Prosecution Insights
Last updated: April 19, 2026
Application No. 17/180,816

MANIPULATING THE CIRCADIAN CLOCK TO INCREASE GENE EXPRESSION

Final Rejection §102§103§112
Filed
Feb 21, 2021
Examiner
SHARMA, SANTOSH
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
VANDERBILT UNIVERSITY
OA Round
4 (Final)
76%
Grant Probability
Favorable
5-6
OA Rounds
2y 11m
To Grant
99%
With Interview

Examiner Intelligence

Grants 76% — above average
76%
Career Allow Rate
77 granted / 102 resolved
+15.5% vs TC avg
Strong +28% interview lift
Without
With
+28.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 11m
Avg Prosecution
32 currently pending
Career history
134
Total Applications
across all art units

Statute-Specific Performance

§101
6.1%
-33.9% vs TC avg
§103
27.2%
-12.8% vs TC avg
§102
15.5%
-24.5% vs TC avg
§112
39.0%
-1.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 102 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions The amendments received on 08/28/2025 have been entered. Claims 1, 3-6, 9-15 are pending. Therefore claims 1, 3-6, 9-15 are examined in this office action. Rejection that are withdrawn Objection to claim 1 is withdrawn in light of applicant’s deletion of the duplicate term “the”. 35 USC § 112 scope of enablement rejection is withdrawn in light of applicant’s cancellation of claim 2. Claim Rejections - 35 USC § 112 -Written Description Requirement The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 3-6, 9-15 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Following analysis is modified to analyze the claims to narrow down the promoter regulating genes of LabA or CikA since applicant has deleted the gene RpaA, SasA, RpaB. Analysis of Breadth of Claims Claim requires any knockout mutation or any sequence mutation in the expression control sequence and or in LabA or CikA gene that alters the activity of clock promoter regulating genes CikA or LabA. Claims requires altering activity (any increase or decrease) of promoter regulating genes CikA or LabA. Claim requires overexpression of any KaiA, KaiB, and KaiC genes to increase the activity of clock output (claims 1, 3-5, 9-15). What is Described in the Specification Applicant describes the following: Applicant has showed the deletion of the clock promoter regulating genes (i.e. input pathway gene), cickA as SEQ ID NO:14 results constant high expression of the output gene (Figure 14). KaiA-OX enhances expression of subjective dusk genes (page 35, paragraph 00100). kaiA expression can enhance production of foreign proteins in cyanobacteria (page 40, paragraph 00109). In vivo overexpression of kaiC has been claimed to globally repress gene expression in S. elongatus (page 35, paragraph 00100). Both KaiA and KaiC can repress and enhance transcript abundances and they appear to have to have opposite effects on the expression of many genes (Figures 2 & 4; Figures 3A and 3B). Difference Between What was Described and What is Claimed Applicant has not described mutation of any expression control sequence of any of CikA or LabA, or in LabA or CikA genes would alter activity of promoter regulating genes resulting in the increased expression of a target gene and increased output of the circadian clock other than deletion of cickA as SEQ ID NO:14. Applicant has not described altering activity of promoter regulating genes CikA or LabA whether the altering is increasing activity or decreasing activity of which of the any of CikA or LabA. Applicant has not described any KaiA, KaiB, and KaiC gene other than SEQ ID NOs: 3-5 (claims 1, 3-5, 9-15). Applicant has not described increase in output of the promoter regulating genes since the level of output in the recited standard as any natural photosynthetic organism is not described. Applicant has not described any target genes that would have increased expression with expression of a large genus of any of the clock genes of KaiA, KaiB or KaiC and mutation in the expression control sequence of the any of the promoter regulating genes (LabA or CikA). Analysis The purpose of the written description is to ensure that the inventor had possession at the time the invention was made, of the specific subject claimed. For a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. Applicant has not described mutation of any expression control sequence of any of CikA or LabA genes would alter activity of promoter regulating genes resulting in the increased expression of a target gene and increased output of the circadian clock other than deletion of cickA as SEQ ID NO:14 that results in constant high expression of the output gene (Figure 14). Applicant defines in page 14, paragraph 0037 “The term "expression control sequence" as used herein refers to polynucleotide sequences which are necessary to affect the expression of coding sequences to which they are operatively linked. Expression control sequences are sequences which control the transcription, post-transcriptional events and translation of nucleic acid sequences. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., ribosome binding sites); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion. For this reason expression control sequence comprises large genus of sequences. For example Markson et al. (Published: 12/05/2013, Volume 155, Issue 6, , Pages 1396-1408) teaches kaiBC promoter activity was absent at all doses of RpaA(D53A). Expression of RpaA(D53E), however, restored activity from the promoter in a dose-dependent manner (Figure 3C), consistent with positive regulation of promoter activity by RpaA∼P. Furthermore, Markson et al. teaches RpaA∼P decreases during the subjective night (Figure 3A), allowing gene expression to revert to its default dawn-like state (Figures 1B and C) and also opening the cell division gate (page 1406, left paragraph 1). Markson et al. teaches no aspartate phosphorylation was present in RpaA(D53A) or RpaA(D53E) (Figure S3G) (page 1399, left paragraph 1). For this reason, a mutation in different region of the RpaA gene would have different effects on the expression of the gene for whether the mutation is phosphorylatable (i.e. D53A) or phophomimetic (i.e. D53E). Markson et al. Figure 7 teaches CikA and Tanicuchi et al. (Published:2007, Journal: Genes Dev. 21, 60–70.) teaches LabA is involved in global expression involving RpaA (page 60, Abstract, Figure 7). Therefore, specific variants of the LabA or CikA would have been used in the recited function of increasing expression of target gene and increasing circadian clock output. Furthermore, Markson et al. teaches the RpaA regulon comprise 134 target transcripts corresponding to 170 protein coding genes wherein Change in expression of circadian ChIP target genes downregulated (green, n = 72) or upregulated (red, n = 23) in the rpaA mutant plotted as a function of their phase in the wild-type strain (Figure 5C). For this reason there are many genes that would be down regulated and upregulated when the RpaA gene is mutated (page 1402, Figure 5). For this reason, there is large genus of target genes that would be upregulated or down regulated by the mutation in the RpaA gene. Applicant has not described any promoter of any target gene would have been regulated by the mutation in any expression control sequence of the promoter regulating genes. Applicant has not described altering activity of promoter regulating genes CikA or LabA whether the altering is increasing activity or decreasing activity of which of the CikA or LabA. For example, Markson et al. teaches deletion of sasA and cikA have opposite effects on cell-cycle gating and RpaA phosphorylation (page 1405, left paragraph 2). For this reason, applicant has not described altering since some gene would require increasing expression and other would require decreasing expression for effect on cell cycle gating and transcription regulation of different genes as target genes (see Figure 7, below). Instead, applicant has not described any example of alteration of promoter regulating genes deletion of the promoter regulating genes (i.e. input pathway gene) other than cickA as SEQ ID NO:14 results constant high expression of the output gene (Figure 14). Applicant has not described increase in output of the promoter regulating genes since there would be large variation in the output of the promoter regulating genes in any of the natural photosynthetic organisms that has been compared in the claim 1. This is because applicant is comparing the output with any natural photosynthetic organisms to compare for the increasing output. Applicant has not described any KaiA, KaiB, and KaiC gene other than SEQ ID NO: 3-5 (claim 1). For example, Mohanta et al. (Published: 2017, EUROPEAN JOURNAL OF PHYCOLOGY, VOL. 52, NO. 2, 149–165 http://dx.doi.org/10.1080/09670262.2016.1251619) teaches various diversity of the KaiA, KaiB and KaiC protein in different families of cyanobacteria Figure 6-8, wherein the proteins have diversity of different conserved domains and motifs. Applicant has not described overexpression of any of the KaiA, KaiB, and KaiC genes other than SEQ ID NO: 3-5 (claim 1) that would affect increase in the circadian clock output. Furthermore, such variation would have been present in the promoter regulating genes CikA or LabA during evolutionary forces in different photosynthetic organism. Instead, applicant has not described any example of alteration of promoter regulating genes deletion of the promoter regulating genes (i.e. input pathway gene) other than cickA as SEQ ID NO:14 results constant high expression of the output gene (Figure 14). Given the large genetic diversity in any of the clock genes and the promoter regulating genes, the variants of mutants for the expression control elements of the promoter regulating genes and the diversity in the photosynthetic organism that would require to have increased circadian clock output in its method of increasing gene expression, Applicant’s disclosure is not representative of the claimed genus as a whole. This point is particularly relevant because, as discussed above, the prior art speaks to the disconnection between the claimed method of increasing gene expression in any photosynthetic organism. Furthermore, claim does not recite any specific mutation that would have such functions, so there is no description of a structure/function relationship. "The test for sufficiency is whether the disclosure of the application relied upon reasonably conveys to one skilled in the art that the inventor had possession of the claimed subject matter as of the filing date." Ariad Pharm, Inc, v EH Lilly & Co., 598 F.3d 1336, 1351 (Fed. Cir. 2010). To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Lockwood v. Amer. Airlines, ina, 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997). "An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations. Lockwood, 107 F.3d at 1572, 41 USPG2d at 1966". While the written description requirement does not demand either examples or an actual reduction, actual "possession" or reduction to practice outside of the specification is not enough. Ariad Pharm, Inc. v. Eli Lilly & Co., 598 F,3d 1336,1352 (Fed. Cir. 2010). Rather, it is the specification itself that must demonstrate possession. Id. Thus, based on the analysis above, Applicant has not met either of the two elements of the written description requirement as set forth in the court's decision in Eli Lilly. As a result, it is not clear that Applicant was in possession of the claimed genus at the time this application was filed. Response to Argument Applicant's arguments filed 08/08/2025 have been fully considered but they are not persuasive. Applicant argues the claims have been revised to recite that the clock signal-transmitting gene is LabA and is not RpaA (Response to Rejection, page 4, second to last paragraph). Applicant argues specification clearly provides written support for a LabA knock out, but admittedly there is no actual data provided for this feature. Applicant argues based on Example 2 and FIGS. 14A-B, the application a filed provides evidence that knock out of cikA, another clock signal-transmitting gene like LabA, provides high expression of an output (reporter) gene (Response to Rejection, page 6, paragraph 2). Applicant argues Markson et al. in their Figure 7 proposes that CikA acts as a suppressor of the clock-controlled gene expression pathway. Applicant argues Taniguchi et al. in their Figure 7 proposes that LabA also acts as a suppressor of the clock-controlled gene expression pathway. Applicant argues therefore i) knockout of either CikA or LabA should work in the same way, and (ii) knocking out a suppressor would be expected to upregulate the downstream steps in the pathway up to "peak" levels, although but not quantitatively (and surprisingly) to the extent the inventors here found. Applicant argues this reasoning is supported in the appended declaration from Dr. Michael J. Rust (Response to Rejection, page 6, paragraph 3). Applicant's arguments have been fully considered but they are not persuasive since: Regarding argument on CiKA and LabA to be suppressor of the clock-controlled gene expression pathway and knockout of either would be expected to upregulate the downstream steps. It was not found persuasive since applicant has only showed cickA as SEQ ID NO:14 results constant high expression of the output gene (Figure 14). Given the large diversity of CikA and LabA genes involved in clock signal transmitting in any photosynthetic organisms, there is dearth of description of mutation in any CikA and LabA genes that would increase the output of the circadian clock. Applicant argues Applicant previously made of record Xu et al., Proc. Nat'lAcad. Sci. 121(21) e2318690121 (2024), which is the work of the present inventors wherein this study provides very clear experimental evidence that LabA knock out has a profound effect on circadian clock regulation that resulted in significantly increased target gene expression. Applicant argues underlying cause of this dramatic quantitatively enhanced target gene expression is not completely understood (Response to Rejection, page 6, last paragraph) (and as the appended declaration indicates is beyond prediction), but Xu et al. (2024) provide evidence in their Figure S 12 that mRNA stability was a major contributor to these results, explaining at least one underlying cause for this effect. Applicant argues while changing mRNA stability is known to affect gene expression patterns in general, alterations to mRNA stability are not a factor previously considered in the quantitative control of clock-controlled gene expression patterns in cyanobacteria. Applicant argues thus to the extent that the concerns stated in the Action are more properly characterized as stemming from enablement, these data are more than sufficient to address the rejection. Regarding argument on Xu et al. applicant is arguing on LabA knockout and its evidence which was published after around 10 years of effective date of filing of the invention. Furthermore, the description requirement is for having function of increased product of circadian cycle when any of LabA is knockout in of the photosynthetic organisms wherein example is only for CikA gene as SEQ ID NO:14 from Synechococcus elongatus would have such effects. For example Taniguchi et al. teaches LabA belongs to the uncharacterized DUF88/ COG1432 domain family (Supplementary Fig. S1A) and many genes have been found belonging to this family in various prokaryotic species, their function and biochemical properties are unknown (page68, left paragraph 2). Given there are variations in LabA genes in different photosynthetic organisms, ther is dearth of description of any LabA genes in any photosynthetic organisms when mutated would have function of increased product of circadian cycle. Therefore, the written description is maintained. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Anticipated by Taniguchi et al. Claims 1, 3-5, 9-11 are rejected under 35 U.S.C. 102 (a) (1) as being anticipated by Taniguchi et al. (Published: 2007, Journal: Genes & Development, 21: 60–70) and as evidenced by Markson et al. (Published: 12/05/2013, Volume 155, Issue 6, , Pages 1396-1408). Regarding claims 1, 3-5, 9 and 11, Taniguchi et al. discloses in cyanobacterium Synechococcus elongatus PCC 7942 novel gene, labA (low-amplitude and bright), that is required for negative feedback regulation of KaiC wherein disruption of labA abolished transcriptional repression caused by overexpression of KaiC and elevated the trough levels of circadian gene expression, resulting in a low-amplitude phenotype and overexpression of labA significantly lowered circadian gene expression. Taniguchi discloses rpaA functions downstream from labA for kaiBC expression (page 60, Abstract). Taniguchi et al. discloses their results showed labA mutation can affect expression at various promoters (page 62, right paragraph 3). Over expression of labA carried out by IPTG-inducible Ptrc_labA transgene reduced the amplitude of the bioluminescence waveforms in the PkaiBC_luxAB reported strain (page 63, right last paragraph). Taniguchi et al. discloses that labA represses circadian gene (page 64, left paragraph). Since rpaA function downstream of labA and which causes the increased expression of the target gene. Taniguchi et al. discloses a mutant of the promoter regulating genes labA in the clock gene KaiC-overexpressing strain wherein the labA is mutated by transposon insertion (page 61, Figure 1). Taniguchi et al. discloses LabA-related protein sequences are found not only in cyanobacteria (Fig. 1C), but also in various prokaryotic organisms, including some archaea (page 62, left paragraph 2). Taniguchi et al. discloses KaiC-interacting sensory histidine kinase SasA and its cognate response regulator RpaA are involved in the output pathways of the cyanobacterial circadian clock (page 64, left paragraph 3). Taniguchi et al. discloses labA mutant carrying Ptrc::sasA or Ptrc::rpaA transgene, wherein loss of labA function attenuated the negative effect of sasA overexpression, suggesting the additive effect of labA and sasA (see Figure 5) (page 64, left last paragraph). Taniguchi et al. discloses additive effect of compound mutations on circadian gene expression suggests that labA and sasA are involved in various output pathways (page 65, left paragraph 1). Furthermore, Figure 6, page 66 showed the labA sas A mutant showed increased growth compared to sasA mutant. Taniguchi et al. discloses a model where the expression of target gene is increased because of the mutation in labA and sasA (Figure 7) wherein following the interaction with KaiC, SasA is autophosphorylated and that activates the putative transcription factor RpaA wherein RpaA controls circadian gene expression globally through the basic transcriptional machinery (page 67, right last paragraph). PNG media_image1.png 642 589 media_image1.png Greyscale For this reason the compound mutant increases the output of circadian clock. PNG media_image2.png 934 1196 media_image2.png Greyscale PNG media_image3.png 671 591 media_image3.png Greyscale Taniguchi et al. discloses labA regulates second promoter operably linked to target gene with reasonable expectation of some genes effected by circadian rhythm to increase their expression. Regarding claim 10, Taniguchi et al. discloses the lab A mutant wherein loss of lab A as inactivated lab A in the PpsbAI_luxAB reporter wherein it modified the circadian rhythm and the maximum bioluminescence intensity of the labA mutant was ~12-fold higher than that of the parental wild-type reporter strain, indicating that the labA mutation can affect expression at various promoters (page 62, last three paragraphs) where in transgenic expression of labA in labA mutants was able to rescue the mutant phenotype (page 63, left last paragraph). Thus, knockout of labA would increase expression of the genes effected by in circadian rhythm as target gene. For this reason, Taniguchi et al. anticipates the claims. Response to Argument Applicant's arguments filed 08/28/2025 have been fully considered but they are not persuasive. Applicant argues Taniguchi used only luciferase as a target gene and that is excluded by claim 1 (Response to Rejection, page 8, first paragraph). Taniguchi et al. discloses a model where the expression of target gene is increased because of the mutation in labA and sasA (Figure 7) wherein following the interaction with KaiC, SasA is autophosphorylated and that activates the putative transcription factor RpaA wherein RpaA controls circadian gene expression globally through the basic transcriptional machinery (page 67, right last paragraph). Therefore Taniguchi et al. discloses the knockout of LabA would increase expression by removing the repression RpaA and since it effects on global gene expression it would affect at least one target gene with its own promoter. Therefore Taniguchi et al. anticipates the claim and the rejection is maintained. Applicant argues Dr. Rust points out that. in Taniguchi et al. (2007), the labA- strain was "bright" in luminescence with the luciferase (bacterial luxAB) reporter (e.g., Fig. 3A of that paper). Applicant argues this result was interpreted by those authors as due to an effect on the luciferase substrate FMNH2, not to an increased expression of the heterologous (foreign) target gene/protein LuxAB. Applicant argues the authors made that conclusion because when they tested a different luciferase reporter that does not use FMNH2 as a substrate (firefly luciferase, a.k.a. luc), they did not see the "bright" phenotype because the peak luminescence was almost the same in the labA- and in the wild-type (WT) strains, and only the trough levels were increased in the labA- strain (e.g., Fig. 3B of that paper) (Response to Rejection, page 8, paragraph 2). Applicant argues Dr. Rust offers that the Taniguchi et al. authors concluded that LabA modulates circadian gene expression because the trough levels of the circadian oscillation were increased, resulting in a low-amplitude phenotype (e.g., Fig. 3B of that paper). Applicant argues as stated in their paper, "Disruption of labA abolished transcriptional repression caused by overexpression of KaiC and elevated the trough levels of circadian gene expression, resulting in a low-amplitude phenotype." Applicant argues Taniguchi et al. do not measure the level of expression (abundance) of any heterologous target protein, relying instead upon the indirect estimation by luciferase-reporter luminescence that is complicated by possible changes in luciferase substrates (e.g., FMNH2), as they acknowledge. Applicant argues Dr. Rust argues that, just like Markson et al., Taniguchi et al. includes no data to indicate that the magnitude of expression (abundance) of a heterologous target protein such as luciferase is increased above levels that would normally be attained at the peak of the oscillation in wild-type cells (Response to Rejection, page 9, last paragraph). Applicant's arguments have been fully considered but they are not persuasive since: Regarding Dr. Rust argument on peak luminescence was almost the same in the labA- and in the wild-type (WT) strains, and only the trough levels were increased in the labA- strain (e.g., Fig. 3B of that paper). It is not found persuasive claims does not require specific significant increase and furthermore Taniguchi et al. clearly showed the mutation of LabA (see Figure 1) that has increased KaiBC mRNA level and the lumiscenece (Figure 3). Regarding argument on expression (abundance) of a heterologous target protein, the Taniguchi et al. anticipated claims 1, 3-5, 9- 11 does not require heterologous promoter, therefore the argument is moot point. Therefore, anticipation rejection over Taniguchi et al. is maintained. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or non-obviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. The previous anticipation rejection over Markson et al. has been reanalyzed as the obviousness rejection since applicant has amended claim to delete genes RpaA, SasA, RpaB in the claims and narrowed the genes to the promoter regulating genes of LabA or CikA. Obvious over Markson et al. and further in view of Xu et al. Claims 1, 3-6, 9, 11 and 13 are rejected under 35 U.S.C. 103 as being unpatentable over Markson et al. (Published: 12/05/2013, Volume 155, Issue 6, , Pages 1396-1408), in view of Xu et al. (Published : 2003, Volume 22 No. 9, Pages 2117-2126), further evidenced by Espardellier et al. (Published Year: 1978, Journal: FEMS Microbiology Letters, Vol. 4, pages: 261-264). Claims are drawn to a method of increasing gene expression by manipulating the circadian clock, comprising transforming a photosynthetic organism (a) a first promoter and a clock gene, wherein the first promoter results in overexpression of the clock gene to which the first promoter is operably linked, and (b) a second promoter and a target gene to which the second promoter is operably linked, thereby resulting in a change to the circadian cycle of the transformed photosynthetic organism that increases expression of a target gene. Regarding claims 1, 3-5 and 9, Markson et al. teaches deletion of cikA has effect on cell cycle gating wherein RpaA~P is responsible for closing the gate and CikA have effects on RpaA phosphorylation (page 1405, left paragraph 2). Markson et al. teaches CikA regulate phosphorylation to generate oscillations of RpaA~P that peak at or immediately preceding subjective dusk (page 1406, left paragraph 1, Figure 3A and Figure 7). Markson et al. teaches CikA acts as phosphatase that dephosphorylates RpaA and promotes higher accumulation of unphosphorylated RpaA that would lower the effect of RpaA on other target genes including global regulators or cell division regulators etc. (see Figure 7 below) wherein the moated CikA, as cikA mutant had higher mean cell length (i.e. increased output of circadian clock) compared to wildtype (page 1404, Figure 6E, see figure below) showing the increased effect of RpaA to the regulation of other cellular genes. PNG media_image4.png 410 512 media_image4.png Greyscale Markson et al. teaches response regulator RpaA serves as the master regulator of the cyanobacterial circadian clock’s genome-wide transcriptional oscillations (page 1396, Summary) in the Cyanobacterium Synechococcus elongatus PCC7942, a photoautotroph (page 1396, left paragraph 1). For example, Espardellier teaches cyanobacteria has photoautotrophic growth (page 261, left paragraph 1). Markson et al. teaches the circadian clock of the cyanobacterium Synechococcus elongatus PCC7942 drives daily genome-wide oscillations in mRNA expression levels, controls genome compaction and supercoiling, and modulates cell division and the clock contains a core oscillator consisting of the proteins KaiA, KaiB, and KaiC, which together generate circadian (i.e., ~24 hr) oscillations in KaiC phosphorylation (page 1396, left last paragraph). Markson et al. teaches Phosphorylated RpaA binds to the kaiBC promoter and upregulates kaiBC expression (page 1398, right paragraph 2). Markson discloses RpaA phosphorylation links the core Kai oscillator to two of the most striking physiological outputs of the clock: global transcriptome oscillations and gating of cell division (page 1405, right last paragraph) (see figure 7 below). Hence the core Kai oscillator’s as KaiA, KaiB, and KaiC with a promoter would be required for oscillations. PNG media_image5.png 767 1347 media_image5.png Greyscale Markson et al. discloses RpaA is responsible for promoting subjective dusk gene expression and repressing subjective dawn gene expression (page 1400, right paragraph 1). Consistent with this scenario, global gene expression in the rpaA mutant is most positively correlated with wild-type subjective-dawn expression and is most negatively correlated with wild-type subjective dusk expression (Figure 1C) (page 1398, left first paragraph). Hence the modulation of expression of clock genes in the circadian cycle suppress the circadian rhythm of the cynobacteria a photoautotroph and photosynthetic bacteria. Markson et al. discloses RpaA∼P binds to DNA and controls the expression of the RpaA regulon, which consists of target genes as global transcriptional regulators, cell division regulators, certain clock genes (kaiBC and rpaA), and genes involved in metabolism and translation (page 1405, Figure 7, see figure above). Markson et al. discloses to isolate transcriptional changes resulting directly from activity of RpaA(D53E) away from potentially confounding Kai oscillator dependent processes, Markson introduced the Ptrc::rpaA(D53E) construct into a strain lacking kaiBC as well as rpaA, producing a ∆rpaA ∆kaiBC Ptrc::rpaA(D53E) strain that Markson refer to as ‘‘OX-D53E.’’(page 1403, left paragraph 1). Markson discloses the strong correlation between the dawn-to-dusk expression change in the wild-type and the expression change upon RpaA(D53E) induction in OX-D53E shows that active RpaA suffices to switch cells between dawn and dusk expression states (page 1403, left second to last paragraph). Consistent with the gene expression state of the rpaA mutant (Figure 1C), preinduction OX-D53E is most correlated with wild-type at 24 hr (subjective dawn) and is most anticorrelated with wild-type at 36 hr (subjective dusk) (page 1403, left paragraph 2). Therefore Markson et al.’s cikA mutant that showed it effect on the RpaA and showing regulation of Global Circadian Gene Expression and Controls the Cell Division Gate wherein the RpaA regulon comprises global regulators, cell division regulators and circadian clock genes as target genes. Furthermore, Xu et al. teaches from their result showed circadian autoregulatory feedback loop in cyanobacteria does not require specific clock gene promoters as it does in eukaryotes, because a heterologous promoter can functionally replace the kaiBC promoter (page 2117, Abstract). Hence a heterologous promoter producing a transgenic photosynthetic organism would have same effect to the circadian growth and global gene expression. Therefore it would have been obvious before effective date of filling of the invention from teaching suggestions and motivation of Markson et al. to generate develop a method of transforming a cyanobacterium(i.e. photosynthetic organism) with a first promoter and a clock gene and second promoter and a targeted gene leading to change in circadian cycle of the cyanobacterium and creating mutation the cikA wherein the cikA mutant would have no negative effect on the master regulator of cull expression RpaA leading to increased expression of the Global Circadian Gene Expression and Controls the Cell Division Gate anticipate the claims wherein the RpaA regulon comprises global regulators, cell division regulators and circadian clock genes as target genes. Therefore the method of mutating cikA would result in change in circadian cycle of the transformed photosynthetic organism and that would affect the expression of target gene and the target gene promoter of the target gene is regulated by the mutated CikA gene by not repressing the RpaA. Furthermore, the promoter would be any heterologous promoter since the promoter can replace any promoter of the clock gene as taught by Xu et al. that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention of method of increasing gene expression by manipulating the circadian clock. Regarding claim 6, Markson et al. and Xu et al. does not teach the clock gene is SEQ ID NO:3. The clock gene was known in the art as SEQ ID NO: 3. Alignment of SEQ ID NO: 3 to the N Geneseq 202344 database showed it had 100% sequence identity to locus AAV12753 a Biological clock control gene ORF-E which are used for control of circadian rhythms (see alignment and description below). Hence it would have been obvious to try from a finite number of clock genes to choose SEQ ID NO:3 as clock gene that would have expected result of modulation of circadian rhythm. Alignment of SEQ ID NO: 3 to the N Geneseq 202344 database: RESULT 1 AAV12752 (NOTE: this sequence has 3 duplicates in the database searched. See complete list at the end of this report) ID AAV12752 standard; DNA; 855 BP. XX AC AAV12752; XX DT 08-MAY-1998 (first entry) XX DE Biological clock control gene ORF-D. XX KW Biological clock; circadian rhythm control; ORF-D; ss. XX OS Synechococcus sp. XX FH Key Location/Qualifiers FT CDS 1..855 FT /*tag= a FT /transl_except= (pos: 1..3, aa: Met) XX CC PN JP10036392-A. XX CC PD 10-FEB-1998. XX CC PF 19-JUL-1996; 96JP-00190518. XX PR 19-JUL-1996; 96JP-00190518. XX CC PA (TAKI ) TAKARA SHUZO CO LTD. XX DR WPI; 1998-174909/16. DR P-PSDB; AAW41156. XX CC PT New proteins from Synechoccus sp. - useful for, e.g. for controlling CC PT circadian rhythms in animals. XX CC PS Claim 3; Page 10; 17pp; Japanese. XX CC This sequence represents the ORF-D sequence of the Synechococcus CC biological clock controlling gene, and encodes a protein of the CC invention. The proteins are used for control of circadian rhythms in, CC e.g. animals XX SQ Sequence 855 BP; 206 A; 230 C; 219 G; 200 T; 0 U; 0 Other; Query Match 100.0%; Score 855; Length 855; Best Local Similarity 100.0%; Matches 855; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTGCTCTCGCAAATTGCAATCTGCATTTGGGTGGAATCGACGGCAATTTTGCAGGATTGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GTGCTCTCGCAAATTGCAATCTGCATTTGGGTGGAATCGACGGCAATTTTGCAGGATTGC 60 Qy 61 CAGCGGGCGCTGTCGGCCGATCGCTATCAACTCCAAGTCTGTGAGTCTGGCGAAATGCTC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CAGCGGGCGCTGTCGGCCGATCGCTATCAACTCCAAGTCTGTGAGTCTGGCGAAATGCTC 120 Qy 121 TTGGAGTATGCCCAAACCCATCGTGACCAAATCGACTGCCTGATTTTAGTGGCAGCCAAT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTGGAGTATGCCCAAACCCATCGTGACCAAATCGACTGCCTGATTTTAGTGGCAGCCAAT 180 Qy 181 CCCAGCTTCAGGGCAGTTGTTCAGCAGCTCTGCTTTGAGGGAGTGGTGGTACCAGCGATT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CCCAGCTTCAGGGCAGTTGTTCAGCAGCTCTGCTTTGAGGGAGTGGTGGTACCAGCGATT 240 Qy 241 GTCGTAGGCGATCGCGACAGTGAGGATCCCGATGAACCAGCCAAAGAACAGCTCTATCAC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GTCGTAGGCGATCGCGACAGTGAGGATCCCGATGAACCAGCCAAAGAACAGCTCTATCAC 300 Qy 301 AGCGCTGAACTGCACCTCGGTATCCATCAGCTCGAGCAATTGCCCTACCAAGTTGATGCT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AGCGCTGAACTGCACCTCGGTATCCATCAGCTCGAGCAATTGCCCTACCAAGTTGATGCT 360 Qy 361 GCACTGGCTGAATTTCTGCGCTTAGCCCCGGTCGAGACCATGGCCGACCACATCATGCTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GCACTGGCTGAATTTCTGCGCTTAGCCCCGGTCGAGACCATGGCCGACCACATCATGCTG 420 Qy 421 ATGGGGGCCAACCACGATCCCGAGCTATCGAGCCAGCAGCGGGACCTCGCTCAGCGACTA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 ATGGGGGCCAACCACGATCCCGAGCTATCGAGCCAGCAGCGGGACCTCGCTCAGCGACTA 480 Qy 481 CAAGAGCGCCTAGGCTATCTCGGGGTCTACTACAAGCGTGATCCCGATCGCTTTCTGCGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 CAAGAGCGCCTAGGCTATCTCGGGGTCTACTACAAGCGTGATCCCGATCGCTTTCTGCGC 540 Qy 541 AACCTACCCGCCTACGAAAGCCAAAAGCTGCACCAAGCGATGCAGACTAGCTATCGTGAA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 AACCTACCCGCCTACGAAAGCCAAAAGCTGCACCAAGCGATGCAGACTAGCTATCGTGAA 600 Qy 601 ATCGTTTTGAGCTATTTTTCGCCGAATAGCAACCTCAACCAGAGCATTGACAACTTCGTC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 ATCGTTTTGAGCTATTTTTCGCCGAATAGCAACCTCAACCAGAGCATTGACAACTTCGTC 660 Qy 661 AACATGGCTTTCTTTGCCGATGTTCCAGTCACCAAAGTGGTAGAAATTCACATGGAGCTG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 AACATGGCTTTCTTTGCCGATGTTCCAGTCACCAAAGTGGTAGAAATTCACATGGAGCTG 720 Qy 721 ATGGACGAGTTTGCCAAGAAGCTCCGCGTAGAGGGACGTTCAGAGGACATTTTGCTGGAT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 ATGGACGAGTTTGCCAAGAAGCTCCGCGTAGAGGGACGTTCAGAGGACATTTTGCTGGAT 780 Qy 781 TATCGGCTGACTTTAATTGATGTAATTGCACATCTTTGTGAGATGTATCGACGGTCTATC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TATCGGCTGACTTTAATTGATGTAATTGCACATCTTTGTGAGATGTATCGACGGTCTATC 840 Qy 841 CCACGAGAAACCTGA 855 ||||||||||||||| Db 841 CCACGAGAAACCTGA 855 Regarding claim 11, Applicant teaches in their experiments temporal expression profiles of representative kaiA-enhanced subjective dusk genes (D) and kai A-repressed subjective down genes (E) from microarray analysis showed by KaiA-OX strain (page 5, paragraph 0014). For this reason, the circadian rhythm of the cyanobacteria would have been suppressed by increasing the expression of the clock gene KaiA in the mutant. Regarding claim 13, Markson et al. teaches a construct PkaiBC::luxAB wherein the luxAB is an heterologous gene for the cyanobacteria. Hence someone skilled in the art would utilize other useful heterologous genes that are affected by manipulation of circadian clock to increase their expression. Obvious over Markson and further in view of Xu and Rosegaard Claims 1 and 12 are rejected under 35 U.S.C. 103 as being unpatentable over Markson et al. and further in view of Xu et al. and further in view of Rosgaard et al. (Published: 2012, Vol. 162, Pages: 134-147). Regarding claim 1, see analysis above. Regarding claim 12, Markson et al. teaches in Table S1 the phosphoenolpyruvate synthase gene which has decrease amplitude and longer period as the circadian time course showing the effect or rpaA mutant time course. Furthermore, Rosegaard et al. teaches phosphoenolpyruvate; Pyr is involved in biofuel production such as in Isobutanol and Ethanol production in cyanobacteria (page 135, Figure 1). Hence someone skilled in the art would develop the method by specifically expressing the gene involved in the biofuel production. Obvious over Markson and further in view of Xu, Eckert and Weyman Claims 1 and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Markson et al. and further in view of Xu et al. and further in view of Eckert et al. (Published: 2012, Vol. 287, Pages: 43502-43515) and Further in view of Weyman et al. (Published: 2011, Journal: . PLoS ONE 6(5): e20126. doi:10.1371/journal.pone.0020126). Regarding claim 1, see analysis above Regarding claim 14, Markson et al. teaches in Table S1 different hox hydrogenase genes which have significantly decrease the amplitude in the rpaA mutant compared to wild type (Table S1, lines 2610-2616). Hence it would have been obvious that someone skilled in the art would expect that the expression of such genes would be increased by rpaA gene. Furthermore, Eckert et al. teaches Hox hydrogenase is expressed under both anaerobic and aerobic conditions but is only active under dark, fermentative conditions and in the transition from dark to light prior to inhibition by O2 generated during photosynthesis (page 43503, left paragraph 2). Eckert teaches Among the diverse hydrogenases, the bidirectional [NiFe]- hydrogenase (Hox) in cyanobacteria is of great interest for basic biological study as well as for the development of solar hydrogen production technologies (page 46502, right last paragraph). Weyman et al. teaches strain of Synechococcus elongatus with active heterologous expression of Alteromonas macleodii and Thiocapsa roseopersicina [NiFe] Hydrogenases wherein the hydrogenase protein was expressed at the correct size upon induction with IPTG (page 1, Abstract). Weyman et al. teaches the heterologous expression of NiFe hydrogenases with fully assembled active sites in cyanobacteria will enable further study of hydrogenase expression in photosynthetic prokaryotic hosts such as cyanobacteria (page 5, right second to last paragraph). Hence someone skilled in the art would overexpress Hox hydrogenase as heterologous gene for the development of solar hydrogen production technologies by manipulating circadian clock. Obvious over Markson and further in view of Xu, Pillet and Weyman Claims 1 and 15 are rejected under 35 U.S.C. 103 as being unpatentable over Markson et al. and further in view of Xu et al. and further in view of Pillet et al. (Published: 204, Vol. 226, Pages: 59-66), and further in view of Weyman et al. Regarding claim 1, see analysis above. Regarding claim 15, Markson et al. teaches in Table S1 glutathione S-transferase (gst) has also decreased amplitude and increased circadian tiemcourse period in rpaA mutant compared to wildtype (Table S1, line 1314). Furthermore, Pillet teaches expression of islet-specific genes insulin production (insulin) and secretion (migration inhibitory factor (MIF), somatostatin and syntaxin 1A) were modulated in the same daily rhythm of circadian rhythm (page 59, Abstract). Pillet teaches insulin is important for diabetic state development. The creation of strains of cyanobacteria with stable heterologous expression is within the scope of an ordinary skill in the art for example Weyman et al. teaches creating cyanobacteria expressing active enzyme NiFe hydrogenases (page 1, Abstract). Hence it would have been obvious someone skilled in the art would expect that the expression of such genes in a fusion with gst tag would be increased by rpaA gene. Furthermore, it would have been obvious to express proinsulin producing gene as heterologous such as islet-specific gene using cyanobacteria with reasonable expectation of increase in expression because of the modulation of circadian rhythm by rpaA gene that would be crucial for diabetes development management as taught by Pillet. Response to Argument Applicant's arguments filed 08/28/2025 have been fully considered but they are not persuasive. Applicant asserts Markson et al. (2013) shows that the response regulator RpaA serves as the master regulator of clock-controlled gene expression in cyanobacteria. Applicant asserts Phosphorylated RpaA regulates the expression of clock components and a small set of circadian effectors that, in turn, orchestrate genome-wide transcriptional rhythms. Applicant asserts Markson et al. shows deletion of RpaA or expression of mutant RpaA that mimics unphosphorylated RpaA (OX-D53A) decreases gene expression rhythms to the dawn-like (trough of rhythm) state. Applicant asserts Markson et al. shows expression of mutant RpaA that mimics phosphorylated RpaA (OX-D53E) can switch cells from the dawn-like (trough of rhythm) to the dusk-like (peak of rhythm) state. Applicant notes that these "states" refer to timepoints along the usual circadian oscillation between peaks and troughs. Applicant argues as such, as noted in the appended declaration submitted under 37 C.F.R. §1.132 of Dr. Michael J. Rust, a circadian clock researcher with considerable expertise in the field at issue here, there is no experiment in Markson et al. showing that manipulating RpaA levels or phosphorylation status can cause gene expression levels in excess of the usual peak of the circadian oscillation (Response to Rejection, pages 8 and 9 last and first paragraphs). Applicant argues the appended declaration by Dr. Rust indicates the declarant' s surprise when reading the present inventors' Xu et al. (2024) paper showing that a LabA-knockout strain had dramatically higher abundance levels of the heterologous target proteins LuxAB and insulin that are far beyond any level achieved during the usual circadian oscillation (7-30X increases beyond usual peak levels). Applicant argues Dr. Rust thus concludes with the statement that "[t]he results and interpretations of neither Taniguchi et al. (2007) nor Markson et al. (2013) would have predicted such a result." Applicant argues therefore, the analyses and conclusions of Taniguchi et al. (2007) and Markson et al. (2013) identify CikA and LabA as suppressing elements in the cyanobacterial clock-controlled gene expression pathway, but neither their data nor their conclusions indicate that the quantitative levels of target gene expression achieved by manipulating the activity of CikA or LabA ("manipulation of activity" to include deletion, knockout, sequence mutations or overexpression of CikA and/or LabA) could be higher than the peak levels of the normal circadian oscillation, which was assumed by those previous researchers to be the maximum-expression state. Applicant argues the observations of the effects of LabA knockout by the present inventors in Xu et al. (2024) could not have been obvious nor anticipated by those skilled in the art (Response to Rejection, page 10, first paragraph). Applicant argues given these facts, even considering the teachings of each of the cited references, the presently claimed subject matter cannot be considered to be reasonably suggested by the cited art, much less with a reasonable prediction of success. Applicant's arguments have been fully considered but they are not persuasive since: Regarding argument on manipulating RpaA levels or phosphorylation status can cause gene expression levels in excess of the usual peak of the circadian oscillation. For example Markson et al. Figure 7 shows (see figure above) the manipulation of RpaA levels or phosphorylation status can cause gene expression changes related to target genes including clock genes, regulators, and genes involved in metabolism etc. For example supplementary Table 6 showed analysis of the Effect of RpaA(D53E) Induction on Global Gene Expression, Related to Figure 6, where it showed there was significant induction in RpaA(D53E) for example for genes Synpcc7942_0834, Synpcc7942_1610 etc. for example see snippet below. Therefore, it was taught by the Markson et al. that the increased expression is predictable if repression of the RpaA has been lowered by m
Read full office action

Prosecution Timeline

Feb 21, 2021
Application Filed
Mar 23, 2024
Non-Final Rejection — §102, §103, §112
Jul 03, 2024
Response Filed
Sep 19, 2024
Final Rejection — §102, §103, §112
Nov 12, 2024
Response after Non-Final Action
Jan 09, 2025
Request for Continued Examination
Jan 15, 2025
Response after Non-Final Action
Mar 21, 2025
Non-Final Rejection — §102, §103, §112
Aug 28, 2025
Response Filed
Nov 18, 2025
Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12599080
PLANTS AND SEEDS OF CORN VARIETY CV951892
2y 5m to grant Granted Apr 14, 2026
Patent 12599091
SOYBEAN CULTIVAR 23151928
2y 5m to grant Granted Apr 14, 2026
Patent 12593792
SOYBEAN VARIETY 01094695
2y 5m to grant Granted Apr 07, 2026
Patent 12593783
PLANTS AND SEEDS OF HYBRID CORN VARIETY CH010518
2y 5m to grant Granted Apr 07, 2026
Patent 12570995
INSECTICIDAL PROTEINS COMPOSITIONS AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

5-6
Expected OA Rounds
76%
Grant Probability
99%
With Interview (+28.0%)
2y 11m
Median Time to Grant
High
PTA Risk
Based on 102 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month