect to Claim 33, Krol et al taught wherein the vector genome comprises four target sequences specific for miR-183 in the 3’ UTR of the coding sequence (Figure 2F).
With respect to Claim 35, Krol et al taught wherein the vector genome comprises two target sequences specific for miR-183 and at least one target sequence specific for miR-182. (Figure 2F).
With respect to Claim 41, Krol et al taught wherein the miR-183 target sequence is about 21 nucleotides in length and comprises a nucleotide sequence of at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence (e.g. Figure S3c, S3f).
Because Krol et al taught wherein the miR-183 target sequence is about 21 nucleotides in length and comprises a nucleotide sequence of at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence, it is considered that such necessarily achieves the at least 30% limitation.
With respect to Claim 56, Krol et al taught wherein the miR-183 target sequence comprises a nucleotide sequence that is 100% complementary to the 7-nucleotide miR-183 seed sequence (e.g. Figure S3c, S3f).
With respect to Claim 47, Krol et al taught wherein a spacer is located 3' to the first miRNA target sequence and/or 5' to the last miRNA target sequence. (Figure 2; Figure S3c).
With respect to Claim 48, Krol et al do not teach the spacers to be different from each other, and thus are reasonably considered to be the same.
With respect to Claim 49, as discussed above, the claim is deficient for a conjunction between the first and second ‘wherein’ clauses. The Examiner interprets the claim to be “wherein…, or wherein…”.
Krol et al do not teach the spacers to comprise a miRNA target sequence.
With respect to Claim 50, Krol et al taught the miRNA sponge is placed about 15 nucleotides from the 3’ end of the gene coding sequence (Figure S3c).
PNG
media_image1.png
140
684
media_image1.png
Greyscale
With respect to Claim 52, Krol et al taught wherein the miRNA sponge comprises at least four miR target sequences and is about 432 nucleotides in length (12 spacers x 15nt each = 180nts) + (12 miR target sequences x 21 nucleotides each = 252nts).
Thus, Krol et al anticipate the claims.
Response to Arguments
Applicant argues that Krol does not teach that miR-183 and miR-182 function differently than miR-96 in dorsal root ganglion.
Applicant’s argument(s) has been fully considered, but is not persuasive. Krol is not required to do so.
Instant claims recite an AAV vector whose genome comprises a miR target sponge comprising miR-183 and miR-182 target sites, which Krol et al taught.
Applicant argues that Krol does not teach or suggest selecting an AAV capsid which transduces dorsal root ganglia.
Applicant’s argument(s) has been fully considered, but is not persuasive. Mason et al evidence that the AAV2 virus Krol et al is capable of tranducing dorsal root ganglia cells (e.g. Figure 4a-c).
Applicant argues that Krol et al do not teach a therapeutic effect or use of the AAV outside of the eye.
Applicant’s argument(s) has been fully considered, but is not persuasive. Instant claims are directed to an AAV product, not a method of use.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
19. Claims 32-33, 35, 41, 43, and 52-57 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Krol et al (2010), as applied to Claims 31-33, 35, 41, 44, 47-50, 52, and 56 above, and in further view of Li et al (MiR-183/-96/-182 cluster is up-regulated in most breast cancers and increases cell proliferation and migration, Breast Cancer Res. 16: 473, 17 pages, doi: 10.1186/s13058-014-0473-z; November 14, 2014).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Krol et al taught wherein the miR-183 target sequence is about 21 nucleotides in length and comprises a nucleotide sequence of at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence (e.g. Figure S3c, S3f).
Krol et al taught the miR-183 target sequence (21nt) is 82% identical to the miR-183, differing only in the central bulge nucleotides (Figure S3f).
Krol et al do not teach wherein the miR-183 target sequence is 100% identical or complementary to the miR-183.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 43 and 57, Li et al is considered relevant prior art for having taught a nucleic acid construct comprising a coding sequence of interest, wherein the 3’ UTR of said coding sequence comprises a miRNA sponge comprising at least four miR-183 target sequences (e.g. Figure S2).
Li et al taught wherein the miR-183 target sequence is 100% complementary to the miR-183, including the central bulge nucleotides (upper line), and is 100% identical to instant SEQ ID NO:1 (lower line) (e.g. Figure S2b), as shown below:
AGTGAATTCTTGGAGTGCCATA
AGTGAATTCTACCAGTGCCATA
Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology and gene expression constructs. Therefore, the level of ordinary skill in this art is high.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first miR-183 target sequence that is 100% identical to the miR-183 binding sites, but for the central bulge, as taught by Krol et al, with a second miR-183 target sequence that is 100% identical to the miR-183 binding sites, including the central bulge, as taught by Li et al, in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first miR-183 target sequence that is 100% identical to the miR-183 binding sites, but for the central bulge, with a second miR-183 target sequence that is 100% identical to the miR-183 binding sites, including the central bulge, in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized and successfully reduced to practice the design of a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences that are 100% complementary to the miR-183 binding sequence.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claim 32, Krol et al taught wherein the vector genome comprises four target sequences specific for miR-183 (Figure 2F).
Li et al taught wherein the vector genome comprises ten target sequences specific for miR-183 (Figure S2).
With respect to Claim 33, Krol et al taught wherein the vector genome comprises four target sequences specific for miR-183 in the 3’ UTR of the coding sequence (Figure 2F).
Li et al taught wherein the vector genome comprises four target sequences specific for miR-183 in the 3’ UTR of the coding sequence (Figure S2).
With respect to Claim 35, Krol et al taught wherein the vector genome comprises two target sequences specific for miR-183 and at least one target sequence specific for miR-182. (Figure 2F).
Li et al taught wherein the vector genome comprises two target sequences specific for miR-183 and at least one target sequence specific for miR-182. (Figure S2).
With respect to Claim 41, Krol et al taught wherein the miR-183 target sequence is about 21 nucleotides in length and comprises a nucleotide sequence of at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence (e.g. Figure S3c, S3f).
Because Krol et al taught wherein the miR-183 target sequence is about 21 nucleotides in length and comprises a nucleotide sequence of at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence, it is considered that such necessarily achieves the at least 30% limitation.
Li et al taught wherein the miR-183 target sequence is about 22 nucleotides in length and comprises a nucleotide sequence of at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence (e.g. Figure S3c, S3f).
Because Li et al taught wherein the miR-183 target sequence is about 22 nucleotides in length and comprises a nucleotide sequence of at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence, it is considered that such necessarily achieves the at least 30% limitation.
With respect to Claim 56, Krol et al taught wherein the miR-183 target sequence comprises a nucleotide sequence that is 100% complementary to the 7-nucleotide miR-183 seed sequence (e.g. Figure S3c, S3f).
Li et al taught wherein the miR-183 target sequence comprises a nucleotide sequence that is 100% complementary to the 7-nucleotide miR-183 seed sequence (e.g. Figure S2).
With respect to Claim 52, Krol et al taught wherein the miRNA sponge comprises at least four miR target sequences and is about 432 nucleotides in length (12 spacers x 15nt each = 180nts) + (12 miR target sequences x 21 nucleotides each = 252nts).
Li et al taught wherein the miRNA sponge comprises at least 30 miR target sequences and is about 660 nucleotides in length (30 miR target sequences x 22 nucleotides each = 660nts).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The specification fails to disclose an element of criticality for the instantly recited range.
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Li et al do not cure the defect(s) of Krol et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Krol et al are discussed above and incorporated herein. Applicant does not contest the teachings of Li et al as applied to the obviousness to substitute a first miR-183 target sequence that is 100% identical to the miR-183 binding sites, but for the central bulge, as taught by Krol et al, with a second miR-183 target sequence that is 100% identical to the miR-183 binding sites, including the central bulge, as taught by Li et al, in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first miR-183 target sequence that is 100% identical to the miR-183 binding sites, but for the central bulge, with a second miR-183 target sequence that is 100% identical to the miR-183 binding sites, including the central bulge, in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized and successfully reduced to practice the design of a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences that are 100% complementary to the miR-183 binding sequence.
20. Claims 33-34 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Krol et al (2010), as applied to Claims 31-33, 35, 41, 44, 47-50, 52, and 56 above, and in further view of Gao et al (U.S. 2010/0186103).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 33, Krol et al taught wherein the vector genome comprises four target sequences specific for miR-183 in the 3’ UTR of the coding sequence (Figure 2F).
Krol et al do not teach wherein the miR-183 target sequence is placed in 5’ UTR of the coding sequence.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 34, Gao et al is considered relevant prior art for having taught a nucleic acid expression constructs, including rAAV expression vectors, wherein the artisan’s nucleic acid coding sequence comprises a 5’ UTR and a 3’ UTR, and one or more miRNA binding sites (e.g. Abstract; [0031] miRNA sponge), and wherein the miRNA target sequences may be placed in the 5’ UTR or the 3’ UTR [0091].
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a 3’ UTR comprising one or more miR-183 target sequences with a 5’ UTR comprising one or more miR-183 target sequences in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a 3’ UTR comprising one or more miR-183 target sequences with a 5’ UTR comprising one or more miR-183 target sequences in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized the scientific and technical design of nucleic acid vectors comprising a miRNA sponge, whereby the miRNA binding sites may be placed in the 5’ or 3’ UTR.
It would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” The ordinary artisan would have immediately recognized that there are but 3 known options where the miRNA binding sites may be placed to regulate expression of the coding sequence: the 5’ UTR, the coding sequence itself, or the 3’ UTR, as disclosed by Gao et al [0091].
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Gao et al do not cure the defect(s) of Krol et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Krol et al are discussed above and incorporated herein. Applicant does not contest the teachings of Gao et al as applied to the obviousness to substitute a 3’ UTR comprising one or more miR-183 target sequences with a 5’ UTR comprising one or more miR-183 target sequences in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a 3’ UTR comprising one or more miR-183 target sequences with a 5’ UTR comprising one or more miR-183 target sequences in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized the scientific and technical design of nucleic acid vectors comprising a miRNA sponge, whereby the miRNA binding sites may be placed in the 5’ or 3’ UTR.
21. Claims 45, 47, and 50-52 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Krol et al (2010), as applied to Claims 31-33, 35, 41, 44, 47-50, 52, and 56 above, and in further view of Vella et al (The C. elegans microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41 3’UTR, Genes & Development 18: 132-137, 2004).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
With respect to Claim 47, Krol et al taught wherein a spacer is located 3' to the first miRNA target sequence and/or 5' to the last miRNA target sequence. (Figure 2; Figure S3c).
Krol et al do not teach wherein the miR-183 target sequences are continuous and not separated by a spacer.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 45, Vella et al is considered relevant prior art for having taught a nucleic acid construct comprising a coding sequence of interest, wherein the 3’ UTR of said coding sequence comprises a miRNA sponge comprising at least four miRNA target sequences (e.g. Figure 1a).
Vella et al taught wherein the miRNA target sequences are continuous and not separated by a spacer (e.g. 5, 3, 1 miR target sites) and/or are separated by a spacer (e.g. miR target site 2) (Figure 1a, constructs pMV1, pMV18).
Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology and gene expression constructs. Therefore, the level of ordinary skill in this art is high.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are each separated by a spacer with a second miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are continuous and not separated by a spacer in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a a miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are each separated by a spacer with a second miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are continuous and not separated by a spacer in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized the scientific and technical design of nucleic acid vectors comprising a miRNA sponge, whereby the miRNA binding sites may be continuous and not separated by a spacer and/or separated by a spacer, as successfully reduced to practice by Vella et al.
It would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” The ordinary artisan would have immediately recognized that there are but 2 known options: spacer or no spacer, and both configurations had been successfully reduced to practice.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claim 50, Krol et al taught the miRNA sponge is placed about 15 nucleotides from the 3’ end of the gene coding sequence (Figure S3c).
Vella et al taught wherein the miRNA sponge is placed immediately downstream from the 3’ end of the gene coding sequence (Figure 1a).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The specification fails to disclose an element of criticality for the instantly recited range.
With respect to Claim 52, Krol et al taught wherein the miRNA sponge comprises at least four miR target sequences and is about 432 nucleotides in length (12 spacers x 15nt each = 180nts) + (12 miR target sequences x 21 nucleotides each = 252nts).
Vella et al taught wherein the miRNA sponge comprises at least 450-500 nucleotides (e.g. Figure 1a, pFS1030, pFS1031).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The specification fails to disclose an element of criticality for the instantly recited range.
With respect to Claim 51, Vella et al taught wherein the miRNA sponge may comprise a miRNA target site placed about 400nt from the 3’ end of the gene coding sequence (Figure 1a, miR site 4).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The specification fails to disclose an element of criticality for the instantly recited range.
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
Response to Arguments
Applicant argues that Vella et al do not cure the defect(s) of Krol et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Krol et al are discussed above and incorporated herein. Applicant does not contest the teachings of Vella et al as applied to the obviousness to substitute a miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are each separated by a spacer with a second miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are continuous and not separated by a spacer in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a a miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are each separated by a spacer with a second miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are continuous and not separated by a spacer in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized the scientific and technical design of nucleic acid vectors comprising a miRNA sponge, whereby the miRNA binding sites may be continuous and not separated by a spacer and/or separated by a spacer, as successfully reduced to practice by Vella et al.
It would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” The ordinary artisan would have immediately recognized that there are but 2 known options: spacer or no spacer, and both configurations had been successfully reduced to practice.
22. Claims 46-47 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Krol et al (2010), as applied to Claims 31-33, 35, 41, 44, 47-50, 52, and 56 above, and in further view of Otaegi et al (An optimized sponge for microRNA miR-9 affects spinal motor neuron development in vivo, Frontiers in Neuroscience 5: Article 146, 9 pages, doi: 10.3389/fnins.2011.00146, January 5, 2012), Kluiver et al (Rapid Generation of MicroRNA Sponges for MicroRNA Inhibition, PLoS ONE 7(1): e29275; 8 pages, January 2012), and New England Biolabs, SphI product sheet; retrieved January 15, 2025).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Krol et al taught wherein the spacers are about 15 nucleotides in length (e.g. Figure S3c).
Krol et al do not teach wherein the spacers are only 4 or 6 nucleotides in length.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 46, Otaegi et al is considered relevant prior art for having taught a nucleic acid construct comprising a coding sequence of interest, wherein the 3’ UTR of said coding sequence comprises a miRNA sponge comprising at least four miR target sequences (e.g. Figure 2), wherein the miR target sequences are separated by spacers.
Otaegi et al taught that spacer regions of different sizes were designed using online tools (e.g. pg 2, col. 1), whereby the spacers do not contain miRNA binding sites (e.g. pg 3, col. 2), and whereby 6 nt spacers generated a stronger effect than larger spacers (e.g. pg 3, col. 1, “6nt spacer”; pg 3, col. 2).
Kluiver et al is considered relevant prior art for having taught a nucleic acid construct comprising a coding sequence of interest, wherein the 3’ UTR of said coding sequence comprises a miRNA sponge comprising at least four miR target sequences (e.g. Figure 1), wherein the miR target sequences are separated by spacers of 5 nucleotides, each encoding a restriction enzyme recognition site, thereby allowing the ordinary artisan to anneal/ligate the miRNA binding sites together when synthesizing the miRNA sponge (Figure 1, legend, SanD1; pg 6, col. 1, Methods, MicroRNA sponge generation).
New England Biolabs evidences that those of ordinary skill in the art immediately recognize that instant SEQ ID NO:7 (GCATGC) is the recognition motif for the Sph1 restriction enzyme.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first spacer in an miRNA sponge with a second spacer, e.g. SEQ ID NO:7, in an miRNA sponge with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first spacer in an miRNA sponge with a second spacer, e.g. SEQ ID NO:7, in an miRNA sponge because those of ordinary skill in the art previously recognized the scientific and technical concepts of using restriction enzyme sites to ligate/anneal miRNA binding sites together, thereby synthesizing a miRNA sponge, whereby the sequence of the spacer is not material to the function of the miRNA sponge, and the ordinary artisan previously recognized that online tools are readily available to design spacer length and sequences, whereby the spacer regions should not contain miRNA binding sites, and whereby shorter spacers, e.g. 6 nt spacers, generated a stronger effect than larger spacers (Otaegi et al).
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
The specification fails to disclose an element of criticality for the instantly recited spacer SEQ ID NOs.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claim 47, Krol et al taught wherein a spacer is located 3' to the first miRNA target sequence and/or 5' to the last miRNA target sequence. (Figure 2; Figure S3c).
Otaegi et al taught wherein a spacer is located 3' to the first miRNA target sequence and/or 5' to the last miRNA target sequence. (Figure 2a).
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
Response to Arguments
Applicant argues that Otaegi et al, Kluiver et al, and New England Biolabs do not cure the defect(s) of Krol et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Krol et al are discussed above and incorporated herein. Applicant does not contest the teachings of Otaegi et al, Kluiver et al, and New England Biolabs as applied to the obviousness to substitute a first spacer in an miRNA sponge with a second spacer, e.g. SEQ ID NO:7, in an miRNA sponge with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first spacer in an miRNA sponge with a second spacer, e.g. SEQ ID NO:7, in an miRNA sponge because those of ordinary skill in the art previously recognized the scientific and technical concepts of using restriction enzyme sites to ligate/anneal miRNA binding sites together, thereby synthesizing a miRNA sponge, whereby the sequence of the spacer is not material to the function of the miRNA sponge, and the ordinary artisan previously recognized that online tools are readily available to design spacer length and sequences, whereby the spacer regions should not contain miRNA binding sites, and whereby shorter spacers, e.g. 6 nt spacers, generated a stronger effect than larger spacers (Otaegi et al).
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
The specification fails to disclose an element of criticality for the instantly recited spacer SEQ ID NOs.
23. Claims 53-55 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Krol et al (2010), as applied to Claims 31-33, 35, 41, 44, 47-50, 52, and 56 above, and in further view of Hadaczek et al (Widespread AAV1- and AAV2-mediated transgene expression in the nonhuman primate brain: implications for Huntington’s disease, Molecular Therapy—Methods & Clinical Development 3: e16037, 11 pages, doi:10.1038/mtm.2016.37; available online June 29, 2016).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Claim 44 recites the intended use of the AAV for transduction of dorsal root ganglia cells, which, in the in vivo context, are located in the brain.
Krol et al taught wherein the AAV composition comprises a pharmaceutically acceptable carrier, e.g. phosphate buffered saline (e.g. Methods).
Krol et al do not teach wherein the pharmaceutically acceptable carrier comprises an artificial cerebrospinal fluid, e.g. buffered saline, and a surfactant.
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 53-54, Hadaczek et al is considered relevant prior art for having taught an AAV pharmaceutical formulation to express the artisan’s nucleic acid of interest in the brain of a subject, said AAV pharmaceutical formulation comprising phosphate-buffered saline and a surfactant, to wit, poloxamer 188 (e.g. pg 9, col. 2, Methods).
With respect to Claim 55, the Examiner interprets AAV pharmaceutical formulation comprising phosphate-buffered saline to fulfill the phrase “artificial cerebrospinal fluid”. To the extent Applicant argues otherwise, see the 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, written description rejection above.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify an AAV pharmaceutical formulation comprising phosphate-buffered saline, as per Krol et al, to further comprise a surfactant, e.g. poloxamer 188, as taught by Hadaczek et al, with a reasonable expectation of success because those of ordinary skill in the art previously recognized and successfully reduced to practice formulating an AAV pharmaceutical composition comprising phosphate-buffered saline and a surfactant, e.g. poloxamer 188, for the intended use of delivering said AAV to the brain of a subject, which is where DRG cells anatomically reside in vivo.
The motivation to combine can arise from the expectation that the prior art elements, will perform their expected functions to achieve their expected results when combined for their common known purpose. MPEP §2144.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the claims at issue are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); and In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO internet Web site contains terminal disclaimer forms which may be used. Please visit http://www.uspto.gov/forms/. The filing date of the application will determine what form should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
24. Claims 31-35, 41, and 43-57 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13, 16, 19, 36-38, 41-44 of copending Application No. 17/998,328 as per claims filed on September 19, 2023. Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are obvious over the cited claims of Application 17/998,328.
Claim 1 of copending Application No. 17/998,328 is directed to:
A recombinant AAV (rAAV) for delivery of a gene product to a patient in need thereof which specifically represses expression of the gene product in dorsal root ganglia (DRG), said rAAV comprising an AAV capsid having packaged therein a vector genome, wherein the vector genome comprises: (a) a coding sequence for the gene product under the control of regulatory sequences that direct expression of the gene product in a cell containing the vector genome; and (b) at least eight miR target sequences, wherein each target sequence is specific for miR-183 or miR-182, and wherein the at least eight miR target sequences are operably linked to the 3’ end of the coding sequence.
Claim 17 of the instant invention is directed to:
A composition for gene delivery comprising a recombinant adeno- associated virus (rAAV), said rAAV comprising a vector genome in an AAV capsid , wherein the vector genome comprises: (a) a coding sequence for a gene product operably linked to regulatory sequences which control expression of the gene product in a cell containing the vector genome, said coding sequence for the gene product having a 5’ end and a 3’ end; and (b) at least four miRNA target sequences which repress expression of the gene product in dorsal root ganglia (DRG) and which are operably linked to the 5’ and/or the 3’ end of the coding sequence in (a), wherein the at least four miRNA target sequences are: (1) at least two target sequences specific for miR-183, and/or (11) at least two target sequences specific for miR-182.
The instant claims required compositions comprising a recombinant adeno- associated virus
Because claims of the instant application are drawn broadly to compositions comprising a recombinant adeno- associated virus, claims of the instant application embrace the invention as set forth in claims 1-13, 16, 19, 36-38, 41-44 of copending Application No. 17/998,328.
This is a provisional obviousness-type double patenting rejection because the conflicting claims have not in fact been patented.
Response to Arguments
Applicant argues that because 17/998328 has a later effective filing date than the instant application, any patent issuing from 17/998,328 will expire at a later date than any claims from the instant application.
Applicant’s argument(s) has been fully considered, but is not persuasive. Instant rejection is a provisional nonstatutory double patenting rejection. Instant claims are not yet in condition for allowance. Instant 17/998,328 claims are not yet in condition for allowance.
Applicant argues that ‘328 requires at least eight copies of the miR-183 and/or miR-182 targeting sequences, and thus is patentably distinct from the instantly claimed invention.
Applicant’s argument(s) has been fully considered, but is not persuasive.
As a first matter, while it is clear that ‘328 claim 1 requires the rAAV vector to comprise at least 8 miRNA target sequences specific for miR-183 or miR-182, it does not require at least eight copies of the miR-183, nor at least eight copies of miR-182 targeting sequences. Rather, the claim encompasses just 4 miR-183 target sequences and just 4 miR-182 target sequences.
The phrases "comprising….at least two miR-183 target sequences", "comprising….at least four miR-183 target sequences", and "comprising….at least one miR-182 target sequences", of instant claims are open-ended and allows for additional miR-183 and/or miR-182 target sequences in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Applicant fails to specifically exclude the presence or more than 1 miR-182 target sequences and/or more than 4 miR-183 target sequences in the instant claims. Instant claims embrace the ‘328 claims.
Furthermore, in the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
The specification fails to disclose an element of criticality for the instantly recited open range(s), as compared to open range(s) of ‘328.
Conclusion
25. No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
KEVIN K. HILL
Examiner
Art Unit 1638
/KEVIN K HILL/Primary Examiner, Art Unit 1638