Prosecution Insights
Last updated: October 01, 2026
Application No. 17/097,997

COMPOSITIONS FOR DRG-SPECIFIC REDUCTION OF TRANSGENE EXPRESSION

Non-Final OA §101§102§103§112§DP
Filed
Nov 13, 2020
Priority
Dec 21, 2018 — provisional 62/783,956 +3 more
Examiner
VIVLEMORE, TRACY ANN
Art Unit
1638
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Trustees of the University of Pennsylvania
OA Round
4 (Non-Final)
73%
Grant Probability
Favorable
4-5
OA Rounds
0m
Est. Remaining
80%
With Interview

Examiner Intelligence

Grants 73% — above average
73%
Career Allowance Rate
531 granted / 727 resolved
+13.0% vs TC avg
Moderate +7% lift
Without
With
+6.6%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
71 currently pending
Career history
798
Total Applications
across all art units

Statute-Specific Performance

§101
4.4%
-35.6% vs TC avg
§103
34.2%
-5.8% vs TC avg
§102
19.4%
-20.6% vs TC avg
§112
24.0%
-16.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 727 resolved cases

Office Action

§101 §102 §103 §112 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on May 20, 2026 has been entered. Detailed Action This action is in response to the papers filed May 20, 2026. Amendments Applicant's response and amendments, filed May 20, 2026, to the prior Office Action is acknowledged. Applicant has cancelled Claims 1-30, 36-40, and 42, amended Claims 31, 41, 43-44, 46, 52, and 56, and added new claims, Claims 58-59. Claims 31-35, 41, and 43-59 are pending. Election/Restrictions Applicant has elected without traverse the invention of Group II, claims 17-26, directed to a composition for gene delivery recombinant adeno-associated virus (rAAV). Within Group II, Applicant has elected the following species, wherein: i) the target sequence comprises “at least two target sequences specific for miR-183”. Newly submitted Claim 59 is directed to an invention that is independent or distinct from the invention originally claimed for the following reasons: the claim is directed to non-elected Group II-V method. Since applicant has received an action on the merits for the originally presented invention, this invention has been constructively elected by original presentation for prosecution on the merits. Accordingly, Claim 59 is withdrawn from consideration as being directed to a non-elected invention. See 37 CFR 1.142(b) and MPEP § 821.03. To preserve a right to petition, the reply to this action must distinctly and specifically point out supposed errors in the restriction requirement. Otherwise, the election shall be treated as a final election without traverse. Traversal must be timely. Failure to timely traverse the requirement will result in the loss of right to petition under 37 CFR 1.144. If claims are subsequently added, applicant must indicate which of the subsequently added claims are readable upon the elected invention. Should applicant traverse on the ground that the inventions are not patentably distinct, applicant should submit evidence or identify such evidence now of record showing the inventions to be obvious variants or clearly admit on the record that this is the case. In either instance, if the examiner finds one of the inventions unpatentable over the prior art, the evidence or admission may be used in a rejection under 35 U.S.C. 103 or pre-AIA 35 U.S.C. 103(a) of the other invention. Claims 31-35, 41, and 43-58 are pending and under examination. Priority This application is a continuation of PCT/US2019/067872 filed on December 20, 2019. This application is claiming the benefit under 35 U.S.C. 119(e) of prior-filed provisional applications 62/783,956, filing date 12/21/2018; 62/924,970 filing date 10/23/2019 and 62/934,915 filing date 11/13/2019 Thus, the earliest possible priority for the instant application is December 21, 2018. Information Disclosure Statement Applicant has filed an Information Disclosure Statement on May 20, 2026 that has been considered. The information disclosure statement filed May 20, 2026 fails to comply with the provisions of 37 CFR 1.97, 1.98 and MPEP § 609 because 37 CFR 1.98(b) requires that each item of information in an IDS be identified properly. Each publication must be identified by publisher, author (if any), title, relevant pages of the publication, and date and place of publication. The date of publication supplied must include at least the month and year of publication, except that the year of publication (without the month) will be accepted if the applicant points out in the information disclosure statement that the year of publication is sufficiently earlier than the effective U.S. filing date and any foreign priority date so that the particular month of publication is not in issue. See also MPEP 707.05(e) for electronic documents, including, but not limited to: (D) reference to the unique Digital Object Identifier (DOI) number, or other unique identification number, if known. NPL citations have been lined through for being defective of one or more requirements. The signed and initialed PTO Forms 1449 are mailed with this action. Specification 1. The prior objection to the specification is withdrawn in light of Applicant’s amendment to accompany the trade names or marks used in commerce by their generic terminology. Claim Objections 2. Claim 31 is objected to because of the following informalities: Where a claim sets forth a plurality of elements or steps, each element or step of the claim should be separated by a line indentation, 37 CFR 1.75(i). See MPEP §608.01(m). The multiple ‘wherein’ clauses should be separated by line indentation. Appropriate correction is required. 3. Claim 44 is objected to because of the following informalities: The claim is internally redundant per the phrase, “the the miR-183” (last line). Appropriate correction is required. 4. Claim 58 is objected to because of the following informalities: The claim is grammatically awkward for being a run-on sentence, and per the multiple “and” clauses lacking punctuation. Where a claim sets forth a plurality of elements or steps, each element or step of the claim should be separated by a line indentation, 37 CFR 1.75(i). See MPEP §608.01(m). The multiple structural limitations recited in the ‘and’ clauses should be separated by line indentation. Appropriate correction is required. Claim Rejections - 35 USC § 101 5. The prior rejection of Claim 43 under 35 U.S.C. 101 is withdrawn in light of Applicant’s amendment to the claim to recite wherein the miR-183 target sequence comprises no more than 1 mismatch, which the Examiner finds persuasive. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 6. The prior rejection of Claim(s) 31-35 and 43 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to Claim 31 to recite wherein the two miR-target sequences comprise a consecutive region of nucleotides complementary to the miR-183 seed sequence, which the Examiner finds persuasive. 7. The prior rejection of Claim 41 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to the claim to recite wherein the two miR-target sequences comprise at least 6 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence, which the Examiner finds persuasive. 8. The prior rejection of Claim(s) 43-57 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, is withdrawn in light of Applicant’s amendment to the claims cancelling recitation of “full-length”, and instead to recite “the miR-183 seed sequence”, which the Examiner finds persuasive. 9. The prior rejection of Claim 43 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to the claim to recite wherein the miR-183 target sequence comprises no more than 1 mismatch, which the Examiner finds persuasive. 10. The prior rejection of Claim(s) 44-57 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to Claim 44 to recite wherein the miR-183 target sequence comprises 12-28 nucleotides, and at least 6 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence, which the Examiner finds persuasive. 11. The prior rejection of Claim(s) 52 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s cancellation of “consist of”, which the Examiner finds persuasive. 12. The prior rejection of Claim(s) 56 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s cancellation of embodiment (b), which the Examiner finds persuasive. 13. The prior rejection of Claim(s) 55 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, is withdrawn in light of Applicant’s argument that the term “artificial cerebrospinal fluid” was known in the art as of the effective filing date of the instant application, which the Examiner finds persuasive. 14. Claims 31-35, 41, 43-56, and 58 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 31, 41, 44, and 58 recite the phrase “the miR-183 seed sequence”. The phrase “the miR-183 seed sequence” is a relative term which renders the claim indefinite. The term “the miR-183 seed sequence” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Applicant argues that the specification discloses the seed sequence may be at least (no upper limit) 7 or 8 nucleotides in length (e.g. pg 10, lines 11-17): In certain embodiments, the length of the seed sequence is no less than about 30% of the length of the miRNA sequence, which may 15 be at least 7 nucleotides to about 28 nucleotides in length, at least 8 nucleotides to about 28 nucleotides in length, 7 nucleotides to 28 nucleotides, 8 nucleotides to 18 nucleotides, 12 nucleotides to 28 nucleotides in length, about 20 to about 26 nucleotides, about 22 nucleotides, about 24 nucleotides, or about 26 nucleotides. A claim may be rendered indefinite by reference to an object, to wit, a miR-183 seed sequence that is about 7 to 26 nucleotides in length, that is variable. (MPEP §2173.05(b)). While this paragraph speaks to the length(s), it does not speak to the nucleotide sequence(s) of the miR-183 seed sequence. Claim 58 is confusing because if, per Applicant’s argument, the miR-183 sequence may be as many as 28 nucleotides in length, then recitation of “at least 20 nucleotides” and “at least 8 consecutive nucleotides” are discordant with “comprises the miR-183 seed sequence”. The claim is indefinite because the metes and bounds of the claimed structure is unclear. Furthermore, Applicant’s argued seed sequence definition on pg 10, lines 11-17 is discordant with the 7 nucleotide GTGCCAT miR-183 seed sequence disclosed on pg 12, lines 26-27 (“the miR-183 seed sequence is underlined”). A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)). Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999). The phrase “the miR-183 seed sequence” is indefinite because the specification does not clearly redefine the term. If there are multiple miR-183 seed sequence definitions, including variable nucleotide sequences and lengths, yet each yields a different structure(s) from which the recited % complementarity is to be determined, then the claim may be indefinite because it is unclear which miR-183 “seed” nucleotide sequence and length is to be used to determine infringement. The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent. Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). The Examiner suggests amending independent Claims 31 and 44 to recite ‘a consecutive region of nucleotides complementary to the miR-183 seed sequence GTGCCAT’, for example. 15. Claim(s) 31-35, 41, and 43-58 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 31 has been amended to recite the phrase “an AAV capsid which transduces a cell for delivery of the vector genome and a dorsal root ganglia (DRG) cell”. Claim 44 has been amended to recite the phrase “an AAV capsid which transduces a cell for delivery of the vector genome and a dorsal root ganglia (DRG) cell”. As a first matter, a broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claims 31 and 44 recite the broad recitation a cell for delivery of the vector genome, and the claim also recites a dorsal root ganglia (DRG) cell which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. As a second matter, the term “a cell for delivery of the vector genome” in Claims 31 and 44 is a relative term which renders the claim indefinite. The term “a cell for delivery of the vector genome” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The phrase “a cell for delivery of the vector genome” is considered an arbitrary and subjective determination. The claims fail to recite, and the specification fails to disclose those cells that is/are not “for delivery of the vector genome”, as opposed to those cells that is/are “for delivery of the vector genome”. As a third matter, the phrase “an AAV capsid which transduces a cell for delivery…” renders the claim indefinite because the referenced cell is itself variable. A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)). If there are multiple target cells, yet each yields a different AAV capsid structure(s) and transduction ability, then the claim may be indefinite because it is unclear which cell is to be used to determine infringement. The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent. Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Response to Arguments Applicant argues that cancellation of the term “targeted” renders the prior rejection moot. Applicant’s argument(s) has been fully considered, but is not persuasive. Applicant’s amendment does nothing to address the substantive issues of the rejection regarding the phrase “a cell for delivery of the vector genome”. Applicant argues that the ordinary artisan specifically selects an AAV capsid based on the cell type to which the rAAV vector genome is to be delivered, whereby the skilled artisan may not choose to also target dorsal root ganglia. Applicant’s argument(s) has been fully considered, but is not persuasive. Applicant’s arguments do not clarify the record, nor overcome, the first (broad/narrow), second (arbitrary and subjective), and third (variable reference(s)) issues discussed in the rejection. 16. Claim(s) 31-35, 41, and 43-58 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The Examiner incorporates herein the above AAV capsid 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection. In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000). The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997). The claims are broad for reasonably encompassing an enormously vast genus of structurally undisclosed AAV capsids that have the functional property of transducing an enormously vast genus of structurally undisclosed target cells “for delivery of the vector genome” and a dorsal root ganglia (DRG) cell. As discussed above, the phrase “a cell targeted for delivery of the vector genome” is considered an arbitrary and subjective determination. The claims fail to recite, and the specification fails to disclose those cells that is/are not “for delivery of the vector genome”, as opposed to those cells that is/are “for delivery of the vector genome”. The phrase “an AAV capsid which transduces a cell for delivery…” renders the claim indefinite because the referenced cell is itself variable. The claims are broad for reasonably encompassing an enormous genus of human and non-human animals, including mammals (e.g. pg 1, line 25, “animals and humans”). The claims are broad for encompassing about 1,000,000 species of animals (Kingdoms of Life, waynesword.palomar.edu/trfeb98.htm, last visited April 8, 2021), wherein the mammalian sub-genus reasonably encompasses some 6,400 species (including humans), distributed in about 1,200 genera, about 152 families and about 29 orders (Mammal, en.wikipedia.org/wiki/Mammal, last visited August 31, 2022). Wikipedia (List of distinct cell types in the human body; last accessed June 13, 2024) teaches that there at least 1000 different cell types with different anatomical locations and functions just within the human body. A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)). If there are multiple target cells, yet each yields a different AAV capsid structure(s) and transduction ability, then the claim may be indefinite because it is unclear which target cell is to be used to determine infringement. The specification discloses AAV capsids such as AAV1, 2, 3, 4, 5, 6, 6.2, 7, 8, 8b, 9, rh10, hu37, 7M8, and Anc80 (e.g. pg 24, lines 1-3) and discloses an AAV9 capsid and an AAVhu68 capsid that is able to transduce DRG cells (e.g. pg 80, Example 6). The specification discloses the capsid may have an amino acid sequences as little as 70% identity relative to a reference sequence (e.g. pg 24, lines 11-12), e.g. the AAV9 capsid of SEQ ID NO:17, which is 736 amino acids in length. Thus, the claims encompass as many as 221 amino acid substitutions, insertions, and/or deletions. 20^221 = about 3x10^287 structurally and functionally undisclosed AAV capsid variants. (calculator.net/exponent-calculator.html; last visited July 30, 2025) The claims fail to recite, and the specification fails to disclose, the structure/function nexus between the enormously vast genus of about 3x10^287 structurally and functionally undisclosed AAV capsid variants that necessarily and predictably have the functional properties of transducing the enormously vast genus of structurally different target cells “for delivery of the vector genome” and/or DRG cells. At best, the specification supports two AAV capsid species that transduce, at least, DRG cells, to wit, an AAV9 capsid and an AAVhu68 capsid that is able to transduce DRG cells (e.g. pg 80, Example 6). A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”). Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) (“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). “A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed.” In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004) The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005). For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014) Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is’). In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017) At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper. At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352. An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5- 16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted). In the instant case, knowing that the initial AAV capsid is AAV9 or AAVhu68 does not tell you anything at all about the enormously vast genus of about 3x10^287 structurally and functionally undisclosed AAV capsid variants that necessarily and predictably have the functional properties of transducing the enormously vast genus of structurally different target cells “for delivery of the vector genome” and/or DRG cells. In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023)) “Amgen seeks to monopolize an entire class of things defined by their function”. “The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.” “It freely admits that it seeks to claim for itself an entire universe of antibodies.” In the instant case, the record reflects that the claims encompass an enormously vast genus of about 3x10^287 structurally and functionally undisclosed AAV capsid variants that necessarily and predictably have the functional properties of transducing the enormously vast genus of structurally different target cells “for delivery of the vector genome” and/or DRG cells. “They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475. This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966). “Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”. While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”. “Amgen offers persons skilled in the art little more than advice to engage in “trial and error”. “The more a party claims for itself the more it must enable.” “Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same. The only AAV capsid species disclosed is AAV9 or AAVhu68. Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph. MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc) Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Response to Arguments Applicant argues that there is no undue experimentation to determine if the capsid selected for a specific target cell is also capable of transducing a dorsal root ganglia cell. Applicant’s argument(s) has been fully considered, but is not persuasive. The only AAV capsid species disclosed is AAV9 or AAVhu68. The record reflects that the claims encompass an enormously vast genus of about 3x10^287 structurally and functionally undisclosed AAV capsid variants that necessarily and predictably have the functional properties of transducing the enormously vast genus of structurally different target cells “for delivery of the vector genome” and/or DRG cells. “They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475. This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966). “Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”. While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”. “Amgen offers persons skilled in the art little more than advice to engage in “trial and error”. “The more a party claims for itself the more it must enable.” “Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same. 17. Claim(s) 31-35, 41, 44-56, and 58 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claim 31 has been amended to recite a nucleic acid encoding at least two miRNA target sequences specific for miR-183, wherein the at least two miRNA target sequences for miR-183 comprise: i) at least 12-28 nucleotides in length [structure]; and ii) a consecutive region of nucleotides complementary to the miR-183 seed sequence [structure]; and having the functional property of specifically binding to a miR-183 in dorsal root ganglia [function], thereby repressing expression of the gene product in dorsal root ganglia [function]. While the specification discloses “a consecutive region” may be 7 or 8 nucleotides (e.g. pg 11, line 5), the phrase is not actually defined in the specification. Thus, the breadth of the phrase “a consecutive region” is considered to minimally require at least 2 consecutive nucleotides. Claim 41 has been amended to recite wherein the miR-183 target sequence comprises: i) at least 12-28 nucleotides in length [structure]; and ii) at least 6 consecutive nucleotides 100% complementary to the miR-183 seed sequence [structure]; and having the functional property of specifically binding to a miR-183 in dorsal root ganglia [function], thereby repressing expression of the gene product in dorsal root ganglia [function]. Claim 44 has been amended to recite a nucleic acid encoding at least four miRNA target sequences [structure] to repress expression of the gene product in dorsal root ganglia [function], wherein the at least four miRNA target sequences comprise at least two miRNA target sequences specific for miR-183 comprise: i) at least 12-28 nucleotides in length [structure]; and ii) a consecutive region of 6 nucleotides 100% complementary to the miR-183 seed sequence [structure]; and having the functional property of specifically binding to a miR-183 in dorsal root ganglia [function]. Claim 56 has been amended to recite wherein the miRNA target sequences specific for miR-183 comprises: i) at least 12-28 nucleotides in length [structure]; and ii) at least 12 consecutive nucleotides 100% complementary to the miR-183 seed sequence [structure]; and having the functional property of specifically binding to a miR-183 in dorsal root ganglia [function]. The Examiner incorporates herein the above miR-183 seed sequence 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection. There is a lack of adequate written description regarding the nexus of the enormous genus of structurally and functionally undisclosed miR-183 target sequences that necessarily and predictably have the functional properties of specifically binding miR-183, thereby repressing expression of the gene product in dorsal root ganglia. Claim 35 recites a miR-182 target sequence at a high level of generality. There is a lack of adequate written description regarding the nexus of the enormous genus of structurally undisclosed miRNA target sequences that necessarily and predictably have the functional properties of specifically binding miR-182. In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000). The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997). The claims are broad for reasonably encompassing an enormously vast genus of structurally undisclosed miRNA target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia. The claims are broad for reasonably encompassing an enormously vast genus of structurally undisclosed miRNA target sequences that necessarily and predictably have the functional properties of specifically binding miR-183 or miR-182, respectively. The specification discloses the miR target sequence need only have “partial complementarity to the miRNA seed sequence with some mismatches” (e.g. pg 11, lines 7-8), e.g. only about 80% complementarity (e.g. pg 14, line 24) and/or having as many as 10 mismatches (e.g. pg 14, line 18). The term "comprising" or “comprises” (Claims 31, “miR-target sequences comprises (no upper limit)”; Claim 44, “miR-183 target sequence each comprising (no upper limit)”; Claim 56, “miR-183 target sequence that comprises (no upper limit)”; Claim 58, “at least 20 nucleotides in length (no upper limit) and comprises (no upper limit)”) is/are open-ended and allows for additional, unrecited elements in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements, e.g. the presence of one or more (no upper limit) additional nucleotides. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Instead, see Claim 41 that limits the miR-183 target sequence to 12-28 nucleotides in length. The claims encompass miRNA target sequences having a minimal length of at least: 56 (28+28) nucleotides (Claim 31); 40 (28+12) nucleotides (Claim 56); and/or 34 (28+6) nucleotides (Claims 41 and 44). While it is clear that the miR-183 target sequence is to comprise at least 2 consecutive nucleotides 100% complementary to a miR-183 seed sequence, the term “target” is broader in scope than, and not synonymous with, “seed”. The claims do not require the miRNA target sequence to comprise a sequence 100% complementary to the miR-183 seed sequence, nor 100% complementary to the miR-182 seed sequence. (4)^34 = 3x10^20 structurally and functionally undisclosed nucleic acid sequences. (4)^40 = 1x10^24 structurally and functionally undisclosed nucleic acid sequences. (4)^56 = 5x10^33 structurally and functionally undisclosed nucleic acid sequences. The specification discloses the miRNA target sequence may be as large as 7, 10, 12, 20, 22, 24, 26, or 28 nucleotides in length (e.g. pg 10, lines 15-18). (4)^7 = 1x10^4 structurally and functionally undisclosed nucleic acid sequences. (4)^10 = 1x10^6 structurally and functionally undisclosed nucleic acid sequences. (4)^12 = 1x10^7 structurally and functionally undisclosed nucleic acid sequences. (4)^20 = 1x10^12 structurally and functionally undisclosed nucleic acid sequences. (4)^22 = 2x10^13 structurally and functionally undisclosed nucleic acid sequences. (4)^24 = 3x10^14 structurally and functionally undisclosed nucleic acid sequences. (4)^26 = 4x10^15 structurally and functionally undisclosed nucleic acid sequences. (4)^28 = 7x10^16 structurally and functionally undisclosed nucleic acid sequences. (https://www.calculator.net/exponent-calculator.html; last visited February 20, 2025) Thus, the claims encompass an enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^14, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR-183 target nucleic acid sequences and/or miR-182 target nucleic acid sequences. The claims are broad for encompassing embodiments such as: xx[nn]xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxx[nn]xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx[nn]xxxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx[nn]xxxxxxxxxxxxxxx; xxxxxxxxxxxx[nn]xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxxx[nn]xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx[nn]xxxxxxx, for example. While it is clear that Claim 31 requires at least 2 consecutive nucleotides ([nn], above) to be 100% complementary to the miR-183 seed sequence, the art does not teach, and the specification fails to disclose, that the presence of just 2 nucleotides 100% complementary to the miR-183 seed sequence is dispositive of and/or controlling for the enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^14, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR-183 target nucleic acid sequences ranging from 7 to 56 nucleotides in length to thereby necessarily and predictably have the functional properties of specifically binding miR-183 [function 1] and repressing expression of the gene product in dorsal root ganglia [function 2]. Claims 41 and 44 require at least 6 consecutive nucleotides 100% complementary to the miR-183 seed sequence. Claim 44 is broad for encompassing miR-183 target sequence embodiments up to 56 nucleotides in length, such as: xx[nnnnnn]xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxx[nnnnnn]xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx[nnnnnn]xxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx[nnnnnn]xxxxxxxxx; xxxxxxxxxxxx[nnnnnn]xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxxx[nnnnnn]xxxxxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx[nnnnnn]x, for example. Claim 56 requires at least 6 consecutive nucleotides 100% complementary to the miR-183 seed sequence and at least 6 more consecutive nucleotides 100% complementary (cc) to the miR-183 sequence, for a total of 12 consecutive nucleotides (6+6) 100% complementary to the miR-183 sequence Claim 56 is broad for encompassing miR-183 target sequence embodiments up to 56 nucleotides in length, such as: xxxxxxxxxxxxxxxxxxcc[nnnnnn]ccccxxxxxxxxxxxxxxxxxxxxxxxxxx; xxxxcccccc[nnnnnn]xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxxxxxxccc[nnnnnn]cccxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccccc[nnnnnn]cxxxxxxxx; xxxx[nnnnnn]ccccccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxc[nnnnnn]cccccxxxxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcccc[nnnnnn]ccxxx, for example. While it is clear that Claim 56 requires at least 12 consecutive nucleotides to be 100% complementary to the miR-183 sequence, at least 6 of which ([nnnnnn], above) are to be 100% complementary to the miR-183 seed sequence, the art does not teach, and the specification fails to disclose, that the presence of just 12 nucleotides 100% complementary to the miR-183 sequence is controlling for the enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^14, 2x10^13, 1x10^12, and/or 1x10^7 structurally and functionally undisclosed miR-183 target nucleic acid sequences ranging from 12 to 56 nucleotides in length to thereby necessarily and predictably have the functional properties of specifically binding miR-183 [function 1] and repressing expression of the gene product in dorsal root ganglia [function 2]. Claim 41 is broad for encompassing miR-183 target sequence embodiments up to 28 nucleotides in length, such as: xx[nnnnnn]xxxxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxx[nnnnnn]xx; xxxxxxx[nnnnnn]xxxxxxxxxxxxxxx; xxxxxxxxxxxxx[nnnnnn]xxxxxxxxx; xxxx[nnnnnn]xxxxxxxxxxxxxxxxxx; xxxxxxxxxxxxxxxxxxxxx[nnnnnn]x; xxxxxxxxxxxxxxxxxx[nnnnnn]xxxx, for example. While it is clear that Claims 41 and 44 requires at least 6 consecutive nucleotides ([nnnnnn], above) to be 100% complementary to the miR-183 seed sequence, the art does not teach, and the specification fails to disclose, that the presence of just 6 nucleotides 100% complementary to the miR-183 seed sequence is controlling for the enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^14, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR-183 target nucleic acid sequences ranging from 7 to 56 nucleotides in length to thereby necessarily and predictably have the functional properties of specifically binding miR-183 [function 1] and repressing expression of the gene product in dorsal root ganglia [function 2]. Claim 58 is confusing and indefinite because the metes and bounds of the claimed structure is unclear. See the above miR-183 seed sequence 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection. Krol et al (2010; of record) taught the mature miR-183 is 22 nucleotides in length, wherein the miR-183 seed sequence is only 7 nucleotides, to wit, AUGGCAC (Figure 1b). See also Fogerty et al (2019; of record; Figure 1b). Instant specification discloses the miR-183 seed sequence is GTGCCAT (e.g. pg 12, lines 26-27, “the miR-183 seed sequence is underlined”). Claim 57 recites the reverse-complement, GTGCCAT, present in SEQ ID NO:1. The art uses miR-183 target sites of 22 nucleotides in length that are perfectly complementary to the entirety of the mature miR-183 oligonucleotide of 22 nucleotides, but for a central bulge of 3 nucleotides to prevent cleavage of the sponge RNA (e.g. Krol et al, Methods; Figure 1c). Rather, the only miR-183 target species demonstrated to have the recited functional properties is SEQ ID NO:1, recited in Claim 57. Similarly, the only miR-182 target species demonstrated to have the recited functional properties is SEQ ID NO:2, recited in Claim 57. The claims fail to recite, and the specification fails to disclose, the enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of: i) specifically binding miR-183 [function 1]; and ii) repressing expression of the gene product in dorsal root ganglia [function 2]. The claims fail to recite, and the specification fails to disclose, the enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of: i) specifically binding miR-182 [function 1]; and ii) repressing expression of the gene product in dorsal root ganglia [function 2]. The claims fail to recite, and the specification fails to disclose, how to transform or otherwise modify a first miRNA target sequence of the enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that does not necessarily and predictably have the functional properties of: i) specifically binding miR-183 [function 1]; and ii) repressing expression of the gene product in dorsal root ganglia [function 2], into a second miRNA target sequence of the enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that now necessarily and predictably has the functional properties of repressing expression of the gene product in dorsal root ganglia. The claims fail to recite, and the specification fails to disclose, how to transform or otherwise modify a first miRNA target sequence of the enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that does not necessarily and predictably have the functional properties of: i) specifically binding miR-182 [function 1]; and ii) repressing expression of the gene product in dorsal root ganglia [function 2], into a second miRNA target sequence of the enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that now necessarily and predictably has the functional properties of repressing expression of the gene product in dorsal root ganglia. Before the effective filing date of the claimed invention, it was known in the art that “MicroRNA is a single-stranded RNA molecule of 21-25 nucleotides, which regulates gene expression in eukaryotes. Specifically, it is known to bind to 3' UTR (untranslated region) of mRNA for a specific gene to inhibit its translation. All the animal microRNAs studied heretofore decrease protein expression without affecting the level of mRNA for a specific gene.” (Park et al., US Pub. 2010/0240058, paragraph [0002]; of record). Additionally, Park et al. discloses “microRNA is attached to RISC (RNA-induced silencing complex) to complementarily bind with a specific mRNA, but the center of microRNA remains mismatched, so it does not degrade mRNA, unlike conventional siRNAs” (paragraph [0003]) and that “pre-miRNA is transported into cytoplasm and cleaved by an enzyme, Dicer, finally to form mature microRNA of 21-25 nucleotides” (paragraph [0005]). Additionally, Fogerty et al., (2019; Sci. Rep. 9, 10302; pp. 1-15; of record), discloses that the RISC complex facilitates mRNA targeting, typically within its 3′ untranslated region (page 1, para 1). Thus, the prior art support binding of endogenous expression of mature microRNA (miR) 183 complex to the miR183 sequence target of SEQ ID NO: 1 within the 3′ untranslated region of the transgene messenger RNA, e.g., GFP, for the transgene-derived mRNA for ablating transgene expression in DRG neurons. Post-filing art by inventors, Hordeaux et al., (2020, Sci. Transl. Med. Pp. 1-14; of record IDS filed on 1/18/2021) states “cloning miRNA targets that are solely expressed in DRG neurons into the 3′ untranslated regions (UTRs) of the transgene (fig. S2B). Any mRNA expressed from the vector would be destroyed by the endogenously expressed miRNA” and that the miRNA183 cluster containing three miRNAs (96, 182, and 183), all expressed from a polycistronic pri-miRNA is specifically expressed in DRG and conserved across species, e.g., (see miRBase trackers for miR183: MI0000273, MI0003084, and MI0000225; miR182: MI0000272, MI0000224, MI0002815 (page 1, column). Thus, post-filing art by inventors supports the specific miR target sequences comprising the full length of SEQ ID NOS: 1 and 2. Hordeaux et al does not teach other miR183 target sequences of an undisclosed number of nucleotides that are effective at binding the endogenous expression of microRNA (miR) 183 complex to reduce transgene expression and toxicity in DRG. In relation to four repeat concatemers of the target miRNA sequences in the 3′ untranslated region of the mRNA of the transgene, Hordeaux et al., teaches that “the redundancy of the of the miR183 cluster with common targets for miR183, 182, and 96 may decrease this theoretical risk [toxicity limited to heavily transduced cells that express miR183 (DRGs)], as suggested in complete cluster versus single miRNA knockout models”. Indeed , Fogerty et al., (2019; Sci. Rep. 9, 10302; pp. 1-15; of record IDS filed on 12/31/2020), teaches that in the retina, the three mir-183/96/182 in the cluster are ultimately required in photoreceptors and a single miRNA from the cluster compensates for the loss of another (abstract), where loss of one of the three miRNA impairs function in mice differently, for example, “In mice, the loss of miR-183 and miR-96 in addition to miR-182 produces a more severe retinal phenotype than loss of miR-182 alone but the contribution of each miRNA remains unclear” (page 3, para 5). Moreover, Fogerty et al., discloses that in zebrafish several mutants of the cluster mir-183/96/182 lead to reduced expression (“It is notable that the mir-96 mutation in the mir-96lri60 and mir-96/182lri79 alleles, which is a net insertion of only 2 nucleotides and decreased expression by 90 percent and 88 percent, respectively, was nearly as disruptive as the much larger mir-182lri61 mutation (11bp deletion)” (page 4; para.1). Thus, the prior art supports the relevance of the redundancy of the of the miR183 cluster to preserve the cluster’s structure/function and prevent components from being lost (page 8, last paragraph) and the critical full length of SEQ ID NO:1 where single point mutations result in reduced activity. Rather, the only species disclosed is: i) the miR-183 target sequence of SEQ ID NO:1, as recited in Claim 57; and ii) the mirR-182 target sequence of SEQ ID NO:2, as recited in Claim 57. Recently, the U.S. Court of Appeals for the Federal Circuit (Federal Circuit) decided Amgen v. Sanofi, 872 F.3d 1367 (Fed. Cir. 2017), which concerned adequate written description for claims drawn to antibodies. These claims are usually handled in Technology Center 1600. The Federal Circuit explained in Amgen that when an antibody is claimed, 35 U.S.C. § 112(a) requires adequate written description of the antibody itself. Amgen, 872 F.3d at 1378-79. The Amgen court expressly stated that the so-called "newly characterized antigen" test, which had been based on an example in USPTO-issued training materials and was noted in dicta in several earlier Federal Circuit decisions, should not be used in determining whether there is adequate written description under 35 U.S.C. § 112(a) for a claim drawn to an antibody. Citing its decision in Ariad Pharmaceuticals, Inc. v. Eli Lilly & Co., the court also stressed that the "newly characterized antigen" test could not stand because it contradicted the quid pro quo of the patent system whereby one must describe an invention in order to obtain a patent. Amgen, 872 F.3d at 1378-79, quotingAriad Pharmaceuticals, Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1345 (Fed. Cir. 2010). In view of the Amgen decision, adequate written description of a newly characterized antigen alone should not be considered adequate written description of a claimed antibody to that newly characterized antigen, even when preparation of such an antibody is routine and conventional. Id. The Amgen decision will be added to the MPEP in due course. A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”). Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) (“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). “A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed.” In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004) The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005). For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014) Since the genetic code is widely known, a disclosure of an amino acid sequence would provide sufficient information such that one would accept that an inventor was in possession of the full genus of nucleic acids encoding a given amino acid sequence, but not necessarily any particular species. Cf. In re Bell, 991 F.2d 781, 785, 26 USPQ2d 1529, 1532 (Fed. Cir. 1993) and In re Baird, 16 F.3d 380, 382, 29 USPQ2d 1550, 1552 (Fed. Cir. 1994). Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function ... does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is’). In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017) At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper. At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352. An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5- 16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted). In the instant case, knowing that the initial nucleic acid sequence is to bind a miRNA, or, even more specifically miR-183 or miR-182, does not tell you anything at all about the structure (nucleic acid sequences) of the enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, nor are specific for miR-183, nor are specific for miR-182. In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023)) “Amgen seeks to monopolize an entire class of things defined by their function”. “The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.” “It freely admits that it seeks to claim for itself an entire universe of antibodies.” In the instant case, the record reflects that the claims encompass an enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, nor are specific for miR-183, nor are specific for miR-182. “They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475. This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966). “Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”. While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”. “Amgen offers persons skilled in the art little more than advice to engage in “trial and error”. “The more a party claims for itself the more it must enable.” “Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same. The only species disclosed is: i) the miR-183 target sequence of SEQ ID NO:1, as recited in Claim 57; and ii) the mirR-182 target sequence of SEQ ID NO:2, as recited in Claim 57. Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph. MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc) Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Response to Arguments Applicant argues that the miRNA target sequence is both structurally and functionally disclosed. Applicant’s argument(s) has been fully considered, but is not persuasive. Applicant’s argument is not on point. The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997). In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023)) “Amgen seeks to monopolize an entire class of things defined by their function”. “The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.” “It freely admits that it seeks to claim for itself an entire universe of antibodies.” In the instant case, the record reflects that the claims encompass an enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, nor are specific for miR-183, nor are specific for miR-182. “They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475. This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966). “Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”. While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”. “Amgen offers persons skilled in the art little more than advice to engage in “trial and error”. “The more a party claims for itself the more it must enable.” “Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same. The only species disclosed is: i) the miR-183 target sequence of SEQ ID NO:1, as recited in Claim 57; and ii) the mirR-182 target sequence of SEQ ID NO:2, as recited in Claim 57. Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph. MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc) Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). 18. Claim(s) 31-35, 41, 44-56, and 58 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, while being enabling for the miR-183 target sequence of SEQ ID NO:1 and the mirR-182 target sequence of SEQ ID NO:2, does not reasonably provide enablement for an enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, and are specific for miR-183, or are specific for miR-182, respectively. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to practice the invention commensurate in scope with these claims. The Examiner incorporates herein the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, written description rejection. Per In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023)), the claims do not satisfy 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, written description and enablement requirements. Response to Arguments Applicant argues that the ordinary artisan can generate an rAAV vector comprising the at least two miR-183 targeting sequences without undue experimentation. Applicant’s argument(s) has been fully considered, but is not persuasive. Applicant’s argument is not on point. The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997). In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023)) “Amgen seeks to monopolize an entire class of things defined by their function”. “The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.” “It freely admits that it seeks to claim for itself an entire universe of antibodies.” In the instant case, the record reflects that the claims encompass an enormously vast genus of about 5x10^33, 1x10^24, 3x10^20, 7x10^16, 4x10^15, 3x10^4, 2x10^13, 1x10^12, 1x10^7, 1x10^6, and/or 1x10^4 structurally and functionally undisclosed miR target sequences that necessarily and predictably have the functional properties of repressing expression of the gene product in dorsal root ganglia, nor are specific for miR-183, nor are specific for miR-182. “They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475. This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966). “Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”. While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”. “Amgen offers persons skilled in the art little more than advice to engage in “trial and error”. “The more a party claims for itself the more it must enable.” “Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same. The only species disclosed is: i) the miR-183 target sequence of SEQ ID NO:1, as recited in Claim 57; and ii) the mirR-182 target sequence of SEQ ID NO:2, as recited in Claim 57. Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description and enablement under 35 U.S.C. 112, first paragraph. MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc) Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s). Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. 19. Claim(s) 31-33, 35, 41, 43-44, 47-48, 50, 52, and 58 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Krol et al (2010; of record), as evidenced by Mason et al (2010; of record). With respect to Claims 31 and 44, Krol et al is considered relevant prior art for having taught a rAAV virus (e.g. pg 629, col. 2, Methods, “AAV2….viruses”; Figure 2F) whose genome comprises: a) a coding sequence for a gene product operably linked to regulatory sequences which control expression of the gene product in a cell containing the vector genome; and b) at least four miR-183 target sequences and at least four miR-182 target sequences in the coding sequence 3’ UTR (Figure 2F). Krol et al taught wherein the miR-183 target sequence is about 21 nucleotides in length and comprises a nucleotide sequence of at least 7consecutive nucleotides that are 100% complementary to the 7-nucleotide miR-183 seed sequence (e.g. Figure S3c, S3f). Krol et al do not teach wherein the miR-183 target sequences result in repressed expression of the gene product in the dorsal root ganglia. However, "Products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art product comprising four miR-183 target sites and/or four miR-182 target sites does not inherently possess the same properties as the instantly claimed product. Mason et al evidence that the AAV2 virus Krol et al is capable of tranducing dorsal root ganglia cells (e.g. Figure 4a-c). With respect to Claim 32, Krol et al taught wherein the vector genome comprises four target sequences specific for miR-183 (Figure 2F). With respect to Claim 33, Krol et al taught wherein the vector genome comprises four target sequences specific for miR-183 in the 3’ UTR of the coding sequence (Figure 2F). With respect to Claim 35, Krol et al taught wherein the vector genome comprises two target sequences specific for miR-183 and at least one target sequence specific for miR-182. (Figure 2F). With respect to Claims 41, 43, and 58, Krol et al taught wherein the miR-183 target sequence is about 21 nucleotides in length and comprises a nucleotide sequence of at least 6 consecutive nucleotides that are 100% complementary to the 7-nucleotide miR-183 seed sequence (e.g. Figure S3c, S3f). With respect to Claim 47, Krol et al taught wherein a spacer is located 3' to the first miRNA target sequence and/or 5' to the last miRNA target sequence. (Figure 2; Figure S3c). With respect to Claim 48, Krol et al do not teach the spacers to be different from each other, and thus are reasonably considered to be the same. With respect to Claim 50, Krol et al taught the miRNA sponge is placed about 15 nucleotides from the 3’ end of the gene coding sequence (Figure S3c). PNG media_image1.png 140 684 media_image1.png Greyscale With respect to Claim 52, Krol et al taught wherein the miRNA sponge comprises at least four miR target sequences and is about 432 nucleotides in length (12 spacers x 15nt each = 180nts) + (12 miR target sequences x 21 nucleotides each = 252nts). Thus, Krol et al anticipate the claims. Response to Arguments Applicant argues that Krol et al do not teach the rAAV encodes a therapeutic gene operably linked to the miR-183 target sequence. Applicant’s argument(s) has been fully considered, but is not persuasive. In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., therapeutic gene) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). The claims recite “gene product” at a high level of generality, for which the transgene of Krol et fulfills. Applicant argues that Krol et al only teach delivery of the rAAV to the retina. Applicant’s argument(s) has been fully considered, but is not persuasive. As a first matter, instant claims are directed to an AAV product, not a method of use. As a second matter, Mason et al evidence that the AAV2 virus Krol et al is capable of transducing dorsal root ganglia cells (e.g. Figure 4a-c). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 20. Claims 32-33, 35, 41, 43, 52, and 56-57 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Krol et al (2010; of record), as applied to Claims 31-33, 35, 41, 43-44, 47-48, 50, 52, and 58 above, and in further view of Li et al (November 14, 2014; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. Krol et al taught wherein the miR-183 target sequence is about 21 nucleotides in length and comprises a nucleotide sequence of at least 7 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence (e.g. Figure S3c, S3f). Krol et al taught the miR-183 target sequence (21nt) is 82% identical to the miR-183, differing only in the central bulge nucleotides (Figure S3f). Krol et al do not teach wherein the miR-183 target sequence is 100% identical or complementary to the miR-183. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 56-57, Li et al is considered relevant prior art for having taught a nucleic acid construct comprising a coding sequence of interest, wherein the 3’ UTR of said coding sequence comprises a miRNA sponge comprising at least four miR-183 target sequences (e.g. Figure S2). Li et al taught wherein the miR-183 target sequence is 100% complementary to the miR-183, including the central bulge nucleotides (upper line), and is 100% identical to instant SEQ ID NO:1 (lower line) (e.g. Figure S2b), as shown below: AGTGAATTCTTGGAGTGCCATA AGTGAATTCTACCAGTGCCATA Resolving the level of ordinary skill in the pertinent art. People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology and gene expression constructs. Therefore, the level of ordinary skill in this art is high. "A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396. Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first miR-183 target sequence that is 100% identical to the miR-183 binding sites, but for the central bulge, as taught by Krol et al, with a second miR-183 target sequence that is 100% identical to the miR-183 binding sites, including the central bulge, as taught by Li et al, in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first miR-183 target sequence that is 100% identical to the miR-183 binding sites, but for the central bulge, with a second miR-183 target sequence that is 100% identical to the miR-183 binding sites, including the central bulge, in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized and successfully reduced to practice the design of a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences that are 100% complementary to the miR-183 binding sequence. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claim 32, Krol et al taught wherein the vector genome comprises four target sequences specific for miR-183 (Figure 2F). Li et al taught wherein the vector genome comprises ten target sequences specific for miR-183 (Figure S2). With respect to Claim 33, Krol et al taught wherein the vector genome comprises four target sequences specific for miR-183 in the 3’ UTR of the coding sequence (Figure 2F). Li et al taught wherein the vector genome comprises four target sequences specific for miR-183 in the 3’ UTR of the coding sequence (Figure S2). With respect to Claim 35, Krol et al taught wherein the vector genome comprises two target sequences specific for miR-183 and at least one target sequence specific for miR-182. (Figure 2F). Li et al taught wherein the vector genome comprises two target sequences specific for miR-183 and at least one target sequence specific for miR-182. (Figure S2). With respect to Claims 41, 43, and 58, Krol et al taught wherein the miR-183 target sequence is about 21 nucleotides in length and comprises a nucleotide sequence of at least 6 consecutive nucleotides that are 100% complementary to the 7-nucleotide miR-183 seed sequence (e.g. Figure S3c, S3f). Li et al taught wherein the miR-183 target sequence is about 22 nucleotides in length and comprises a nucleotide sequence of at least 8 consecutive nucleotides that are 100% complementary to the miR-183 seed sequence (e.g. Figure S3c, S3f). With respect to Claim 52, Krol et al taught wherein the miRNA sponge comprises at least four miR target sequences and is about 432 nucleotides in length (12 spacers x 15nt each = 180nts) + (12 miR target sequences x 21 nucleotides each = 252nts). Li et al taught wherein the miRNA sponge comprises at least 30 miR target sequences and is about 660 nucleotides in length (30 miR target sequences x 22 nucleotides each = 660nts). In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). The specification fails to disclose an element of criticality for the instantly recited range. The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. Response to Arguments Applicant argues that Li et al do not cure the defect(s) of Krol et al. Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Krol et al are discussed above and incorporated herein. Applicant does not contest the teachings of Li et al as applied to the obviousness to substitute a first miR-183 target sequence that is 100% identical to the miR-183 binding sites, but for the central bulge, as taught by Krol et al, with a second miR-183 target sequence that is 100% identical to the miR-183 binding sites, including the central bulge, as taught by Li et al, in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first miR-183 target sequence that is 100% identical to the miR-183 binding sites, but for the central bulge, with a second miR-183 target sequence that is 100% identical to the miR-183 binding sites, including the central bulge, in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized and successfully reduced to practice the design of a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences that are 100% complementary to the miR-183 binding sequence. 21. Claims 33-34 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Krol et al (2010), as applied to Claims 31-33, 35, 41, 43-44, 47-48, 50, 52, and 58 above, and in further view of Gao et al (U.S. 2010/0186103; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. With respect to Claim 33, Krol et al taught wherein the vector genome comprises four target sequences specific for miR-183 in the 3’ UTR of the coding sequence (Figure 2F). Krol et al do not teach wherein the miR-183 target sequence is placed in 5’ UTR of the coding sequence. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 34, Gao et al is considered relevant prior art for having taught a nucleic acid expression constructs, including rAAV expression vectors, wherein the artisan’s nucleic acid coding sequence comprises a 5’ UTR and a 3’ UTR, and one or more miRNA binding sites (e.g. Abstract; [0031] miRNA sponge), and wherein the miRNA target sequences may be placed in the 5’ UTR or the 3’ UTR [0091]. Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a 3’ UTR comprising one or more miR-183 target sequences with a 5’ UTR comprising one or more miR-183 target sequences in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a 3’ UTR comprising one or more miR-183 target sequences with a 5’ UTR comprising one or more miR-183 target sequences in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized the scientific and technical design of nucleic acid vectors comprising a miRNA sponge, whereby the miRNA binding sites may be placed in the 5’ or 3’ UTR. It would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” The ordinary artisan would have immediately recognized that there are but 3 known options where the miRNA binding sites may be placed to regulate expression of the coding sequence: the 5’ UTR, the coding sequence itself, or the 3’ UTR, as disclosed by Gao et al [0091]. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. Response to Arguments Applicant argues that Gao et al do not cure the defect(s) of Krol et al. Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Krol et al are discussed above and incorporated herein. Applicant does not contest the teachings of Gao et al as applied to the obviousness to substitute a 3’ UTR comprising one or more miR-183 target sequences with a 5’ UTR comprising one or more miR-183 target sequences in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a 3’ UTR comprising one or more miR-183 target sequences with a 5’ UTR comprising one or more miR-183 target sequences in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized the scientific and technical design of nucleic acid vectors comprising a miRNA sponge, whereby the miRNA binding sites may be placed in the 5’ or 3’ UTR. 22. Claims 45, 47, and 49-52 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Krol et al (2010), as applied to Claims 31-33, 35, 41, 43-44, 47-48, 50, 52, and 58 above, and in further view of Vella et al (2004; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. With respect to Claim 47, Krol et al taught wherein a spacer is located 3' to the first miRNA target sequence and/or 5' to the last miRNA target sequence. (Figure 2; Figure S3c). Krol et al do not teach wherein the miR-183 target sequences are continuous and not separated by a spacer. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 45, Vella et al is considered relevant prior art for having taught a nucleic acid construct comprising a coding sequence of interest, wherein the 3’ UTR of said coding sequence comprises a miRNA sponge comprising at least four miRNA target sequences (e.g. Figure 1a). Vella et al taught wherein the miRNA target sequences are continuous and not separated by a spacer (e.g. 5, 3, 1 miR target sites) and/or are separated by a spacer (e.g. miR target site 2) (Figure 1a, constructs pMV1, pMV18). Resolving the level of ordinary skill in the pertinent art. People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology and gene expression constructs. Therefore, the level of ordinary skill in this art is high. "A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396. Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are each separated by a spacer with a second miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are continuous and not separated by a spacer in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a a miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are each separated by a spacer with a second miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are continuous and not separated by a spacer in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized the scientific and technical design of nucleic acid vectors comprising a miRNA sponge, whereby the miRNA binding sites may be continuous and not separated by a spacer and/or separated by a spacer, as successfully reduced to practice by Vella et al. It would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” The ordinary artisan would have immediately recognized that there are but 2 known options: spacer or no spacer, and both configurations had been successfully reduced to practice. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claim 49, Krol et al do not teach the spacers to comprise a miRNA target sequence. Krol et al taught the spacers are about 15 nucleotides in length. Vella et al taught wherein the miRNA target sequences are continuous and not separated by a spacer (e.g. 5, 3, 1 miR target sites) and/or are separated by a spacer (e.g. miR target site 2) (Figure 1a, constructs pMV1, pMV18). In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). The specification fails to disclose an element of criticality for the instantly recited range of 1-10 nucleotides, as opposed to lack of a spacer (syn. 0 nucleotides) and/or as opposed to the about 15 nucleotides of Krol et al. With respect to Claim 50, Krol et al taught the miRNA sponge is placed about 15 nucleotides from the 3’ end of the gene coding sequence (Figure S3c). Vella et al taught wherein the miRNA sponge is placed immediately downstream from the 3’ end of the gene coding sequence (Figure 1a). In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). The specification fails to disclose an element of criticality for the instantly recited range. With respect to Claim 52, Krol et al taught wherein the miRNA sponge comprises at least four miR target sequences and is about 432 nucleotides in length (12 spacers x 15nt each = 180nts) + (12 miR target sequences x 21 nucleotides each = 252nts). Vella et al taught wherein the miRNA sponge comprises at least 450-500 nucleotides (e.g. Figure 1a, pFS1030, pFS1031). In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). The specification fails to disclose an element of criticality for the instantly recited range. With respect to Claim 51, Vella et al taught wherein the miRNA sponge may comprise a miRNA target site placed about 400nt from the 3’ end of the gene coding sequence (Figure 1a, miR site 4). In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). The specification fails to disclose an element of criticality for the instantly recited range. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). Response to Arguments Applicant argues that Vella et al do not cure the defect(s) of Krol et al. Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Krol et al are discussed above and incorporated herein. Applicant does not contest the teachings of Vella et al as applied to the obviousness to substitute a miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are each separated by a spacer with a second miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are continuous and not separated by a spacer in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a a miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are each separated by a spacer with a second miRNA sponge comprising at least two or at least 4 miR-183 target sequences that are continuous and not separated by a spacer in a nucleic acid vector comprising a miRNA sponge comprising at least two or at least four miR-183 target sequences because those of ordinary skill in the art previously recognized the scientific and technical design of nucleic acid vectors comprising a miRNA sponge, whereby the miRNA binding sites may be continuous and not separated by a spacer and/or separated by a spacer, as successfully reduced to practice by Vella et al. It would have been obvious to one of ordinary skill in the art to choose from a finite number of identified, predictable options because “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipate success, it is likely that product not of innovation but of ordinary skill and common sense.” The ordinary artisan would have immediately recognized that there are but 2 known options: spacer or no spacer, and both configurations had been successfully reduced to practice. 23. Claims 46-47 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Krol et al (2010; of record), as applied to Claims 31-33, 35, 41, 43-44, 47-48, 50, 52, and 58 above, and in further view of Otaegi et al (January 5, 2012; of record), Kluiver et al (January 2012; of record), and New England Biolabs (PmlI product sheet; neb.com/en-us/products/r0532-pmli; retrieved June 3, 2026). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. Krol et al taught wherein the spacers are about 15 nucleotides in length (e.g. Figure S3c). Krol et al do not teach wherein the spacers are only 1-10 nucleotides in length (Claim 49), or more specifically, 4-6 nucleotides in length (Claim 46), more specifically the sequence of GGAT or CACGTG. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claim(s) 46, Otaegi et al is considered relevant prior art for having taught a nucleic acid construct comprising a coding sequence of interest, wherein the 3’ UTR of said coding sequence comprises a miRNA sponge comprising at least four miR target sequences (e.g. Figure 2), wherein the miR target sequences are separated by spacers. Otaegi et al taught that spacer regions of different sizes were designed using online tools (e.g. pg 2, col. 1), whereby the spacers do not contain miRNA binding sites (e.g. pg 3, col. 2), and whereby 6 nt spacers generated a stronger effect than larger spacers (e.g. pg 3, col. 1, “6nt spacer”; pg 3, col. 2). Kluiver et al is considered relevant prior art for having taught a nucleic acid construct comprising a coding sequence of interest, wherein the 3’ UTR of said coding sequence comprises a miRNA sponge comprising at least four miR target sequences (e.g. Figure 1), wherein the miR target sequences are separated by spacers of 6 nucleotides, each encoding a restriction enzyme recognition site, thereby allowing the ordinary artisan to anneal/ligate the miRNA binding sites together when synthesizing the miRNA sponge (Figure 1, legend, SanD1; pg 6, col. 1, Methods, MicroRNA sponge generation). Kluiver et al taught that the miRNA sponge also comprises spacers of 4 nucleotides between a first and second miRNA target sequence (e.g. Table S2, e.g. AATT, GGAA, GACG, CCGG, GTCC, TTAT, GCGG, or CGCC). The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id. Instant specification fails to disclose an element of criticality for the 4-nucleotide spacer sequence GGAT, as opposed to the 4-nucleotide spacer sequences AATT, GACG, CCGG, GTCC, TTAT, GCGG, and/or CGCC, even more specifically, GGAA (1 nucleotide mismatch), successfully reduced to practice in a miRNA sponge by Kluiver et al. New England Biolabs evidences that those of ordinary skill in the art immediately recognize that instant SEQ ID NO:6 (CACGTG) is the recognition motif for the PmlI restriction enzyme. The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id. Instant specification fails to disclose an element of criticality for the 6-nucleotide spacer sequence CACGTG, as opposed to the 6-nucleotide spacer sequence successfully reduced to practice in a miRNA sponge by Otaegi et al, and/or the 6-nucleotide restriction enzyme spacer sequence successfully reduced to practice by Kluiver et al to synthesize a miRNA sponge. Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first spacer in an miRNA sponge with a second spacer, e.g. SEQ ID NO:7, in an miRNA sponge with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first spacer in an miRNA sponge with a second spacer, e.g. SEQ ID NO:7, in an miRNA sponge because those of ordinary skill in the art previously recognized the scientific and technical concepts of using restriction enzyme sites to ligate/anneal miRNA binding sites together, thereby synthesizing a miRNA sponge, whereby the sequence of the spacer is not material to the function of the miRNA sponge, and the ordinary artisan previously recognized that online tools are readily available to design spacer length and sequences, whereby the spacer regions should not contain miRNA binding sites, and whereby shorter spacers, e.g. 6 nt spacers, generated a stronger effect than larger spacers (Otaegi et al). The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id. The specification fails to disclose an element of criticality for the instantly recited spacer SEQ ID NOs. In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). The specification fails to disclose an element of criticality for the instantly recited range of 1-10 spacer nucleotides, as opposed to the spacer nucleotide lengths of 4, 6, or about 15 taught by the cited prior art. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). With respect to Claim 47, Krol et al taught wherein a spacer is located 3' to the first miRNA target sequence and/or 5' to the last miRNA target sequence. (Figure 2; Figure S3c). Otaegi et al taught wherein a spacer is located 3' to the first miRNA target sequence and/or 5' to the last miRNA target sequence. (Figure 2a). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). Response to Arguments Applicant argues that Otaegi et al, Kluiver et al, and New England Biolabs do not cure the defect(s) of Krol et al. Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Krol et al are discussed above and incorporated herein. Applicant does not contest the teachings of Otaegi et al, Kluiver et al, and New England Biolabs as applied to the obviousness to substitute a first spacer in an miRNA sponge with a second spacer, e.g. SEQ ID NO:7, in an miRNA sponge with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first spacer in an miRNA sponge with a second spacer, e.g. SEQ ID NO:6, in an miRNA sponge because those of ordinary skill in the art previously recognized the scientific and technical concepts of using restriction enzyme sites to ligate/anneal miRNA binding sites together, thereby synthesizing a miRNA sponge, whereby the sequence of the spacer is not material to the function of the miRNA sponge, and the ordinary artisan previously recognized that online tools are readily available to design spacer length and sequences, whereby the spacer regions should not contain miRNA binding sites, and whereby shorter spacers, e.g. 6 nt spacers, generated a stronger effect than larger spacers (Otaegi et al). The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id. The specification fails to disclose an element of criticality for the instantly recited spacer SEQ ID NOs: 5 and 6. 24. Claims 53-55 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Krol et al (2010; of record), as applied to Claims 31-33, 35, 41, 43-44, 47-48, 50, 52, and 58 above, and in further view of Hadaczek et al (available online June 29, 2016; of record). Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue. Claim 44 recites the intended use of the AAV for transduction of dorsal root ganglia cells, which, in the in vivo context, are located in the central nervous system, more specifically, the spinal cord. Krol et al taught wherein the AAV composition comprises a pharmaceutically acceptable carrier, e.g. phosphate buffered saline (e.g. Methods). Krol et al do not teach wherein the pharmaceutically acceptable carrier comprises an artificial cerebrospinal fluid, e.g. buffered saline, and a surfactant. However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 53-54, Hadaczek et al is considered relevant prior art for having taught an AAV pharmaceutical formulation to express the artisan’s nucleic acid of interest in the central nervous system, more specifically, the brain of a subject, said AAV pharmaceutical formulation comprising phosphate-buffered saline and a surfactant, to wit, poloxamer 188 (e.g. pg 9, col. 2, Methods). With respect to Claim 55, the Examiner interprets AAV pharmaceutical formulation comprising phosphate-buffered saline and/or phosphate-buffered saline and a surfactant to fulfill the phrase “artificial cerebrospinal fluid”. A recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The phrase “for delivery of the vector genome [to] a dorsal root ganglia (DRG) cell" is an intended use limitation, which does not contain any further structural limitations with respect to claimed physiologically compatible aqueous suspending agent comprising buffered saline and a surfactant, recited at a high level of generality, and/or an artificial cerebrospinal fluid and a surfactant, also recited at a high level of generality (see MPEP §2114). Considering objective evidence present in the application indicating obviousness or nonobviousness. The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141. The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144. Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to modify an AAV pharmaceutical formulation comprising phosphate-buffered saline, as per Krol et al, to further comprise a surfactant, e.g. poloxamer 188, as taught by Hadaczek et al, with a reasonable expectation of success because those of ordinary skill in the art previously recognized and successfully reduced to practice formulating an AAV pharmaceutical composition comprising phosphate-buffered saline and a surfactant, e.g. poloxamer 188, for the intended use of delivering said AAV to the central nervous system of a subject, which is where DRG cells anatomically reside in vivo. The motivation to combine can arise from the expectation that the prior art elements, will perform their expected functions to achieve their expected results when combined for their common known purpose. MPEP §2144. It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton."). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf). Response to Arguments Applicant argues that Hadaczek et al do not cure the defect(s) of Krol et al. Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Krol et al are discussed above and incorporated herein. Applicant does not contest the teachings of Hadaczek et al as applied to the obviousness to to modify an AAV pharmaceutical formulation comprising phosphate-buffered saline, as per Krol et al, to further comprise a surfactant, e.g. poloxamer 188, as taught by Hadaczek et al, with a reasonable expectation of success because those of ordinary skill in the art previously recognized and successfully reduced to practice formulating an AAV pharmaceutical composition comprising phosphate-buffered saline and a surfactant, e.g. poloxamer 188, for the intended use of delivering said AAV to the central nervous system of a subject, which is where DRG cells anatomically reside in vivo. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the claims at issue are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); and In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The USPTO internet Web site contains terminal disclaimer forms which may be used. Please visit http://www.uspto.gov/forms/. The filing date of the application will determine what form should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp. 25. Claims 31-35, 41, and 43-58 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5, 7-13, 16, 19, 36, and 43-44 of copending Application No. 17/998,328 as per claims filed on February 20, 2026. Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are obvious over the cited claims of Application 17/998,328. ‘328 claims 1 and 19 recite a recombinant AAV (rAAV) which specifically represses expression of the gene product in dorsal root ganglia (DRG), said rAAV comprising an AAV capsid having packaged therein a vector genome, wherein the vector genome comprises: (a) a coding sequence for the gene product under the control of regulatory sequences that direct expression of the gene product in a cell containing the vector genome; and (b) at least eight miR target sequences, wherein each target sequence is specific for miR-183 or miR-182, wherein the at least eight miR target sequences are operably linked to the 3’ end of the coding sequence. Instant Claims 31 and 44 anticipate the broader ‘328 claims 1, 19, and 43-44. Instant claims recite wherein the miRNA sponge comprises at least 2, 4, or more (“comprises” is open language, no upper limit), miR-183 target sequences and at least 1, or more (“comprises” is open language, no upper limit), miR-182 target sequences, and thus anticipates ‘328 claims 1-5, 19, and 43-44. Instant Claim 52 recites wherein the vector genome encodes a 200-1200 nucleotide sequence comprising a 3’ UTR and the miRNA sponge, which anticipates ‘328 claim 7. Instant Claims 45 and 49 recite wherein the miRNA target sequences are separated by a spacer of 0-10 nucleotides, which anticipates ‘328 claim 8. Instant Claims 50-51 recite wherein the miRNA target sequences are within 20-100 nucleotides from the 3’ end of the coding sequence, which anticipates ‘328 claims 9-10. Instant Claim 34 recites wherein the miRNA target sequences are in the 5’ UTR, which anticipates ‘328 claim 11. Instant Claim 57 recites wherein the miRNA target sequences are SEQ ID NO:1 or SEQ ID NO:2, which anticipates ‘328 claim 12, identical to SEQ ID NO:1 and SEQ ID NO:3, respectively. Instant Claim 46 recites wherein the spacer is SEQ ID NO:5 or SEQ ID NO:6, which anticipates ‘328 claim 13, identical to SEQ ID NO:5 and SEQ ID NO:6, respectively. Instant Claims 53-54 recite wherein the rAAV is formulated with a pharmaceutically acceptable saline buffer and a surfactant and/or an artificial cerebrospinal fluid comprising a surfactant, which anticipates ‘328 claim 36. The instant claims anticipate the broader claims of ‘328. This is a provisional obviousness-type double patenting rejection because the conflicting claims have not in fact been patented. Response to Arguments Applicant argues that because 17/998328 has a later effective filing date than the instant application, any patent issuing from 17/998,328 will expire at a later date than any claims from the instant application. Applicant’s argument(s) has been fully considered, but is not persuasive. Instant rejection is a provisional nonstatutory double patenting rejection. Instant claims are not yet in condition for allowance. Instant 17/998,328 claims are not yet in condition for allowance. Applicant argues that ‘328 requires at least eight copies of the miR-183 and/or miR-182 targeting sequences, and thus is patentably distinct from the instantly claimed invention. Applicant’s argument(s) has been fully considered, but is not persuasive. As a first matter, while it is clear that ‘328 claim 1 requires the rAAV vector to comprise at least 8 miRNA target sequences specific for miR-183 or miR-182, it does not require at least eight copies of the miR-183, nor at least eight copies of miR-182 targeting sequences. Rather, the claim encompasses just 4 miR-183 target sequences and just 4 miR-182 target sequences. The phrases "comprising….at least two miR-183 target sequences", "comprising….at least four miR-183 target sequences", and "comprising….at least one miR-182 target sequences", of instant claims are open-ended and allows for additional miR-183 and/or miR-182 target sequences in the claims. MPEP 2111.03 specifically sets forth that the transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004). Applicant fails to specifically exclude the presence or more than 1 miR-182 target sequences and/or more than 4 miR-183 target sequences in the instant claims. Instant claims embrace the ‘328 claims. Furthermore, in the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). The specification fails to disclose an element of criticality for the instantly recited open range(s), as compared to open range(s) of ‘328. Conclusion 26. No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. KEVIN K. HILL Examiner Art Unit 1638 /KEVIN K HILL/Primary Examiner, Art Unit 1638
Read full office action

Prosecution Timeline

Show 5 earlier events
Feb 03, 2025
Response Filed
Feb 27, 2025
Non-Final Rejection mailed — §101, §102, §103
Jul 24, 2025
Response Filed
Sep 29, 2025
Final Rejection mailed — §101, §102, §103
Mar 30, 2026
Notice of Allowance
May 20, 2026
Request for Continued Examination
May 26, 2026
Response after Non-Final Action
Jul 01, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735700
COMPOUNDS AND METHODS FOR REDUCING FUS EXPRESSION
4y 9m to grant Granted Sep 15, 2026
Patent 12723266
HOMOLOGY DEPENDENT REPAIR GENOME EDITING
5y 3m to grant Granted Sep 01, 2026
Patent 12709751
MANNAN BINDING LECTIN SERINE PEPTIDASE 2 (MASP2) IRNA COMPOSITIONS AND METHODS OF USE THEREOF
4y 0m to grant Granted Aug 18, 2026
Patent 12703864
VECTORS AND COMPOSITIONS FOR TREATING HEMOGLOBINOPATHIES
4y 6m to grant Granted Aug 11, 2026
Patent 12703858
THERAPEUTICS FOR GLYCOGEN STORAGE DISEASE TYPE III
4y 3m to grant Granted Aug 11, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

4-5
Expected OA Rounds
73%
Grant Probability
80%
With Interview (+6.6%)
2y 10m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 727 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month