Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Detailed Action
This action is in response to the papers filed February 13, 2026.
Amendments
Applicant's response and amendments, filed February 13, 2026, is acknowledged. Applicant has cancelled Claims 1-55, 57-65, 67, 72, 75, 80, 82-85, and 87-88, amended Claims 56, 68, 70, and 81, added new claims, Claims 89-92, and withdrawn Claims 71, 74, 76, 78, 81, and 89-90.
Claims 56, 66, 68-71, 73-74, 76-79, 81, 86, and 89-92 are pending.
The amendment to the claims filed on February 13, 2026 does not comply with the requirements of 37 CFR 1.121(c). Amendments to the claims filed on or after July 30, 2003 must comply with 37 CFR 1.121(c) which states:
(c) Claims. Amendments to a claim must be made by rewriting the entire claim with all changes (e.g., additions and deletions) as indicated in this subsection, except when the claim is being canceled. Each amendment document that includes a change to an existing claim, cancellation of an existing claim or addition of a new claim, must include a complete listing of all claims ever presented, including the text of all pending and withdrawn claims, in the application. The claim listing, including the text of the claims, in the amendment document will serve to replace all prior versions of the claims, in the application. In the claim listing, the status of every claim must be indicated after its claim number by using one of the following identifiers in a parenthetical expression: (Original), (Currently amended), (Canceled), (Withdrawn), (Previously presented), (New), and (Not entered).
The correct status of Claim 68 is (Withdrawn, Currently amended).
Election/Restrictions
Applicant has elected without traverse the following species, wherein:
i) alternative target gene is a gene associated with a neurodegenerative disorder, as recited in Claim 70; and
ii) alternative additional decoy RNA structural modification is a modified nucleoside, as recited in Claim 77.
Claims 56, 66, 68-71, 73-74, 76-79, 81, 86, and 89-92 are pending.
Claims 68, 71, 74, 76, 78, 81, and 89-90 are pending but withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a non-elected invention, there being no allowable generic or linking claim.
Claims 56, 66, 69-70, 73, 77, 79, 86, and 91-92 are under consideration.
Priority
This application is a continuation of application 15/771,913, filed April 27, 2018, now abandoned, which is a 371 of PCT/US2016/059399 filed on October 28, 2016. Applicant’s claim for the benefit of a prior-filed application provisional application 62/266805 filed on December 14, 2015 and 62/248119 filed on October 29, 2015 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is acknowledged.
Information Disclosure Statement
Applicant has filed an Information Disclosure Statement on February 13, 2026 that has been considered.
The signed and initialed PTO Forms 1449 are mailed with this action.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
1. The prior rejection of Claims 56, 66-67, 69-70, 73, 75, 77, 79, and 83-88 under 35 U.S.C. 101 is withdrawn in light of Applicant’s amendments to the independent Claim 56, and claim set as a whole.
2. Claims 56, 66, 68-71, 73-74, 76-79, 81, and 86 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception without significantly more.
Claim 56 has been amended to recite the phrase “a nucleotide sequence as set forth in SEQ ID NOs: 1 or 28”.
The breadth of Claim 56 encompasses an enormously vast genus of structurally undisclosed decoy RNA molecules recited at a high level of generality comprising not more than two nucleotides set forth in SEQ ID NO:1 or SEQ ID NO:28,
wherein said decoy RNAs are to achieve:
i) decreased expression of a target gene, recited at a high level of generality, by interfering with the binding between YY1 and a nascent RNA of the target gene (Claim 56);
ii) decreased expression of a target gene, recited at a high level of generality, for which increased transcription is associated with a disease/disorder/condition, recited at a high level of generality, (Claim 69);
iii) decreased expression of a target gene, recited at a high level of generality, for which increased transcription is associated with a neurodegenerative disorder, recited at a high level of generality (Claim 70); and/or
iv) decreased expression of a target gene, recited at a high level of generality, by interfering with the binding between YY1 and a nascent RNA enhancer RNA, promoter RNA, super-enhancer constituent RNA, or a combination thereof, each of which are recited at a high level of generality, of the target gene (Claim 79).
The breadth of the independent claim does not require the decoy RNA to bind to a YY1 binding sequence in the nascent RNA.
The breadth of the claim encompasses a genus of RNA aptamers (e.g. specification, pg 4, line 12, “aptamer”; pg 43, “binds to either the transcription factor (YY1) or the nascent RNA”) that would bind to YY1, thereby interfering with the binding of YY1 and the target nascent RNA.
See also 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, and 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, rejections below.
The specification discloses the decoy RNA [structure 1] has a length of less than 300, 200, or 100 nucleotides, and the synthetic RNA [structure 2] has a length of between 10-300, 10-100, 12-50, or 15-30 nucleotides (e.g. pg 49, lines 3-15).
Thus, the claim encompasses an enormously vast genus of structurally and functionally undisclosed RNA molecules comprising a decoy RNA [structure 1] of about 300 nucleotides and a synthetic RNA [structure 2] of about 300, for a sum of 600 nucleotides or more.
4^600 is infinite.
(www.calculator.net/exponent-calculator.html; last visited August 4, 2025)
Those of ordinary skill in the art would immediately recognize that Applicant simply cannot possess infinity, as such violates natural law of biology, chemistry, and physics. Thus, at best, the claim is considered to be directed to the judicial exception of abstract thought.
This judicial exception is not integrated into a practical application because the additional elements of the claims generally link the use of the judicial exception to a particular technological field of use. The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
Response to Arguments
Applicant argues that the amendments to independent Claim 56 render the prior rejection moot.
Applicant’s argument(s) has been fully considered, but is not persuasive. See discussion in amended 35 U.S.C. 101 rejection.
To the extent Applicant argues for support of SEQ ID NO:1 and/or SEQ ID NO:28, such are only 30 nucleotides in length.
However, the independent claim encompasses an enormously vast genus of structurally and functionally undisclosed RNA molecules comprising 600 nucleotides or more.
4^600 is infinite.
(www.calculator.net/exponent-calculator.html; last visited August 4, 2025)
Those of ordinary skill in the art would immediately recognize that Applicant simply cannot possess infinity, as such violates natural law of biology, chemistry, and physics.
Thus, at best, the claim is considered to be directed to the judicial exception of abstract thought.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
3. The prior rejection of Claim 70 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendment to the claim to limit the disease/disorder/condition to a neurodegenerative disorder, which the Examiner finds persuasive.
4. The prior rejection of Claims 56, 66-71, 73-79, 81, and 83-88 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendments to the independent Claim 56, and claim set as a whole.
5. The prior rejection of Claim 85 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s cancellation of the claim.
6. The prior rejection of Claims 56, 66-71, 73-79, and 81-88 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendments to the independent Claim 56, and claim set as a whole.
7. Claim(s) 56, 66, 69-70, 73, 77, 79, and 86 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 56 has been amended to recite the phrase “a nucleotide sequence as set forth in SEQ ID NOs: 1 or 28”.
As a first matter, the phrase "as" renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d). It is the Examiner’s position that the use of the term “as” renders the targeting domain as an example [emphasis added] and does not exclude other nucleotide sequences. Neither the claims nor the specification disclose what nucleotide sequences are objectively included and/or excluded by “as set forth in”.
As a second matter, the claims recite the phrases “a…sequence set forth in” renders the claims indefinite because the reference SEQ ID NO’s are each composed of a plurality of nucleotide sequences or subsequences, respectively, and it is unclear to which sequence or subsequence “a… set forth in” the reference SEQ ID NO Applicant refers.
The preposition “in”, per “set forth in” does not have the same meaning as the preposition “of”. For example, “in” indicates a location or position within a limit or reference, e.g. a fragment or some portion of the referenced SEQ ID NO.
The house is in Tippecanoe county.
PNG
media_image1.png
120
235
media_image1.png
Greyscale
Three cows are grazing in the field.
PNG
media_image2.png
113
291
media_image2.png
Greyscale
The preposition “of” indicates possession of the reference, characteristic, or trait, that is to say, the entirety of the referenced SEQ ID NO.
To the extent that Applicant is requiring the entirety of the referenced SEQ ID NO, then replacing the phrases “a… sequence set forth in” with the phrase “the… sequence of SEQ ID NO:” would render the rejection moot. See Claims 91-92, for example.
As a third matter, a broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, the claims recite the broad recitation “a…sequence as set forth in SEQ ID NO”, and the claim also recites “SEQ ID NO:1” or “SEQ ID NO:28” which is/are the narrower statement(s) of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
As a fourth matter, the phrase “a… nucleotide acid sequence as set forth in SEQ ID NO…”, which renders the claim indefinite because the referenced SEQ ID NO is composed of a plurality of nucleic acid subsequences, respectively.
The Directors Technology Center 1600 Memorandum, Nucleic Acid and Peptide Claim Interpretation: “A” and “The” (December 29, 2005) informs the TC1600 Examiners that the phrase “A nucleic acid comprising a nucleotide sequence of SEQ ID NO:1” encompasses nucleic acids that comprise any portion of SEQ ID NO:1; whereas, the phrase “A nucleic acid comprising the nucleotide sequence of SEQ ID NO:1” is directed only to nucleic acids that comprise the full length of SEQ ID NO:1.
English has two articles: ‘the’, and ‘a/an’.
‘the’ is a definite article, referring to a specific or particular noun; whereas, ‘a/an’ is an indefinite article, modifying non-specific or non-particular nouns.
To the extent that Applicant is requiring the entirety of the referenced SEQ ID NO, then replacing the phrases “a… sequence set forth in” with the phrase “the… sequence of SEQ ID NO:” would render the rejection moot. See Claims 91-92, for example.
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
The Examiner suggests amending the independent claim cancelling recitation of “a nucleotide sequence set forth in”, and instead recite “the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:28”.
8. Claims 69-70 and 79 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 56 has been amended to recite the phrase “a nucleotide sequence as set forth in SEQ ID NOs: 1 or 28”.
Claim 69 recites wherein the target gene comprises a gene for which increased transcription is associated with a disease/disorder/condition.
Claim 70 recites wherein the disease/disorder/condition is a neurodegenerative disorder.
Claim 79 recites wherein the nascent RNA is an enhancer RNA, a promoter RNA, a super-enhancer constituent RNA, or a combination thereof.
Either the target gene(s) and target nascent RNA(s) of the dependent claims are inherently targeted by the synthetic decoy RNA comprising SEQ ID NO:1 or SEQ ID NO:28 of the independent claim, per natural law of cell biology, or they are not, and something structural of the synthetic decoy RNA of the independent claim must change, concordantly and respectively.
To the extent it is an inherent property of (that naturally flows from) the synthetic decoy RNA of the independent claim, then the instant dependent claim fails to further limit the independent claim.
Furthermore, in regard to instant claims, it is noted that the "wherein" clauses do not recite any additional structure(s) and/or active method step(s), but simply states a characterization or conclusion of the results of synthetic decoy RNA positively recited in the independent claim. Therefore, the "wherein" clause is not considered to further limit the method defined by the claim and has not been given weight in construing the claims. See Texas Instruments, Inc. v. International Trade Comm., 988 F.2d 1165, 1171,26 USPQ2d 1018, 1023 (Fed Cir. 1993) ("A 'whereby' clause that merely states the result of the limitations in the claim adds nothing to the patentability or substance of the claim."). See also Minton v. National Assoc. of Securities Dealers, Inc., 336 F.3d 1373, 1381, 67 USPQ2d 1614, 1620 (Fed. Cir. 2003) ("A whereby clause in a method claim is not given weight when it simply expresses the intended result of a process step positively recited.").
The specification fails to disclose a synthetic decoy RNA comprising the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:28 that is capable of decreasing expression of a target gene (Claim 56), yet does NOT also:
hybridize to a target gene for which increased transcription is associated with a disease/disorder/condition (Claim 69);
wherein the disease/disorder/condition is a neurodegenerative disorder (Claim 70); and/or
wherein the nascent RNA is an enhancer RNA, a promoter RNA, a super-enhancer constituent RNA, or a combination thereof (Claim 79).
'Even if such a phrase did hold patentable weight, the phrase would likely be rejected under 35 USC 112(b) for being indefinite because such a phrase would amount to a 'functional limitation' whereby one of ordinary skill in the art would essentially need to 'guess' what steps must occur in the claim, in addition to the positively-recited method steps, in order to result in 'wherein the....' (the 'intended result' phrase in the claim).
Instant specification discloses the synthetic decoy RNA consisting of the nucleotide sequence of SEQ ID NO:1 hybridizes to the Arid1a promoter (e.g. pg 124).
Instant specification discloses the synthetic RNA comprising the nucleotide sequence of SEQ ID NO:28 is a reverse-complement of SEQ ID NO:1, as shown below:
SEQ ID NO:1/SEQ ID NO:28 (lower)
Qy 1 CUCUUCUCUCUUAAAAUGGCUGCCUGUCUG 30
|:|::|:|:|::||||:|||:|||:|:|:|
Db 30 CTCTTCTCTCTTAAAATGGCTGCCTGTCTG 1
SEQ ID NO:28 hybridizes to the synthetic decoy RNA comprising the nucleotide sequence of SEQ ID NO:1 (e.g. pg 124, “cold competitor”), thereby preventing the synthetic decoy RNA comprising the nucleotide sequence of SEQ ID NO:1 from binding the Arid1a target nucleotide sequence.
SEQ ID NO:28 has the same sequence as the Arid1a promoter, and thus does bind to the nascent Arid1a promoter RNA.
The specification fails to provide objective evidence that the SEQ ID NO:28 30-mer is able to bind YY1 protein, thereby interfering with the binding between a YY1 protein and a nascent RNA, recited at a high level of generality, let alone an Arid1a nascent RNA.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
9. Claim(s) 69-70 and 79 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 56 has been amended to recite the phrase “a nucleotide sequence as set forth in SEQ ID NOs: 1 or 28”.
Claim 69 recites wherein the target gene comprises a gene for which increased transcription is associated with a disease/disorder/condition.
Claim 70 recites wherein the disease/disorder/condition is a neurodegenerative disorder.
Claim 79 recites wherein the nascent RNA is an enhancer RNA, a promoter RNA, a super-enhancer constituent RNA, or a combination thereof.
Either the target gene(s) and target nascent RNA(s) of the dependent claims are inherently targeted by the synthetic decoy RNA comprising SEQ ID NO:1 or SEQ ID NO:28 of the independent claim, per natural law of cell biology, or they are not, and something structural of the synthetic decoy RNA of the independent claim must change, concordantly and respectively.
The claim denotes that not all of the structures/method steps of the independent claim are able to achieve the functional property(ies) recited in the dependent claim(s).
To the extent it is not an inherent property (that naturally flows) from the product/method of the independent claim, then something must change. The claim is considered to lack adequate written description for failing to recite the structure(s) and/or method step(s) that is/are necessary and sufficient to cause the recited functional language in the dependent claims.
The "wherein" clauses do not recite any additional structure(s) and/or active method step(s), but simply states a characterization or conclusion of the results of synthetic decoy RNA positively recited in the independent claim without providing any indication about how the functional characteristic is provided. The functional characteristic(s) does/do not follow from (is/are not an inherent property of) the structure recited in the independent claim, and thus the dependent claims lack adequate written description. The claims fail to recite, and the specification fails to disclose, what structural changes to the synthetic decoy RNA of the independent claim is/are necessary and sufficient to hybridize to the target genes and/or target sequences of dependent Claims 69-70 and 79, and thus the ordinary artisan would not know what modification(s) must be made in order to fulfill the instant recitation.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997).
The specification fails to disclose a synthetic decoy RNA comprising the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:28 that is capable of decreasing expression of a target gene (Claim 56), yet does NOT also:
hybridize to a target gene for which increased transcription is associated with a disease/disorder/condition (Claim 69);
wherein the disease/disorder/condition is a neurodegenerative disorder (Claim 70); and/or
wherein the nascent RNA is an enhancer RNA, a promoter RNA, a super-enhancer constituent RNA, or a combination thereof (Claim 79).
Instant specification discloses the synthetic decoy RNA consisting of the nucleotide sequence of SEQ ID NO:1 hybridizes to the Arid1a promoter (e.g. pg 124).
Instant specification discloses the synthetic RNA comprising the nucleotide sequence of SEQ ID NO:28 is a reverse-complement of SEQ ID NO:1, as shown below:
SEQ ID NO:1/SEQ ID NO:28 (lower)
Qy 1 CUCUUCUCUCUUAAAAUGGCUGCCUGUCUG 30
|:|::|:|:|::||||:|||:|||:|:|:|
Db 30 CTCTTCTCTCTTAAAATGGCTGCCTGTCTG 1
SEQ ID NO:28 hybridizes to the synthetic decoy RNA comprising the nucleotide sequence of SEQ ID NO:1 (e.g. pg 124, “cold competitor”), thereby preventing the synthetic decoy RNA comprising the nucleotide sequence of SEQ ID NO:1 from binding the Arid1a target nucleotide sequence.
SEQ ID NO:28 has the same sequence as the Arid1a promoter, and thus does bind to the nascent Arid1a promoter RNA.
The specification fails to provide objective evidence that the SEQ ID NO:28 30-mer is able to bind YY1 protein, thereby interfering with the binding between a YY1 protein and a nascent RNA, recited at a high level of generality, let alone an Arid1a nascent RNA.
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function … does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is”).
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
10. Claim(s) 56, 66, 69-70, 73, 77, 79, 86, and 91-92 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 56 has been amended to recite the phrase “a nucleotide sequence as set forth in SEQ ID NOs: 1 or 28”.
The Examiner incorporates herein the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, and 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejections.
Instant specification discloses the synthetic decoy RNA consisting of the nucleotide sequence of SEQ ID NO:1 hybridizes to the Arid1a promoter (e.g. pg 124).
Instant specification discloses the synthetic RNA comprising the nucleotide sequence of SEQ ID NO:28 is a reverse-complement of SEQ ID NO:1, as shown below:
SEQ ID NO:1/SEQ ID NO:28 (lower)
Qy 1 CUCUUCUCUCUUAAAAUGGCUGCCUGUCUG 30
|:|::|:|:|::||||:|||:|||:|:|:|
Db 30 CTCTTCTCTCTTAAAATGGCTGCCTGTCTG 1
SEQ ID NO:28 hybridizes to the synthetic decoy RNA comprising the nucleotide sequence of SEQ ID NO:1 (e.g. pg 124, “cold competitor”), thereby preventing the synthetic decoy RNA comprising the nucleotide sequence of SEQ ID NO:1 from binding the Arid1a target nucleotide sequence.
SEQ ID NO:28 has the same sequence as the Arid1a promoter, and thus does bind to the nascent Arid1a promoter RNA.
The specification fails to provide objective evidence that the SEQ ID NO:28 30-mer is able to bind YY1 protein, thereby interfering with the binding between a YY1 protein and a nascent RNA, recited at a high level of generality, let alone an Arid1a nascent RNA.
The specification fails to disclose a synthetic decoy RNA comprising a nucleotide sequence set forth in SEQ ID NO:28 that will necessarily and predictably achieve:
i) decreased expression of a target gene, recited at a high level of generality, by interfering with the binding between YY1 and a nascent RNA of the target gene (Claim 56);
ii) decreased expression of a target gene, recited at a high level of generality, for which increased transcription is associated with a disease/disorder/condition (Claim 69);
iii) decreased expression of a target gene, recited at a high level of generality, for which increased transcription is associated with a neurodegenerative disorder (Claim 70); and/or
iv) decreased expression of a target gene, recited at a high level of generality, by interfering with the binding between YY1 and a nascent RNA enhancer RNA, promoter RNA, super-enhancer constituent RNA, or a combination thereof, of the target gene (Claim 79).
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function … does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is”).
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they also suffer from lack of adequate written description and/or do not correct the primary deficiencies of the independent claim.
11. Claims 56, 66, 69-70, 73, 77, 79, 86, and 92 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement.
The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The Examiner incorporates herein the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, and 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejections.
Claim 56 has been amended to recite the phrase “a nucleotide sequence as set forth in SEQ ID NOs: 1 or 28”.
The breadth of Claim 56 encompasses an enormously vast genus of structurally undisclosed decoy RNA molecules recited at a high level of generality comprising not more than two nucleotides (syn. “a nucleotide sequence”) set forth in SEQ ID NO:1 or SEQ ID NO:28,
wherein said decoy RNAs are to achieve:
i) decreased expression of a target gene, recited at a high level of generality, by interfering with the binding between YY1 and a nascent RNA of the target gene (Claim 56);
ii) decreased expression of a target gene, recited at a high level of generality, for which increased transcription is associated with a disease/disorder/condition, recited at a high level of generality, (Claim 69);
iii) decreased expression of a target gene, recited at a high level of generality, for which increased transcription is associated with a neurodegenerative disorder, recited at a high level of generality (Claim 70); and/or
iv) decreased expression of a target gene, recited at a high level of generality, by interfering with the binding between YY1 and a nascent RNA enhancer RNA, promoter RNA, super-enhancer constituent RNA, or a combination thereof, each of which are recited at a high level of generality, of the target gene (Claim 79).
The breadth of the independent claim does not require the decoy RNA to bind to a YY1 binding sequence in the nascent RNA.
The breadth of the claim encompasses a genus of RNA aptamers (e.g. specification, pg 4, line 12, “aptamer”; pg 43, “binds to either the transcription factor (YY1) or the nascent RNA”) that would bind to YY1, thereby interfering with the binding of YY1 and the target nascent RNA.
Instant specification discloses the synthetic decoy RNA consisting of the nucleotide sequence of SEQ ID NO:1 hybridizes to the Arid1a promoter (e.g. pg 124).
Instant specification discloses the synthetic RNA comprising the nucleotide sequence of SEQ ID NO:28 is a reverse-complement of SEQ ID NO:1, as shown below:
SEQ ID NO:1/SEQ ID NO:28 (lower)
Qy 1 CUCUUCUCUCUUAAAAUGGCUGCCUGUCUG 30
|:|::|:|:|::||||:|||:|||:|:|:|
Db 30 CTCTTCTCTCTTAAAATGGCTGCCTGTCTG 1
SEQ ID NO:28 hybridizes to the synthetic decoy RNA comprising the nucleotide sequence of SEQ ID NO:1 (e.g. pg 124, “cold competitor”), not to the target Arid1a promoter RNA.
The specification fails to disclose a synthetic decoy RNA comprising a nucleotide sequence set forth in SEQ ID NO:28 that will necessarily and predictably achieve:
i) decreased expression of a target gene, recited at a high level of generality, by interfering with the binding between YY1 and a nascent RNA of the target gene (Claim 56);
ii) decreased expression of a target gene, recited at a high level of generality, for which increased transcription is associated with a disease/disorder/condition (Claim 69);
iii) decreased expression of a target gene, recited at a high level of generality, for which increased transcription is associated with a neurodegenerative disorder (Claim 70); and/or
iv) decreased expression of a target gene, recited at a high level of generality, by interfering with the binding between YY1 and a nascent RNA enhancer RNA, promoter RNA, super-enhancer constituent RNA, or a combination thereof, of the target gene (Claim 79).
Vas-cath Inc. v. Mahurkar, 19USPQ2d 1111, clearly states that Applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.'' (See page 1117.) The specification should “clearly allow persons of ordinary skill in the art to recognize that (he or she) invented what is claimed.'' (See Vas-cath at page 1116).
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,’ to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997).
With respect to independent Claim 56, and claims dependent therefrom, the claims are directed to an enormously broad genus of mammalian target cells, and reasonably encompass some 6,400 species (including Humans), distributed in about 1,200 genera, 152 families and up to 46 orders (en.wikipedia.org/wiki/Mammal, last visited August 31, 2022), of which only 240 mammalian species have had their genomes sequenced (DiCorato, Broad Institute, Genomes from 240 mammalian species reveal what makes the human genome unique, April 27, 2023).
The claims are directed to an enormously vast genus of mammalian target genes encoded by the enormously broad genus of mammalian cells, whereby Medline Plus (What is a gene?; medlineplus.gov/genetics/understanding/basics/gene; last visited March 4, 2024) teach that, for example, the number of genes in the human genome is between 20,000 and 25,000 genes.
It is axiomatic that if the remaining 6160 mammalian species, each of which comprising about 20,000 different genes in their genome, respectively, have not yet had their genomes sequenced, then one simply does not know which genes possess a promoter comprising a YY1-binding motif.
Claim 56 recites a genus of target genes comprising a promoter comprising a YY1-binding motif, wherein expression of the target gene is decreased when a decoy RNA comprising a sequence complementary to a YY1 consensus sequence binds to the nascent RNA of said gene.
In the Remarks Made in Amendment (November 18, 2024), Applicant argues that the specification discloses that RNA transcribed from regulatory elements of genes bind to and stabilize transcription factors (YY1) occupying these regulatory elements. Competitor RNAs can compete for binding to YY1, thereby blocking the subsequent binding of YY1 to target RNA by rendering the YY1 consensus binding motif in the nascent RNA inaccessible.
Gordon et al (Transcription factor YY1: structure, function, and therapeutic implications in cancer biology, Oncogene 25: 1125-1142, 2006) is considered relevant prior art for having taught that YY1 acts as a transcriptional activator for some target genes (Figures 7-9), but a transcriptional repressor for other target genes (e.g. Figures 4-6).
The claims fail to recite, and the specification fails to disclose, the subgenus of target genes comprising a promoter comprising a YY1-binding motif, wherein expression of the target gene is decreased when a decoy RNA comprising a sequence complementary to a YY1 consensus sequence binds to the nascent RNA of said gene, as opposed to the subgenus of target genes comprising a promoter comprising a YY1-binding motif, wherein expression of the target gene is increased when a decoy RNA comprising a sequence complementary to a YY1 consensus sequence binds to the nascent RNA of said gene.
The claims fail to recite, and the specification fails to disclose, the subgenus of target genes comprising a promoter comprising a YY1-binding motif whose nascent RNA is bound by YY1 and wherein expression of the target gene is decreased when a decoy RNA comprising a sequence complementary to a YY1 consensus sequence binds to the nascent RNA of said gene, as opposed to the subgenus of target genes comprising a promoter comprising a YY1-binding motif whose nascent RNA is bound by YY1 and wherein expression of the target gene is increased when a decoy RNA comprising a sequence complementary to a YY1 consensus sequence binds to the nascent RNA of said gene.
The claims fail to recite, and the specification fails to disclose, the genus and/or subgenus of target genes comprising a promoter comprising a YY1-binding motif whose nascent RNA is bound by YY1, as opposed to the genus and/or subgenus of target genes comprising a promoter comprising a YY1-binding motif whose nascent RNA is not bound by YY1.
Essentially, Applicant is requiring the ordinary artisan to discover and invent for themselves that which Applicant simply does not possess, nor has disclosed.
The claims are directed to an enormously vast genus of structurally and functionally undisclosed decoy RNAs.
Instant amended Claim 56 does not require the RNA molecule to bind to a YY1 consensus binding motif of the nascent RNA, but rather may bind any sequence within the nascent RNA.
The limitation “interferes with binding between a YY1 protein and the nascent RNA” is recited at a high level of generality and includes both direct and indirect means by which the binding between a YY1 protein and the nascent RNA is abrogated or reduced.
The specification discloses the decoy RNA [structure 1] has a length of less than 300, 200, or 100 nucleotides, and the synthetic RNA [structure 2] has a length of between 10-300, 10-100, 12-50, or 15-30 nucleotides (e.g. pg 49, lines 3-15).
The claim encompasses an enormously vast genus of structurally and functionally undisclosed RNA molecules comprising a decoy RNA [structure 1] of about 300 nucleotides and a synthetic RNA [structure 2] of about 300, for a sum of 600 nucleotides or more.
4^600 is infinite.
4^360 = about 5x10^216 structurally and functionally undisclosed RNA molecules.
4^350 = about 5x10^210 structurally and functionally undisclosed RNA molecules.
4^330 = about 5x10^198 structurally and functionally undisclosed RNA molecules.
4^315 = about 4x10^189 structurally and functionally undisclosed RNA molecules.
4^250 = about 3x10^150 structurally and functionally undisclosed RNA molecules.
4^200 = about 2x10^120 structurally and functionally undisclosed RNA molecules.
4^150 = about 2x10^90 structurally and functionally undisclosed RNA molecules.
4^100 = about 1x10^60 structurally and functionally undisclosed RNA molecules.
(www.calculator.net/exponent-calculator.html; last visited August 4, 2025)
Those of ordinary skill in the art would immediately recognize that Applicant simply cannot possess infinity, as such violates natural law of biology, chemistry, and physics. See also 35 U.S.C. 101 rejection above.
4^60 = about 1x10^36 structurally and functionally undisclosed RNA molecules.
4^50 = about 1x10^30 structurally and functionally undisclosed RNA molecules.
4^30 = about 1x10^18 structurally and functionally undisclosed RNA molecules.
Thus, the claims reasonably encompass an infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA molecules.
Perry et al (The architecture of mammalian ribosomal protein promoters, BMC Evolutionary Biology 5(15): 18 pages, doi:10.1186/1471-2148-5-15; 2005) is considered relevant prior art for having taught the Rpl30 promoter comprises a YY1 binding site comprising a YY1 consensus binding sequence of only 6 nucleotides, to wit, GCCATC (e.g. Figure 2b; last page).
Thus, it would appear that the decoy RNA must minimally comprise at least a 4-, 6-, or 9-nucleotide sequence motif.
While Claim 85 recites reference SEQ ID NO’s 1, 4, or 18 (each 30nt in length), the claim refers to a sequence complementary to the YY1 consensus binding motif set forth in SEQ ID NO’s 1, 4, or 18. The claim does not require the decoy RNA to comprise a nucleotide sequence complementary to the entirety of SEQ ID NO’s 1, 4, or 18.
A 10nt decoy RNA comprising at least 6 known nucleotides of a YY1 binding motif allows for a genus of an additional 4 unknown nucleotides, which is a genus of 256 structurally structurally and functionally decoy RNAs.
A 12nt decoy RNA comprising at least 6 known nucleotides of a YY1 binding motif allows for a genus of an additional 6 unknown nucleotides, which is a genus of 4096 structurally structurally and functionally decoy RNAs.
A 15nt decoy RNA comprising at least 6 known nucleotides of a YY1 binding motif allows for a genus of an additional 9 unknown nucleotides, which is a genus of 2x10^5 structurally and functionally undisclosed decoy RNAs.
A 30nt decoy RNA comprising at least 6 known nucleotides of a YY1 binding motif allows for a genus of an additional 24 unknown nucleotides, which is a genus of 2x10^14 structurally and functionally undisclosed decoy RNAs.
A 50nt decoy RNA comprising at least 6 known nucleotides of a YY1 binding motif allows for a genus of an additional 44 unknown nucleotides, which is a genus of 3x10^26 structurally and functionally undisclosed decoy RNAs.
A 60nt decoy RNA comprising at least 6 known nucleotides of a YY1 binding motif allows for a genus of an additional 54 unknown nucleotides, which is a genus of 3x10^54 structurally and functionally undisclosed decoy RNAs.
A 100nt decoy RNA comprising at least 6 known nucleotides of a YY1 binding motif allows for a genus of an additional 94 unknown nucleotides, which is a genus of 4x10^56 structurally undisclosed decoy RNAs.
A 200nt decoy RNA comprising at least 6 known nucleotides of a YY1 binding motif allows for a genus of an additional 194 unknown nucleotides, which is a genus of 6x10^116 structurally and functionally undisclosed decoy RNAs.
A 300nt decoy RNA comprising at least 6 known nucleotides of a YY1 binding motif allows for a genus of an additional 294 unknown nucleotides, which is a genus of 1x10^177 structurally and functionally undisclosed decoy RNAs.
(https://www.calculator.net/exponent-calculator.html; last visited January 16, 2025)
The claims are directed to an infinite and/or an enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, 4096, and/or 256 structurally and functionally undisclosed decoy RNAs [structures] that are to have the functional property of binding to a nascent RNA transcript from said enormously vast genus of structurally undisclosed mammalian target genes comprising a promoter comprising a YY1-binding motif so as to necessarily and predictably interfere with binding between YY1 and the nascent RNA, thereby decreasing expression of the enormously vast genus of structurally undisclosed mammalian target genes.
Essentially, Applicant is requiring the ordinary artisan to discover and invent for themselves that which Applicant simply does not possess, nor has disclosed.
The claims fail to recite, and the specification fails to disclose, the structure/function nexus of the infinite and/or enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, 4096, and/or 256 structurally and functionally undisclosed decoy RNA nucleotide sequences that necessarily and predictably have the functional properties of binding to a nascent RNA transcript from said enormously vast genus of structurally undisclosed mammalian target genes comprising a promoter comprising a YY1-binding motif so as to necessarily and predictably interfere with binding between YY1 and the nascent RNA, thereby decreasing expression of the enormously vast genus of structurally undisclosed mammalian target genes.
The claims fail to recite, and the specification fails to disclose, a first RNA decoy nucleotide sequence of the infinite and/or enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, 4096, and/or 256 structurally and functionally undisclosed decoy RNA nucleotide sequences that necessarily and predictably have the functional properties of binding to a nascent RNA transcript from said enormously vast genus of structurally undisclosed mammalian target genes comprising a promoter comprising a YY1-binding motif so as to necessarily and predictably interfere with binding between YY1 and the nascent RNA, thereby decreasing expression of the enormously vast genus of structurally undisclosed mammalian target genes, as opposed to a second RNA decoy nucleotide sequence of the infinite and/or enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, 4096, and/or 256 structurally and functionally undisclosed decoy RNA nucleotide sequences that does not have the functional properties of binding to a nascent RNA transcript from said enormously vast genus of structurally undisclosed mammalian target genes comprising a promoter comprising a YY1-binding motif.
The claims fail to recite, and the specification fails to disclose, how to transform or otherwise modify a first RNA decoy nucleotide sequence of the infinite and/or enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, 4096, and/or 256 structurally and functionally undisclosed decoy RNA nucleotide sequences that does not have the functional properties of binding to a nascent RNA transcript from said enormously vast genus of structurally undisclosed mammalian target genes comprising a promoter comprising a YY1-binding motif, into a second RNA decoy nucleotide sequence of the infinite and/or enormously vast genus of1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, 4096, and/or 256 structurally and functionally undisclosed decoy RNA nucleotide sequences that now necessarily and predictably has the functional properties of binding to a nascent RNA transcript from said enormously vast genus of structurally undisclosed mammalian target genes comprising a promoter comprising a YY1-binding motif so as to necessarily and predictably interfere with binding between YY1 and the nascent RNA, thereby decreasing expression of the enormously vast genus of structurally undisclosed mammalian target genes.
Essentially, Applicant is requiring the ordinary artisan to discover and invent for themselves that which Applicant simply does not possess, nor has disclosed.
Belak et al (Assembly of the Yin Yang 1 Transcription Factor into Messenger Ribonucleoprotein Particles Requires Direct RNA Binding Activity, J. Biol. Chem. 282(52): 37913-37920, 2007) is considered relevant prior art for having taught that high affinity RNA substrates are able to inhibit YY1-mRNP assembly in vivo (e.g. pg 37918, col. 2).
Belak et al taught that YY1 displayed sequence specificity in its RNA-binding characteristics, with high affinity for A:U duplexes and single-stranded U-rich regions, on the same order as affinity for its DNA consensus site (pg 37919, col. 1).
Belak et al taught that the minimal length of single-stranded RNA substrate for YY1-binding is 11 nucleotides (pg 37918, col. 2).
The A:U duplexes and single-stranded U-rich RNA nucleic acids of Belak et al do not structurally and/or functionally fulfill the instantly recited decoy RNA that is to comprise a nucleotide sequence complementary to a YY1 consensus binding motif, nor blocks the binding of YY1 to nascent RNA by rendering the YY1 consensus motif in the nascent RNA inaccessible.
Belak et al taught that very low affinity was observed for RNA complementary to YY1 promoter consensus sequences (pg 37919, col. 1).
Instant claims fail to recite the dosage or amount of the decoy RNA that is to be introduced into a given target host mammalian cell, neither in vitro nor in vivo, so as to necessarily and predictably achieve decreased expression of the target gene.
Essentially, Applicant is requiring the ordinary artisan to discover and invent for themselves that which Applicant simply does not possess, nor has disclosed.
The Examiner notes that even with a 9-nucleotide sequence complementary to a YY1 consensus binding motif present in the decoy RNA, the genus of decoy RNA comprise:
an additional 21 undisclosed nucleotides (30nt decoy RNA);
an additional 41 undisclosed nucleotides (50nt decoy RNA);
an additional 51 undisclosed nucleotides (60nt decoy RNA);
an additional 91 undisclosed nucleotides (100nt decoy RNA);
an additional 191 undisclosed nucleotides (200nt decoy RNA);
an additional 291 undisclosed nucleotides (300nt decoy RNA);
Applicant fails to disclose how the mere 9 nucleotide sequence will necessarily and predictably be dispositive and controlling for a decoy RNA molecule comprising the additional 21, 41, 51, 91, 191, and/or 291 structurally undisclosed nucleotides present in the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs to necessarily and predictably achieve the binding of the decoy RNA to the enormous genus of structurally undisclosed nascent RNAs transcribed from a promoter comprising a YY1-binding motif.
Jackson et al (Widespread siRNA ‘‘off-target’’ transcript silencing mediated by seed region sequence complementarity RNA 12: 1179-1187, 2006) is considered relevant prior art for having taught that base mismatches of the RNA reduced hybridization to the on-target sequence, and instead generated off-target hybridization with sequences complementary to the mismatched sequence (e.g. Abstract). Complementarity to nucleotides centrally within the RNA oligonucleotide can generate off-target hybridization (e.g. pg 1180, col. 1). Furthermore, not all transcripts with at least 7 nucleotides of sequence complementarity to the seed region of an siRNA molecule are actually silenced by siRNAs and shRNAs. Rather, functional targets contain additional specificity determinants (e.g. pg 1185, col. 1).
Naiser et al (Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges, BMC Biotechnol. 8(48): 23 pages, doi: 10.1186/14712-6750-8-48, 2008) is considered relevant prior art for having taught nucleic acid hybridization experiments using oligonucleotides varying in length from 16 to 40 nucleotides (e.g. Abstract).
Naiser et al taught that nucleotide mismatches located centrally within the oligonucleotide significantly negatives hybridization to a target sequence (e.g. Figure 1, “defect position”; Figure 2, “mismatch base position”).
Naiser et al taught that in addition to the hybridization defects caused by single nucleotide mismatches or bulges that negative hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify (e.g. Abstract).
Zhang et al (Optimizing the specificity of nucleic acid Hybridization, Nature Chemistry 4: 208-214, 2012) is considered relevant prior art for having taught that specific hybridization of complementary sequences is an essential property of nucleic acids; however, the specificity of hybridization is compromised for long strands. The hybridization of long nucleic acids may be non-specific, except near the melting temperatures, whereby those of ordinary skill in the art immediately recognize that such high temperatures do not exist in living cells (e.g. Abstract, Introduction).
Nowak et al (The transcription factor Yin Yang 1 is an activator of BACE1 expression, J. Neurochem. 96: 1696-1707, 2006) is considered relevant prior art for having taught YY1 decoy DNA oligonucleotides, wherein said YY1 decoy DNA oligos interfere with the binding of YY1 to a promoter of a target gene whose promoter comprises an YY1-binding motif (e.g. pg 1698, col. 2), wherein said DNA decoy oligos are 31 nucleotides in length.
Nowak et al taught that YY1 binds the decoy DNA oligos in vitro (e.g. mobility shift assays; Figure 2), and transfection of the double-stranded DNA decoy oligonucleotides reduced promoter strength in a dose-dependent manner in vitro cultured cells (e.g. pg 1700, col. 2).
Nowak et al differs from the instantly claimed invention in that:
the YY1 decoy oligonucleotides are DNA, not RNA;
the YY1 decoy DNA oligonucleotides do not hybridize to the nascent RNA of the target gene, nor the YY1 binding motif of the target gene promoter; and
the YY1 decoy DNA oligonucleotides squelch YY1 protein, acting as a sponge, so to speak, thereby preventing YY1 protein from binding to the YY1 binding motif of the target gene promoter.
Nowak et al taught that for targeting the expression of a specific target gene, one needs to use the target gene-specific YY1 decoy oligonucleotides (e.g. pg 1703, col. 2).
The instant specification discloses the synthesis of double-stranded DNA oligonucleotides of 30 nucleotides in length to detect YY1 binding via in vitro mobility shift assays (e.g. pgs 122-123), wherein the dsDNA oligos include the YY1 binding motif present in the Rpl30 promoter (e.g. SEQ ID NO:17 and 18; GGCCATCTT).
Becker et al (Binding of the ubiquitous nuclear transcription factor YY1 to a cis
regulatory sequence in the human LINE-1 transposable element, Human Mol. Genet. 2(10): 1697-1702, 1993) is considered relevant prior art for having taught the Rpl30 and L1Hs promoters comprise a YY1 binding site comprising a YY1 consensus binding sequence of GGCCATCTT (e.g. Figure 1).
Becker et al, like Applicant, taught the synthesis of double-stranded DNA oligonucleotides of 40 nucleotides in length to detect YY1 binding via in vitro mobility shift assays (e.g. pg 1701, col. 2, Methods; Figures 3-6), wherein the dsDNA oligos include the YY1 binding motif present in the Rpl30 and L1Hs promoters, said YY1 binding motif being also present in SEQ ID NO:17 and 18.
Becker et al do not teach synthesis of a decoy RNA oligonucleotides [structures] comprising a nucleotide sequence complementary to a YY1-binding motif present in the Rpl130 promoter or SEQ ID NO:17 and/or 18, nor that such a decoy RNA has the functional properties of hybridizing to nascent RNA and blocking the subsequent binding of YY1 to target RNA by rendering the YY1 consensus binding motif in the nascent RNA inaccessible, thereby decreasing expression of the target gene [functions].
Kenten et al (US 2003/0207290) is considered relevant prior art for having disclosed a double-stranded DNA oligonucleotide probe of 37 nucleotides in length (Example 15, [0225-227] comprising the YY1 binding motif present in instant SEQ ID NO:17 and 18, as shown below:
Qy ACACCAGCCGCCAAGATGGCCGGGGAGCGA
||||||||||||||||||||
Db 37 ACCAGCCGCCAAGATGGCCG 18 (SIN:15)
Db 1 ACCAGCCGCCAAGATGGCCG 20 (SIN:16)
Kenten et al, like Applicant, disclosed the use of the dsDNA oligonucleotide probe to detect proteins that bind DNA more specifically, YY1 proteins binding to target sequence.
Kenten et al do not disclose synthesis of a decoy RNA oligonucleotides [structures] comprising a nucleotide sequence complementary to a YY1-binding motif present in the Rpl130 promoter or SEQ ID NO:17 and/or 18, nor that such a decoy RNA has the functional properties of hybridizing to nascent RNA and blocking the subsequent binding of YY1 to target RNA by rendering the YY1 consensus binding motif in the nascent RNA inaccessible, thereby decreasing expression of the target gene [functions].
Bentwich et al (U.S. 2006/0257851) disclosed a miRNA (SEQ ID NO:372085) (lower line) comprising a reverse complement nucleotide sequence within instant SEQ ID NO:18 (upper line), as shown below
Qy ACACCAGCCGCCAAGATGGCCGGGGAGCGA
|||||||||||||||
Db 28 ATGGCCGGGGAGCGA 14
However, Bentwich et al disclosed the miRNA targets one or more viral genes (VGAM), e.g HIV-1 or vaccinia (Figures 1, 9, 11, 16a; [0065, 229]).
As discussed above, the specification discloses the minimal YY1 consensus binding motif is ATGG (pg 10, line 1, bolded), which the miRNA of Bentwich et al comprises.
As discussed above, Perry et al taught the Rpl30 promoter comprises a YY1 binding site comprising a YY1 consensus binding sequence of GCCATC, for which the miRNA of Bentwich et al is deficient by just 1 nucleotide.
Thus, while the miRNA comprises a 14 nucleotide sequence that is 100% complementary to a nascent RNA molecule transcribed from a promoter comprising a YY1-binding motif, to wit, Rpl30, as provided in instant SEQ ID NO:18, and thus has at least 10nt (Claim 60), 12nt (Claim 75), and being 1nt short of 15nt (Claim 83), and having 100% complementarity to an Rpl30 nascently transcribed RNA, thereby fulfilling most, if not all, of the structural requirements of the claims [structure], said miRNA is directed to the nascent RNAs of viral target genes, not nascent RNAs of target genes whose promoters comprise a YY1-binding motif, and thus does not appear to satisfy the instantly recited functional properties of hybridizing to nascent RNA and blocking the subsequent binding of YY1 to target RNA by rendering the YY1 consensus binding motif in the nascent RNA inaccessible, thereby decreasing expression of the target gene [functions].
The Examiner notes that there is no objective evidence that the YY1 binding motif “AAG” and/or “G” nucleotide(s) absent from the Bentwhich et al miRNA are dispositive and controlling for binding to an Rpl30 nascently transcribed RNA, thereby fulfilling the structural and functional requirements of the claims, given that there an additional 9 nucleotides present in said miRNA that also have 100% complementary to a nascent RNA molecule transcribed from a promoter comprising a YY1-binding motif, to wit, Rpl30.
Gilbert et al (U.S. 2017/0204407; filed July 14, 2015) is considered relevant prior art for having disclosed methods of modulating the transcription of a target gene, the method comprising the use of the CRISPR/Cas system, wherein the Cas enzyme is nuclease-deficient [0006]. Gilbert et al disclose an sgRNA (e.g. SEQ ID NO:696053) whose nucleotide sequence comprises at least 14 nucleotides 100% complementary to instant SEQ ID NO:18, including a YY1-binding motif, as shown below:
Qy 9 CGCCAAGATGGCCG 22
||||||||||||||
Db 15 CGCCAAGATGGCCG 2
Gilbert et al disclosed the sgRNA molecule may comprise between 33-220 nucleotides in length (e.g. [0075], 15-45nt 5’ hairpin; [0078], 10-50nt intervening sequence; [0079], 3-25nt 3’ hairpin; [0081], 5-100nt target-specific binding sequence).
Rich et al (U.S. 2017/0165376) is considered relevant art for having disclosed aptamers being 200, 100, 50, 40, or 35 nucleotides in length (e.g. [0030]).
Doyle et al (U.S. Patent 8,105,982) is considered relevant prior art for having disclosed aptamers being 20-50 nucleotides in length (e.g. col. 4, lines 13-14), whereby the aptamers may have an enormous range of binding affinities to its corresponding target molecule, ranging from as low as 10^-4 M, 10^-5 M, 10^-6M, 10^-8M, or 10^-9M (col. 12, lines 5-7; col 14, lines 1-2), a range of at least 5 orders of magnitude.
4^200 = about 2x10^120 structurally undisclosed aptamers.
4^150 = about 2x10^90 structurally undisclosed aptamers.
4^100 = about 1x10^60 structurally undisclosed aptamers.
4^75 = about 1x10^45 structurally undisclosed aptamers.
4^50 = about 1x10^30 structurally undisclosed aptamers.
4^30 = about 1x10^18 structurally undisclosed aptamers.
Cho et al (Quantitative selection and parallel characterization of aptamers, PNAS 110(46): 18460-18465, 2013) is considered relevant prior art for having taught that, while aptamers with high affinity and specificity have been previously reported for a wide range of molecular targets, including proteins, and that recent advances in selection and sequencing techniques have greatly increased the efficiency of aptamer discovery, despite these advances, the generation of high-quality aptamers remains a time-consuming and low-throughput process (pg 18460, Introduction). Screening a library of 10^14 molecules (pg 18464, col. 1, Methods) yielded only about 235 initial candidate aptamers, of which only 8 possessed sufficient high affinity to their target (e.g. Figure 3).
Thus, it is considered undue experimentation to synthesize and screen the enormously vast genus of about 2x10^120, 2x10^90, 1x10^60, 1x10^45, 1x10^30, and/or 1x10^18 structurally undisclosed aptamer sequences that are to have the functional property of binding to YY1 or some other structurally undisclosed transcription factor, thereby interfering with the binding between YY1 and the nascent RNA.
Thus, while the RNA molecule of Gilbert et al comprises a 14 nucleotide sequence that is 100% complementary to a nascent RNA molecule transcribed from a promoter comprising a YY1-binding motif, to wit, Rpl30, as provided in instant SEQ ID NO:18, and having 100% complementarity to an Rpl30 nascently transcribed RNA, thereby fulfilling most, if not all, of the structural requirements of the claims [structure], said miRNA is directed to the nascent RNAs of viral target genes, not nascent RNAs of target genes whose promoters comprise a YY1-binding motif, and thus does not appear to satisfy the instantly recited functional properties of hybridizing to nascent RNA and blocking the subsequent binding of YY1 to target RNA by rendering the YY1 consensus binding motif in the nascent RNA inaccessible, thereby decreasing expression of the target gene [functions].
While it is clear that Applicant has synthesized DNA and RNA oligonucleotides that are able to bind YY1 protein in vitro, e.g. as used in mobility shift assays (pgs 122-124), the specification is silent to the synthesis of a decoy RNA comprising a nucleotide sequence that is complementary to a YY1 binding motif, wherein said decoy RNA is introduced into a target cell, in vitro, let alone in vivo, thereby necessarily and predictably achieving the recited functional properties of hybridizing to nascent RNA and blocking the subsequent binding of YY1 to target RNA by rendering the YY1 consensus binding motif in the nascent RNA inaccessible, thereby decreasing expression of the target gene.
Neither the prior art nor the instant specification teach/disclose such decoy RNA structures having the recited functional properties.
Essentially, Applicant is requiring the ordinary artisan to discover and invent for themselves that which Applicant simply does not possess, nor has disclosed.
The specification fails to make up for the deficiencies of the global scientific community.
The breadth of the claims encompasses contacting the enormously broad genus of mammalian cells into which, be it in vitro or in vivo, the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs are to be introduced.
The specification discloses the route of administration may include, but is not limited to, rectal, intestinal, or intraperitoneal delivery. Other suitable routes may include various forms of parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraarticular, intra-sternal, intra-synovial, intra-hepatic, intralesional, intracranial, intraperitoneal, intranasal, or intraocular injections or other modes of delivery (e.g. pg 100, lines 15-19).
Claim 56 recites a decoy RNA comprising an RNA sequence complementary to a YY1 consensus binding motif, wherein the decoy RNA binds to a nascent RNA transcribed from a regulatory element of a target gene.
Claims 69-70 recite wherein the target gene is, upon increased transcription, associated with, either directly or however indirectly, an enormous genus of etiologically and pathologically distinct diseases, disorders, or conditions, including but not limited to a neurodegenerative disorder.
The claims fail to recite, and the specification fails to disclose, the structure/function nexus of the enormously vast genus of structurally undisclosed mammalian genes whose promoter comprises a YY1 consensus binding motif, whereupon increased transcription, said enormously vast genus of structurally undisclosed mammalian genes are necessarily and predictably associated with a disease, disorder, and/or condition, including, but not limited to, cancer, a genetic disorder, a liver disorder, a neurodegenerative disorder, and/or an autoimmune disease, as opposed to the enormously vast genus of structurally undisclosed mammalian genes whose promoter comprises a YY1 consensus binding motif, whereupon increased transcription, said enormously vast genus of structurally undisclosed mammalian genes are not associated with a disease, disorder, and/or condition, including, but not limited to, cancer, a genetic disorder, a liver disorder, a neurodegenerative disorder, and/or an autoimmune disease.
It is considered axiomatic natural law of chemistry and biology that a decoy RNA comprising an RNA sequence complementary to a YY1 consensus binding motif will inherently and naturally bind to any and all nascent RNAs transcribed from a regulatory element of the one or more genes whose regulatory element(s) encode a YY1 binding motif.
To put it another way, a decoy RNA comprising an RNA sequence complementary to a YY1 consensus binding motif will inherently, naturally, and simultaneously bind to any and all nascent RNAs transcribed from a regulatory element of the one or more genes whose regulatory element(s) encode a YY1 binding motif, e.g. genome-wide downregulation of the YY1-regulated transcriptome, including the target genes recited at a high level of generality in Claim 54 and the disease/disorder/condition-associated target genes recited at a high level of generality in Claims 69-70.
To the extent that Applicant argues that the ability of the decoy RNA of Claim 56 to bind to the target gene(s) of Claims 69-70 recited at a high level of generality is not an inherent property of (that naturally flows from) the decoy RNA comprising an RNA sequence complementary to a YY1 consensus binding motif [structure] of independent Claim 56, then something structural of the decoy RNA of independent Claim 56 must change. See discussion above discussing the enormously broad genus of mammalian cells into which, be it in vitro or in vivo, the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs. See additional discussion below.
Claims 69-70 are directed to an enormously vast genus of mammalian target genes encoded by the enormously broad genus of mammalian cells, wherein said enormously vast genus of mammalian target genes have the functional property(ies) of, upon increased transcription (e.g. increase, decrease, mis-expression), being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder (Claim 70).
The claims reasonably encompass essentially any and all diseases, disorders and/or conditions that are associated with, directly or however indirectly, increased, decreased, or mis-expression of each of the enormously vast genus of mammalian target genes.
Malacards: The Human Disease Database (doi: dx.doi.org/10.5195/jmla.2018.253; January 2018; of record) is considered relevant art for teaching that there are more than 26,000 known human diseases.
Brown et al (Neurodegenerative Diseases: An Overview of Environmental Risk Factors, Environ Health Perspect. 113(9): 1250–1256, 2005; of record) is considered relevant art for teaching that there are more than 600 known human neurologic or neurodegenerative disorders.
The claims fail to recite, and the specification fails to disclose, the structure/function nexus of the enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes that necessarily and predictably have the functional property(ies) of, upon increased or aberrant transcription (e.g. increase, mis-expression), being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder.
The claims fail to recite, and the specification fails to disclose, a first mammalian target gene of the enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes that, upon increased or aberrant transcription (e.g. increase, decrease, mis-expression), is/are associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition is a neurodegenerative disorder, as opposed to a second mammalian target gene of the enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes that, upon increased or aberrant transcription (e.g. increase, mis-expression), is/are not associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder.
The claims fail to recite, and the specification fails to disclose, a first decoy RNA of the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs that necessarily binds to the enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes in the enormously broad genus of 6,400 mammalian species that necessarily and predictably have the functional property(ies) of, upon increased or aberrant transcription (e.g. increase, mis-expression), being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder, as opposed to a second decoy RNA of the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs that necessarily binds to the enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes in the enormously broad genus of 6,400 mammalian species that, while capable of binding to a nascent RNA of a target gene whose promoter comprises a YY1 binding motif, said target gene(s) do/does not have the functional property(ies) of, upon increased or aberrant transcription (e.g. increase, mis-expression), being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder.
Essentially, Applicant is requiring the ordinary artisan to discover and invent for themselves that which Applicant simply does not possess, nor has disclosed.
The specification fails to make up for the deficiencies of the global scientific community.
The claimed method denotes a therapeutic effect upon administering the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs to the enormous genus of mammalian subjects whose cells comprise an enormous genus of structurally undisclosed target genes for which increased or aberrant transcription is associated with a disease, condition, or disorder.
The claims fail to recite, and the specification fails to disclose, a first RNA decoy dosage administered via a first administration route, e.g. subcutaneously, that is necessarily and predictably able to:
bind to a nascent RNA transcribed from a regulatory element of an enormous genus of structurally undisclosed target genes being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder;
interfere with binding between YY1 and the nascent RNA;
promotes decreased expression of the target gene; and/or
thereby achieving a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans, as opposed to a second decoy RNA dosage administered via a second administration route, e.g. intravenously, that is unable to:
bind to a nascent RNA transcribed from a regulatory element of an enormous genus of structurally undisclosed target genes being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder;
interfere with binding between YY1 and the nascent RNA;
promotes decreased expression of the target gene; nor
achieve a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans, for example.
The claims fail to recite, and the specification fails to disclose, what modification(s) to a first RNA decoy dosage administered via a first administration route, e.g. subcutaneously, that is unable to:
bind to a nascent RNA transcribed from a regulatory element of an enormous genus of structurally undisclosed target genes being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder;
interfere with binding between YY1 and the nascent RNA;
promotes decreased expression of the target gene; nor
achieve a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans, transforms said first decoy RNA dosage and/or first administration route into one that is now necessarily and predictably able to:
bind to a nascent RNA transcribed from a regulatory element of an enormous genus of structurally undisclosed target genes being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder;
interfere with binding between YY1 and the nascent RNA;
promotes decreased expression of the target gene; and/or
achieve a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans, for example.
The instant specification fails to disclose a working example whereby a decoy RNA having the recited structural and functional properties is contacted with a mammalian cell in vitro so as to achieve the recited result of decreasing expression of the target gene.
The instant specification fails to disclose a working example whereby a decoy RNA having the recited structural and functional properties is contacted with a mammalian cell in vivo so as to achieve the recited result of decreasing expression of the target gene, and thus is therapeutic for the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects.
Essentially, Applicant is requiring the ordinary artisan to discover and invent for themselves that which Applicant simply does not possess, nor has disclosed.
The specification fails to make up for the deficiencies of the global scientific community.
The Examiner notes that breadth of the claims encompass genome-wide downregulation of the YY1-regulated transcriptome via simultaneous binding of the generically recited decoy RNAs comprising an RNA sequence complementary to a YY1 consensus binding motif to all nascent RNAs transcribed from a regulatory element of the one or more genes whose regulatory element(s) encode a YY1 binding motif. However, the specification fails to disclose, and the prior art does not teach, the use of a decoy RNA molecule to necessarily and predictably achieve genome-wide transcriptome silencing of an enormous genus of structurally undisclosed target genes being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder, thereby achieving a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans.
Essentially, Applicant is requiring the ordinary artisan to discover and invent for themselves that which Applicant simply does not possess, nor has disclosed.
The specification fails to make up for the deficiencies of the global scientific community.
Riquet et al (YY1 Is a Positive Regulator of Transcription of the Col1a1 Gene, J. Biol. Chem. 276(42): 38665-38672, 2001; of record in parent application 15/771,913) is considered relevant prior art for having taught that the mouse collagen 1a1 gene comprises a promoter comprising a YY1-binding motif (e.g. Figure 1). Riquet et al are silent to a decoy RNA having the structural and functional properties recited in the instant claims.
Maston et al (Transcriptional Regulatory Elements in the Human Genome, Ann. Rev. Genomics Hum. Genet. 7: 29-59, 2006; of record in parent application 15/771,913) is considered relevant prior art for having taught that one of the main emerging challenges for genomics research is to identify all functional elements in the genome, including those that regulate gene expression (pg 30, col. 1). The structure of human gene promoters can be quite complex, typically consisting of multiple transcriptional regulatory elements. The presence of multiple regulatory elements within promoters confers combinatorial control of regulation, which exponentially increases the potential number of unique expression patterns. Such transcriptional regulatory elements include locus control regions (LCRs), insulators, silencers, enhancer, the core promoter, and proximal promoter elements (Figure 1), whereby the distal elements such as LCRs, insulators, silencers, and enhancers may well be over 1 megabase (1 million nucleotides in length) away from the promoter. These regulatory elements can be widely dispersed from the corresponding target gene each regulates (pg 42, col. 2). Identifying the promoter of a specific target gene can be a challenge because the core promoter is often distantly located from the first coding exon (pg 45, col. 1). In addition, because promoters can contain any one of a number of combinations of core promoter elements [and, conversely, many promoters have only one or no such elements (68)], simply searching for the co-occurrence of known core promoter motifs has had only limited success (pg 45, col. 2). Although much improved over earlier prediction programs, these methods still have limited sensitivity and specificity when applied to genome-scale sequence data (pg 45, col. 2). While a number of bioinformatics approaches attempt to list potential transcription factor binding sites based on a statistical match between a region in the sequence and a site matrix. This analysis is often hampered by the prediction of a large number of sites, a significant fraction of which are likely false positives. In addition to the false-positive problem, the completeness of these databases is also an issue; it is likely that not all DNA-binding transcription factors have been identified, and even for some known factors, their binding specificity has not yet been fully characterized. (pg 46, col. 2). Transcription factor binding sites are small and degenerate, are often located distantly from the promoter upon which they act, and are not always conserved through evolution. These properties make regulatory elements difficult to identify through computational means alone (pg 48, col. 2).
Similarly, Thakurta (Computational identification of transcriptional regulatory elements in DNA sequence, Nucleic Acids Res. 34(12): 3585-3598, 2006; of record in parent application 15/771,913) is considered relevant prior art for having taught that identification and annotation of all the functional elements in the genome, including genes and the regulatory sequences, is a fundamental challenge in genomics and computational biology. Since regulatory elements are frequently short and variable, their identification and discovery using computational algorithms is difficult. (Abstract) However, our knowledge of the transcriptional regulatory elements in the genome and their contribution to gene expression in different spatial and temporal contexts is still limited. Given the complex pattern of regulatory interactions, the challenges involved in the complete elucidation of these elements in the genome are substantial. (pg 3593, Conclusion) However, neither the prior art nor the instant specification disclose the structural identity of the enormous genus of regulatory elements of the enormous genus of (target) genes within all recognized mammalian life forms and mobile genetic elements, whereby said enormous genus of (target) genes necessarily and predictably encode and transcribe an RNA that binds to one or more of the structurally undisclosed transcription factors which bind to said structurally undisclosed regulatory element.
The art simply does not know, and the instant specification does not disclose, the nucleotide sequences of the enormous genus of regulatory elements for the enormous genus of corresponding target genes in the enormous genus of corresponding organisms extant on the planet.
The specification fails to make up for the deficiencies of the global scientific community.
Recently, the U.S. Court of Appeals for the Federal Circuit (Federal Circuit) decided Amgen v. Sanofi, 872 F.3d 1367 (Fed. Cir. 2017), which concerned adequate written description for claims drawn to antibodies. These claims are usually handled in Technology Center 1600. The Federal Circuit explained in Amgen that when an antibody is claimed, 35 U.S.C. § 112(a) requires adequate written description of the antibody itself. Amgen, 872 F.3d at 1378-79. The Amgen court expressly stated that the so-called "newly characterized antigen" test, which had been based on an example in USPTO-issued training materials and was noted in dicta in several earlier Federal Circuit decisions, should not be used in determining whether there is adequate written description under 35 U.S.C. § 112(a) for a claim drawn to an antibody. Citing its decision in Ariad Pharmaceuticals, Inc. v. Eli Lilly & Co., the court also stressed that the "newly characterized antigen" test could not stand because it contradicted the quid pro quo of the patent system whereby one must describe an invention in order to obtain a patent. Amgen, 872 F.3d at 1378-79, quotingAriad Pharmaceuticals, Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1345 (Fed. Cir. 2010). In view of the Amgen decision, adequate written description of a newly characterized antigen alone should not be considered adequate written description of a claimed antibody to that newly characterized antigen, even when preparation of such an antibody is routine and conventional. Id. The Amgen decision will be added to the MPEP in due course.
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”).
Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) (“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). “A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed.” In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004)
The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005).
For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014)
Since the genetic code is widely known, a disclosure of an amino acid sequence would provide sufficient information such that one would accept that an inventor was in possession of the full genus of nucleic acids encoding a given amino acid sequence, but not necessarily any particular species. Cf. In re Bell, 991 F.2d 781, 785, 26 USPQ2d 1529, 1532 (Fed. Cir. 1993) and In re Baird, 16 F.3d 380, 382, 29 USPQ2d 1550, 1552 (Fed. Cir. 1994).
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper.
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
Thus, the claims reasonably encompass an infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA molecules.
In the instant case, knowing that a given mammalian genome may encode a YY1-binding motif does not tell you anything at all about the structures (RNA nucleic acid sequences) of the infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA molecules, nor even the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs comprising a sequence complementary to a YY1 consensus binding motif that will necessarily and predictably have the functional properties of:
bind to a nascent RNA transcribed from a regulatory element of the enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes in the enormously broad genus of 6,400 mammalian species, including those being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder;
interfere with binding between YY1 and the nascent RNA;
promotes decreased expression of the target gene, nor
achieve a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans.
Similarly, knowing that a given mammalian genome may encode a YY1-binding motif does not tell you anything at all about the enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes in the enormously broad genus of 6,400 mammalian species, that upon increased or aberrant transcription (e.g. increase, mis-expression), are associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition is a neurodegenerative disorder.
In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”.
“The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.”
“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
In the instant case, the record reflects that the claimed class of RNA molecules encompasses an infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA molecules, including the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs comprising a sequence complementary to a YY1 consensus binding motif. The record reflects that the claimed class of mammalian target cells reasonably encompasses an enormously broad genus of mammalian target cells, and reasonably encompass some 6,400 species.
The record reflects that the claimed class of mammalian target genes encoded by the enormously broad genus of mammalian cells reasonably encompasses as many as 20,000 and 25,000 genes in humans alone.
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
Applicant’s working examples are directed to DNA and RNA oligonucleotides that are able to bind YY1 protein in vitro, e.g. as used in art-recognized mobility shift assays (pgs 122-124).
The specification is silent to the synthesis of a decoy RNA comprising a nucleotide sequence that is complementary to a YY1 binding motif, wherein said decoy RNA is introduced into a target cell, in vitro, let alone in vivo, thereby necessarily and predictably achieving the recited functional properties of hybridizing to nascent RNA and blocking the subsequent binding of YY1 to target RNA by rendering the YY1 consensus binding motif in the nascent RNA inaccessible, thereby decreasing expression of the target gene.
The few species, about 5, of double-stranded oligonucleotides that bind YY1 in vitro per art-recognized mobility shift assays are not considered to be representative of the infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA molecules, including the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs comprising a sequence complementary to a YY1 consensus binding motif that necessarily and predictably have the functional properties of hybridizing to nascent RNA of the enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes in the enormously broad genus of 6,400 mammalian species being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder, and blocking the subsequent binding of YY1 to target RNA by rendering the YY1 consensus binding motif in the nascent RNA inaccessible, thereby decreasing expression of the target gene and achieve a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans [functions].
No reduction to practice has been achieved making and using a decoy RNA molecule in a mammalian cell, in vitro or in vivo, that is able to:
bind to a nascent RNA transcribed from a regulatory element of an enormous genus of structurally undisclosed target genes, including those being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder;
interfere with binding between YY1 and the nascent RNA;
promotes decreased expression of the target gene; and/or
achieve a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans.
The specification fails to make up for the deficiencies of the global scientific community.
"The claimed invention as a whole may not be adequately described if the claims require an essential or critical element which is not adequately described in the specification and which is not conventional in the art", "when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus", "in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus''. MPEP §2163
An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations using such descriptive means as words, structures, figures, diagrams, and formulas that fully set forth the claimed invention. Lockwood v. American Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997).
Possession may also be shown in a variety of ways including description of an actual reduction to practice, or by showing that the invention was ''ready for patenting'' such as by the disclosure of drawings or structural chemical formulas that show that the invention was complete, or by describing distinguishing identifying characteristics sufficient to show that the applicant was in possession of the claimed invention. See, e.g., Pfaff v. Wells Elecs., Inc., 525 U.S. 55, 68, 1 19 S.Ct. 304, 312, 48 USPQ2d 1641, 1647 (1998), Regents of the University of California v. Eli Lilly, 119 F.3d 1559, 1568, 43 USPQ2d 1398, 1406 (Fed. Cir. 1997)*, Amgen, Inc. v. Chugai Pharmaceutical, 927 F.2d 1200, 1206, 18 USPQ2d 1016, 1021 (Fed. Cir. 1991) (one must define a compound by ''whatever characteristics sufficiently distinguish it'').
Therefore, conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. See Fiers v. Revel, 25 USPQ2d 1602 at 1606 (CAFC 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016. One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481, 1483. In Fiddes, claims directed to mammalian FGF's were found to be unpatentable due to lack of written description for that broad class. The specification provided only the bovine sequence.
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function … does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is”).
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they also suffer from lack of adequate written description and/or do not correct the primary deficiencies of the independent claim.
Response to Arguments
Applicant argues that the specification provides adequate written description for the genus of synthetic RNAs encompassed by the claims, even more specifically, SEQ ID NO:1 and SEQ ID NO:28.
Applicant’s argument(s) has been fully considered, but is not persuasive. As discussed in the above rejections, instant independent Claim 56 is not limited to just SEQ ID NO:1 and SEQ ID NO:28, but rather encompass an infinite and/or enormously vast genus of structurally undisclosed RNA molecules that are to have the functional properties of:
i) bind to a nascent RNA target sequence, thereby interfering with the binding of YY1 protein to the nascent RNA; or
ii) bind to YY1, or some other structurally undisclosed transcription factor, thereby interfering with the binding of YY1 protein to the nascent RNA.
Applicant’s arguments suffer the same deficiencies per In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023)).
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
Applicant’s argument(s) “amount to little more than research assignments”.
The specification fails to make up for the deficiencies of the global scientific community.
Essentially, Applicant is requiring the ordinary artisan to discover and invent for themselves that which Applicant simply does not possess, nor has disclosed.
Applicant argues that the ordinary artisan would be easily able to visualize or recognize the identity of the members of the genus of the recited decoy RNAs because of a limited quantum of YY1 consensus binding motif sequences.
Applicant’s argument(s) has been fully considered, but is not persuasive. The claims encompass RNA decoy molecules as large as 300 nucleotides in length. Applicant fails to disclose how the mere argued 9 nucleotide sequence will necessarily and predictably be dispositive and controlling for a decoy RNA molecule comprising the additional 21, 41, 51, 91, 191, and/or 291 structurally undisclosed nucleotides present in the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs to necessarily and predictably achieve the binding of the decoy RNA to the enormous genus of structurally undisclosed nascent RNAs transcribed from a promoter comprising a YY1-binding motif.
Applicant argues that the specification exemplifies the use of methods for identifying genome-wide YY1 consensus binding motifs.
Applicant’s argument(s) has been fully considered, but is not persuasive. Applicant’s arguments suffer the same deficiencies per In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023)).
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
Applicant’s argument(s) “amount to little more than research assignments”.
12. Claims 56, 66, 69-70, 73, 77, 79, 86, and 91-92 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, while being enabling for an in vitro method of decreasing expression of an Arid1a target gene in a mammalian cell, the method comprising the step of contacting the mammalian cell with a decoy RNA consisting of the nucleotide sequence of SEQ ID NO:1,
does not reasonably provide enablement for:
i) an in vivo method of decreasing the expression of an enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes whose promoter(s) comprise(s) a YY1 consensus binding motif,
ii) an infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA molecules that comprise as few as but two nucleotides set forth in SEQ ID NO:1 or SEQ ID NO:28 and are identical to said enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes whose promoter(s) comprise(s) a YY1 consensus binding motif,
iii) an infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA aptamer molecules that comprise as few as but two nucleotides set forth in SEQ ID NO:1 or SEQ ID NO:28 that are necessarily and predictably able to bind to YY1 or some other structurally unrecited and undisclosed transcription factor, thereby interfering with the binding between YY1 protein and the target nascent RNA; nor
iv) administration of the infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA molecules that comprise as sequence that is at least 81% identical to said enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes whose promoter(s) comprise(s) a YY1 consensus binding motif to the enormously broad genus of 6,400 mammalian species, so as to necessarily and predictably decrease expression of said enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to practice the invention commensurate in scope with these claims.
While determining whether a specification is enabling, one considers whether the claimed invention provides sufficient guidance to make and use the claimed invention. If not, whether an artisan would have required undue experimentation to make and use the claimed invention and whether working examples have been provided. When determining whether a specification meets the enablement requirements, some of the factors that need to be analyzed are: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and whether the quantity of any necessary experimentation to make or use the invention based on the content of the disclosure is “undue” (In re Wands, 858 F.2d 731, 737, 8 USPQ2ds 1400, 1404 (Fed. Cir. 1988)). Furthermore, USPTO does not have laboratory facilities to test if an invention will function as claimed when working examples are not disclosed in the specification. Therefore, enablement issues are raised and discussed based on the state of knowledge pertinent to an art at the time of the invention. And thus, skepticism raised in the enablement rejections are those raised in the art by artisans of expertise.
The Examiner incorporates herein the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, written description rejections.
The art has demonstrated through numerous publications, delivery of nucleic acid vectors in vivo is highly unpredictable for successful therapy, including human therapy.
At issue in general are organ barriers, failure to persist, side-effects in other organs, T-cell responses, virus neutralizing antibodies, humoral immunity, normal tropism of the vector to other organs and more. The challenge is to maintain the efficiency of delivery and expression while minimizing any pathogenicity of the virus from which the vector was derived. The inability to develop an adequate means of overcoming obstacles such as humoral; responses and refractory cells limits the successful means by which the nucleic acid can be administered. The physiological art is recognized as unpredictable. (MPEP 2164.03.) In cases involving predictable factors, such as mechanical or electrical elements, a single embodiment provides broad enablement in the sense that, once imagined, other embodiments can be made without difficulty and their performance characteristics predicted by resort to known scientific laws. In cases involving unpredictable factors, such as most chemical reactions and physiological activity, the scope of enablement obviously varies inversely with the degree of unpredictability of the factors involved. In this case, the nucleic acid is broadly stated as being administered to a patient. The lack of guidance exacerbates the highly unpredictable field of gene therapy and the method of delivery of polynucleotides is highly unpredictable to date.
Gene delivery has been a persistent problem for gene therapy protocols and the route of delivery itself presents an obstacle to be overcome for the application of the vector therapeutically. To date, no single mode of gene transfer has provided a viable option for successful gene therapy protocols Daya et al (Gene Therapy Using Adeno-Associated Virus Vectors, Clin. Microbiol. Rev. 21(4): 583-593, 2008; pg 590-591, joining ¶; of record). When considering AAV therapy, there are many obstacles to its use systemically- host cell immune response which leads to toxicity (pg 587, col 2), blood brain as well as cellular barriers against the virus, adequate expression, degradation of the vector or the product. Even the use of targeting methods and tissue specific promoters have done little to overcome the numerous obstacles related to gene delivery. Even use of tissue specific promoters and capsids targeting has not successfully overcome these obstacles. Taken together with the large breadth of target tissues and diseases claimed, in light of the difficulties to overcome even one of these barriers, one could not perform the full breadth of the claims.
Reliance on animal models is not predictive of clinical outcome. This has been complicated by the inability to extrapolate delivery methods in animals with those in humans or higher animals.
Mingozzi and High (Immune responses to AAV vectors: overcoming barriers to successful gene therapy, Blood 122(1): 23-36, 2013; of record) demonstrate that the human findings are not recapitulated from the animal studies (page 26, col 2, “it seemed logical that one could model the human immune response in these animals, but multiple attempts to do so have also failed”). Hence, lessons learned from small animals such as the mice studies could not recapitulate the ability to deliver adequately in humans.
Kattenhorn et al (Adeno-Associated Virus Gene Therapy for Liver Disease, Human Gene Therapy 27(12): 947-961, November 28, 2016; of record) taught concerns for translation lead to extensive analysis of the effects on clinical use. The use of AAV after initial promising results went on hiatus (pg 947, col. 2, “clinical hiatus in the field”) as the animal models were deficient (pg 953, col. 2, “Although animal models predicted many aspects of the human immune response…, they largely failed to predict responses to AAV capsid”; “Work done in nonhuman primates has not met with any additional success”). This emphasizes that the challenge in humans is to maintain the efficiency of delivery and expression while minimizing any pathogenicity of the virus from which the vector was derived. Eventually, the use of AAV is serotype-dependent (e.g. pg 950, col. 1), organ and concentration dependent. The inability to develop an adequate means of overcoming humoral responses, neutralizing antibody, inactivation of transgene expression, shedding and refractory cells limits the successful means by which the nucleic acid can be administered.
The gene therapy art is unpredictable, as manifested in the poor and unpredictable targeting of the gene therapy vectors to target cells, routes of administration, the transient and unpredictable expression of the transgenes in target cells, the specific genes to be used for a treatment, the unsuitability of many animal models of human diseases, etc…, all critical for the success of a gene therapy method. Thus, it is not apparent how administration of the enormously vast genus of structurally undisclosed decoy RNAs via the broad genus of anatomically distinct routes would be reasonably expected by those of ordinary skill in the art to necessarily and predictably be able to achieve delivery of the enormously vast genus of structurally undisclosed decoy RNAs to the enormously broad genus of anatomically and physiologically distinct cell type extant in mammalian bodies such that said enormously vast genus of structurally undisclosed decoy RNAs will necessarily and predictably achieve:
binding to a nascent RNA transcribed from a regulatory element of a target gene in a generically recited mammalian target cell;
interfering with binding between YY1 and the nascent RNA;
does not bind to or interfere with a YY1 DNA-binding domain;
promotes RNase H-mediated degradation of the nascent RNA; and/or
achieves a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans, particularly given the doubts expressed in the art of record.
The Quantity of Any Necessary Experimentation to Make or Use the Invention
It is generally recognized in the art that biological compounds often react unpredictably under different circumstances (Nationwide Chem. Corp. v. Wright, 458 F. supp. 828, 839, 192 USPQ95, 105(M.D. Fla. 1976); Affd 584 F.2d 714, 200 USPQ257 (5th Cir. 1978); In re Fischer, 427 F.2d 833, 839, 166 USPQ 10, 24(CCPA 1970)). The relative skill of the artisan and the unpredictability of the pharmaceutical art are very high. Where the physiological activity of a chemical or biological compound is considered to be an unpredictable art (Note that in cases involving physiological activity such as the instant case, "the scope of enablement obviously varies inversely with the degree of unpredictability of the factors involved" (See In re Fischer, 427 F.2d 833, 839, 166 USPQ 10, 24(CCPA 1970))), the skilled artisan would have not known how to extrapolate the obfuscatory disclosure and absence of working examples in the instant application of a decoy RNA having the recited functional properties of that is to be guideposts to making and using the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNA nucleotide sequences that are to necessarily bind to the enormously vast genus of target genes when administered in vitro and/or in vivo to the enormously broad genus of mammalian cell types such that the recited functional properties of:
i) binding a nascent RNA transcribed from a generically recited regulatory element of the enormously vast genus of structurally undisclosed target genes comprising a YY1-binding motif;
ii) interferes with binding between YY1 and the nascent RNA;
iii) decreases target gene expression;
iv) does not bind to or interfere with a YY1 DNA-binding domain; and/or
v) promotes RNase H-mediated degradation of the nascent RNA,
so as to necessarily and predictably treat an enormous genus of etiologically and pathologically distinct diseases, disorders, and/or conditions, including an enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammals, including humans, however directly or indirectly said enormously vast genus of structurally undisclosed target genes may function.
Neither the specification nor the claims provide the appropriate dosage of the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNA nucleotide sequences that, upon administration to the enormous genus of mammalian subjects via an enormous genus of anatomically distinct administration routes would reasonably be expected by the ordinary artisan to necessarily and predictably achieve a clinically meaningful, real-world therapeutic result to treat an enormous genus of etiologically and pathologically distinct diseases, disorders, and/or conditions, including an enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammals, including humans, however directly or indirectly said enormously vast genus of structurally undisclosed target genes may function.
The relative skill of the artisan and the unpredictability of the pharmaceutical art are very high. Where the physiological activity of a chemical or biological compound is considered to be an unpredictable art (Note that in cases involving physiological activity such as the instant case, "the scope of enablement obviously varies inversely with the degree of unpredictability of the factors involved" (See In re Fischer, 427 F.2d 833, 839, 166 USPQ 10, 24(CCPA 1970))), the skilled artisan would have not known how to extrapolate the absence of making and using a decoy RNA nucleotide sequence working example to the presently recited methods encompassing administration of the enormously vast genus of structurally undisclosed decoy RNAs via the broad genus of anatomically distinct routes would be reasonably expected by those of ordinary skill in the art to necessarily and predictably be able to achieve delivery of the enormously vast genus of structurally undisclosed decoy RNAs to the enormously broad genus of anatomically and physiologically distinct cell type extant in mammalian bodies such that said enormously vast genus of structurally undisclosed decoy RNAs will necessarily and predictably achieve:
binding to a nascent RNA transcribed from a regulatory element of an enormous genus of structurally undisclosed target genes, including those being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder in a generically recited mammalian target cell;
interfering with binding between YY1 and the nascent RNA;
does not bind to or interfere with a YY1 DNA-binding domain;
promotes RNase H-mediated degradation of the nascent RNA; and/or
achieves a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans, particularly given the doubts expressed in the art of record.
The instant portion of the invention, as claimed, falls under the "germ of an idea" concept defined by the CAFC. The court has stated that "patent protection is granted in return for an enabling disclosure, not for vague intimations of general ideas that may or may not be workable". The court continues to say that "tossing out the mere germ of an idea does not constitute an enabling disclosure" and that "the specification, not knowledge in the art, that must supply the novel aspects of an invention in order to constitute adequate enablement". (See Genentech Inc v. Novo Nordisk A/S 42 USPQ2d 1001, at 1005). The claimed methods of using the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs that will necessarily and predictably have the functional properties of:
bind to a nascent RNA transcribed from a regulatory element of an enormous genus of structurally undisclosed target genes, including those being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder;
interfere with binding between YY1 and the nascent RNA;
promotes decreased expression of the target gene, and
achieve a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans, constitutes such a "germ of an idea".
The courts have stated that reasonable correlation must exist between scope of exclusive right to patent application and scope of enablement set forth in patent application. 27 USPQ2d 1662 Exparte Maizel. In the instant case, in view of the lack of guidance, working examples, breadth of the claims, the level of skill in the art and state of the art at the time of the claimed invention was made, it would have required undue experimentation to make and/or use the invention as claimed.
If little is known in the prior art about the nature of the invention and the art is unpredictable, the specification would need more detail as to how to make and use the invention in order to be enabling. See, e.g., Chiron Corp. v. Genentech Inc., 363 F.3d 1247, 1254, 70 USPQ2d 1321, 1326 (Fed. Cir. 2004) ("Nascent technology, however, must be enabled with a 'specific and useful teaching.' The law requires an enabling disclosure for nascent technology because a person of ordinary skill in the art has little or no knowledge independent from the patentee's instruction. Thus, the public's end of the bargain struck by the patent system is a full enabling disclosure of the claimed technology." (citations omitted)).
As In re Gardner, Roe and Willey, 427 F.2d 786,789 (C.C.P.A. 1970), the skilled artisan might eventually find out how to use the invention after “a great deal of work”. In the case of In re Gardner, Roe and Willey, the invention was a compound which the inventor claimed to have antidepressant activity, but was not enabled because the inventor failed to disclose how to use the invention based on insufficient disclosure of effective drug dosage. The court held that “the law requires that the disclosure in the application shall inform them how to use, not how to find out how to use for themselves”.
Perrin (Make mouse studies work, Nature (507): 423-425, 2014; of record) taught that the series of clinical trials for a potential therapy can cost hundreds of millions of dollars. The human costs are even greater (pg 423, col. 1). For example, while 12 clinical trials were tested for the treatment of ALS, all but one failed in the clinic (pg 423, col. 2). Experiments necessary in preclinical animal models to characterize new drugs or therapeutic compounds are expensive, time-consuming, and will not, in themselves, lead to new treatments. But without this upfront investment, financial resources for clinical trials are being wasted and [human] lives are being lost (pg 424, col. 1). Animal models are highly variable, and require a large number of animals per test group. Before assessing a drug’s efficacy, researchers should investigate what dose animals can tolerate, whether the drug reaches the relevant tissue at the required dose and how quickly the drug is metabolized or degraded by the body. We estimate that it takes about $30,000 and 6–9 months to characterize the toxicity of a molecule and assess whether enough reaches the relevant tissue and has a sufficient half-life at the target to be potentially effective. If those results are promising, then experiments to test whether a drug can extend an animal’s survival are warranted — this will cost about $100,000 per dose and take around 12 months. At least three doses of the molecule should be tested; this will help to establish that any drug responses are real and suggest what a reasonable dosing level might be. Thus, even assuming the model has been adequately characterized, an investment of $330,000 is necessary just to determine whether a single drug has reasonable potential to treat disease in humans. It could take thousands of patients, several years and hundreds of millions of dollars to move a drug through the clinical development process. The investment required in time and funds is far beyond what any one lab should be expected to do. (pg 425, col.s 2-3). The human costs are even greater: patients with progressive terminal illnesses may have just one shot at an unproven but promising treatment. Clinical trials typically require patients to commit to year or more of treatment, during which they are precluded from pursuing other experimental options (pg 423, col.2 1-3).
Greenberg (Gene Therapy for heart failure, Trends in Cardiovascular Medicine 27: 216-222, 2017) is considered relevant prior art for taught that despite success in experimental animal models, translating gene transfer strategies from the laboratory to the clinic remains at an early stage (Abstract). The success of gene therapy depends on a variety of factors that will ultimately determine the level of transgene expression within the targeted cells. These factors include the vector used for delivery, the method and conditions of delivery of the vector to the [target tissue], the dose that is given and interactions between the host and the vector that alter the efficiency of transfection of [target] cells (e.g. pg 217, col. 1). Failure of therapeutic results may arise because the vector DNA levels were at the lower end of the threshold for dose-response curves in pharmacology studies, and/or only a small proportion of target cells were expressing the therapeutic transgene (e.g. pg 220, col. 1). Although the use of AAVs for gene therapy is appealing, additional information about the best strain of AAVs to use in human patients is needed. Experience indicates that there is a need to carefully consider the dose of the gene therapy vector; however, this has proved to be difficult in early phase developmental studies due to the complexity and cost of such studies (e.g. pg 221, col. 1).
Maguire et al (Viral vectors for gene delivery to the inner ear, Hearing Research 394: e107927, 13 pages, doi.org/10.1016/j.heares.2020.107927, 2020) is considered relevant post-filing art for taught that despite the progress with AAV vectors in the inner ear, little is known regarding the mechanism of transduction of specific cells by AAV within the cochlea (e.g. pg 2, col. 2). There are limitations to what experiments in mice can tell us about the true translation potential of a new therapeutic (e.g. pg 8, col. 2), e.g. species-related physiological differences between mice and humans (e.g. pg 9, col. 1). The [AAV] dosage is a significant factor in achieving transduction of the target cell, as insufficient dosage may achieve no transduction of the target cells (e.g. pg 9, col. 2).
Tobias (Mouse Study Used in Research, Multiple Sclerosis News Today, multiplesclerosisnewstoday.com/news-posts/2023/09/08/lets-not-get-overexcited-about-any-mice-study-used-research/; September 8, 2023; last visited September 27, 2024) is considered relevant art for having taught that, “Mice exaggerate and monkeys lie, some researchers jokingly say. (Or is it the other way around?)” The odds of an experimental treatment making it from mouse or monkey to human are very low. Less than 8% of cancer treatments make it from animal studies into a clinical setting, where they’re tested on people, and only 10% of the medications in those clinical trials make it through to government approval. No wonder some researchers joke about mice and monkeys lying and exaggerating.
The specification fails to make up for the deficiencies of the global scientific community.
Recently, the U.S. Court of Appeals for the Federal Circuit (Federal Circuit) decided Amgen v. Sanofi, 872 F.3d 1367 (Fed. Cir. 2017), which concerned adequate written description for claims drawn to antibodies. These claims are usually handled in Technology Center 1600. The Federal Circuit explained in Amgen that when an antibody is claimed, 35 U.S.C. § 112(a) requires adequate written description of the antibody itself. Amgen, 872 F.3d at 1378-79. The Amgen court expressly stated that the so-called "newly characterized antigen" test, which had been based on an example in USPTO-issued training materials and was noted in dicta in several earlier Federal Circuit decisions, should not be used in determining whether there is adequate written description under 35 U.S.C. § 112(a) for a claim drawn to an antibody. Citing its decision in Ariad Pharmaceuticals, Inc. v. Eli Lilly & Co., the court also stressed that the "newly characterized antigen" test could not stand because it contradicted the quid pro quo of the patent system whereby one must describe an invention in order to obtain a patent. Amgen, 872 F.3d at 1378-79, quotingAriad Pharmaceuticals, Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1345 (Fed. Cir. 2010). In view of the Amgen decision, adequate written description of a newly characterized antigen alone should not be considered adequate written description of a claimed antibody to that newly characterized antigen, even when preparation of such an antibody is routine and conventional. Id. The Amgen decision will be added to the MPEP in due course.
A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”).
Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) (“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). “A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed.” In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004)
The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005).
For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014)
Since the genetic code is widely known, a disclosure of an amino acid sequence would provide sufficient information such that one would accept that an inventor was in possession of the full genus of nucleic acids encoding a given amino acid sequence, but not necessarily any particular species. Cf. In re Bell, 991 F.2d 781, 785, 26 USPQ2d 1529, 1532 (Fed. Cir. 1993) and In re Baird, 16 F.3d 380, 382, 29 USPQ2d 1550, 1552 (Fed. Cir. 1994).
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper.
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
Thus, the claims reasonably encompass an infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA molecules.
In the instant case, knowing that a given mammalian genome may encode a YY1-binding motif does not tell you anything at all about the structures (RNA nucleic acid sequences) of the infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA molecules, nor even the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs comprising a sequence complementary to a YY1 consensus binding motif that will necessarily and predictably have the functional properties of:
bind to a nascent RNA transcribed from a regulatory element of the enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes in the enormously broad genus of 6,400 mammalian species, including those being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder;
interfere with binding between YY1 and the nascent RNA;
promotes decreased expression of the target gene, nor
achieve a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans.
Similarly, knowing that a given mammalian genome may encode a YY1-binding motif does not tell you anything at all about the enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes in the enormously broad genus of 6,400 mammalian species, that upon increased or aberrant transcription (e.g. increase, mis-expression), are associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition is a neurodegenerative disorder.
In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”.
“The record reflects that this class of antibodies does not include just the 26 that Amgen has described by their amino acid sequence, but a “vast” number of additional antibodies that it has not.”
“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
In the instant case, the record reflects that the claimed class of RNA molecules encompasses an infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA molecules, including the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs comprising a sequence complementary to a YY1 consensus binding motif. The record reflects that the claimed class of mammalian target cells reasonably encompasses an enormously broad genus of mammalian target cells, and reasonably encompass some 6,400 species.
The record reflects that the claimed class of mammalian target genes encoded by the enormously broad genus of mammalian cells reasonably encompasses as many as 20,000 and 25,000 genes in humans alone.
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475.
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966).
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”.
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”.
“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
“The more a party claims for itself the more it must enable.”
“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same.
Applicant’s working examples are directed to DNA and RNA oligonucleotides that are able to bind YY1 protein in vitro, e.g. as used in art-recognized mobility shift assays (pgs 122-124).
The specification is silent to the synthesis of a decoy RNA comprising a nucleotide sequence that is complementary to a YY1 binding motif, wherein said decoy RNA is introduced into a target cell, in vitro, let alone in vivo, thereby necessarily and predictably achieving the recited functional properties of hybridizing to nascent RNA and blocking the subsequent binding of YY1 to target RNA by rendering the YY1 consensus binding motif in the nascent RNA inaccessible, thereby decreasing expression of the target gene.
The few species, about 5, of double-stranded oligonucleotides that bind YY1 in vitro per art-recognized mobility shift assays are not considered to be representative of the infinite and/or enormously vast genus of about 5x10^216, 5x10^210, 5x10^198, 4x10^189, 3x10^150, 2x10^120, 2x10^90, 1x10^60, 1x10^36, 1x10^30, and/or 1x10^18 structurally and functionally undisclosed RNA molecules, including the enormously vast genus of 1x10^177, 6x10^116, 4x10^56, 3x10^54, 3x10^26, 2x10^14, 2x10^5, and/or 4096 structurally and functionally undisclosed decoy RNAs comprising a sequence complementary to a YY1 consensus binding motif that necessarily and predictably have the functional properties of hybridizing to nascent RNA of the enormously vast genus of about 20,000 to 25,000 structurally and functionally undisclosed mammalian target genes in the enormously broad genus of 6,400 mammalian species being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder, and blocking the subsequent binding of YY1 to target RNA by rendering the YY1 consensus binding motif in the nascent RNA inaccessible, thereby decreasing expression of the target gene and achieve a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans [functions].
No reduction to practice has been achieved making and using a decoy RNA molecule in a mammalian cell, in vitro or in vivo, that is able to:
bind to a nascent RNA transcribed from a regulatory element of an enormous genus of structurally undisclosed target genes, including those being associated with, directly or however indirectly, an enormous genus of etiologically and pathologically distinct and undisclosed diseases, disorders, and/or conditions, wherein the disease, disorder, and/or condition includes, but is not limited to, a neurodegenerative disorder;
interfere with binding between YY1 and the nascent RNA;
promotes decreased expression of the target gene; and/or
achieve a real-world, clinically meaningful treatment of the enormously vast genus of anatomically, etiologically and pathologically distinct diseases, disorders, and/or conditions, including the enormous genus of etiologically and pathologically distinct neurodegenerative diseases, disorders, and/or conditions, in the enormously broad genus of mammalian subjects, including humans.
The specification fails to make up for the deficiencies of the global scientific community.
Accordingly, limiting the claimed invention to an vitro method of decreasing the expression of YY1 target genes Arid1a in a mammalian cell, the method comprising the step of contacting said mammalian cell with an RNA oligonucleotide consisting of the nucleotide sequence of SEQ ID NO:1, is proper.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they also suffer from lack of enablement and/or do not correct the primary deficiencies of the independent claim.
13. Claims 56, 66, 69-70, 73, 77, 79, and 86 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Independent Claim 56 recites the phrase “a decoy RNA comprising a synthetic RNA”.
Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999). The phrase “a decoy RNA comprising a synthetic RNA” is indefinite because the specification does not clearly redefine the term.
The specification discloses that “synthetic RNA” refers to a molecule that can be generated by in vitro transcription, chemical synthesis, or produced in a genetically modified cell (e.g. pg 43, lines 21-24).
The specification discloses, for example, that the decoy RNA is the synthetic RNA (e.g. pg 49, line 1).
It is unclear if the “decoy RNA” is the same or different nucleotide sequence than the “synthetic RNA”.
The specification fails to disclose a working example of the “decoy RNA” absent a “synthetic RNA”, and similarly, a “synthetic RNA” absent a “decoy RNA”. Thus, it is unclear what objectively constitutes the “decoy RNA” as opposed to the “synthetic RNA”. Rather, at best, the specification discloses, for example, a synthetic RNA that is 30 nucleotides in length that is complementary to an Arid1a nascent RNA (e.g. SEQ ID NO:1, SEQ ID NO:28, pg 124, lines 10-15).
The instant claims as a whole do not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
The Examiner interprets the phrase “a decoy RNA comprising a synthetic RNA” to simply mean a synthetic RNA molecule comprising a nucleotide sequence complementary to a target nascent RNA.
Response to Arguments
Applicant argues that the specification provides definitions for the terms “decoy RNA” and “synthetic RNA”, e.g. [0098, 99].
Applicant’s argument(s) has been fully considered, but is not persuasive.
[0089] provides only functional language for the “decoy RNA”, including the ability of the decoy RNA to bind the nascent RNA.
[0090] provides description as to how the synthetic RNA may be manufactured. [0090] also discloses the “synthetic RNA” comprises a nucleotide sequence that is homologous to the target nascent RNA, which is essentially a re-wording of the “decoy RNA”.
It is unclear if the “decoy RNA” is the same or different nucleotide sequence than the “synthetic RNA”.
Applicant’s response fails to clarify the record on this issue.
The specification fails to disclose a working example of the “decoy RNA” absent a “synthetic RNA”, and similarly, a “synthetic RNA” absent a “decoy RNA”. Thus, it is unclear what objectively constitutes the “decoy RNA” as opposed to the “synthetic RNA”.
Rather, at best, the specification discloses that the decoy RNA is the synthetic RNA (e.g. pg 49, line 1).
The specification discloses, for example, a synthetic RNA that is 30 nucleotides in length that is complementary to an Arid1a nascent RNA (e.g. SEQ ID NO:1).
The Examiner interprets the phrase “a decoy RNA comprising a synthetic RNA” to simply mean a synthetic RNA molecule comprising a nucleotide sequence complementary to a target nascent RNA.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
14. Claim(s) 56, 69-70, 73, 79, and 86 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Vasileiou et al (Chromatin-Remodeling-Factor ARID1B Represses Wnt/beta-catenin Signaling, Am. J. Human Genetics 97: 445-456, available online September 3, 2015), as evidenced by Verdel et al (Common themes in siRNA-mediated epigenetic silencing pathways, Int. J. Dev. Biol. 53: 245-257, 2009), GenBank NG_029965.1 (human Arid1a, 2024), and Sun et al (Arid1a Has Context-Dependent Oncogenic and Tumor Suppressor Functions in Liver Cancer, Cancer Cell 32: 574-589, November 13, 2017).
See 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejection discussed above.
Instant specification discloses the Arid1a gene comprises a YY1 consensus binding motif in the promoter RNA.
Instant amended Claim 56 does not require the RNA molecule to bind to a YY1 consensus binding motif of the nascent RNA, but rather may bind any sequence within the nascent RNA.
The limitation “interferes with binding between a YY1 protein and the nascent RNA” is recited at a high level of generality and includes both direct and indirect means by which the binding between a YY1 protein and the nascent RNA is abrogated or reduced.
Instant specification discloses the RNA molecule may be an antisense oligonucleotide (Claim 67), e.g. an siRNA (pg 40, line 31), whereby the candidate oligonucleotide effectively promotes degradation of the nascent RNA (e.g. pg 92, lines 28-29). Thus, it is considered that degradation of the target gene RNA by siRNA, shRNA, or dsRNA means achieves the functional limitation “interferes with”.
With respect to Claim 56, 79, and 86, Vasileiou et al is considered relevant prior art for having taught an in vitro method of decreasing expression of a target gene in a mammalian cell, e.g. human cells (e.g. pg 446, col. 2, Cell Culture), the method comprising the step of introducing into said mammalian cell a synthetic RNA molecule that binds to Arid1a RNA (e.g. pg 446, col. 2, siRNA Sequences).
Vasileiou et al taught the use of Arid1a siRNA molecules 19 nucleotides in length, which then results in the degradation of nascent Arid1a RNA.
Verdel et al taught that it is natural law of cell biology that siRNA molecules bind to nascent RNA (e.g. pg 249, col. 2, “a siRNA-nascent RNA base-pairing mechanism”; Figure 2b legend, “siRNA base-pairs with a complementary nascent transcript”).
Thus, it is considered that the siRNA of Vasileiou et al interferes with binding between YY1 protein and the nascent RNA because the nascent RNA has been degraded.
Vasileiou et al taught the Arid1a siRNA has the nucleotide sequence (e.g. pg 446, col. 2, siRNA sequences), shown below:
CUCAUUGGUUUCACAAGUC
SEQ ID NO:1 (30nts, Arid1a), has the nucleotide sequence shown below:
cucuucucucuuaaaauggcugccugucug
As discussed above, instant independent claim merely requires the RNA molecule to have at least two nucleotides set forth in SEQ ID NO:1, e.g. uu, cu, uc, gg, or gu (bold, underlined), for which the siRNA of Vasileiou et al clearly comprises.
With respect to Claim 79, the specification discloses the Arid1a nascent RNA inherently and naturally comprises an enhancer and/or promoter RNA.
The claim is considered to fail to further limit the independent claim. See 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, above.
To the extent Applicant argues otherwise, see 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, and 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejections above.
With respect to Claims 69-70, Sun et al evidence that it is natural law of cell biology and physiology that increased expression of Arid1a is associated with a disease, e.g. liver cancer.
As discussed above, instant independent claim merely requires the RNA molecule to have at least two nucleotides set forth in SEQ ID NO:1, e.g. uu, cu, uc, gg, or gu (bold, underlined), for which the siRNA of Vasileiou et al clearly comprises.
There is no requirement that a person of ordinary skill in the art would have recognized the inherent disclosure at the time of the invention, but only that the subject matter is in fact inherent in the prior art reference. This inherency argument is bolstered by Schering Corp. v. Geneva Pharm. Inc., 339 F.3d 1373, 1377, 67 USPQ2d 1664, 1668 (Fed. Cir. 2003). Inherent anticipation does not require recognition in the prior art.
"Products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art product/target gene, to wit, increased expression of Arid1a, does not inherently possess the same properties as the instantly claimed product/target gene, to wit, is associated with a disease, e.g. liver cancer or a neurodegenerative disorder.
The claim is considered to fail to further limit the independent claim. See 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, above.
To the extent Applicant argues otherwise, see 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, and 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejections above.
With respect to Claim 73, Vasileiou et al taught formulating the siRNA with a transfer vehicle (pg 446, col. 2, Methods, Transfections).
Thus, Vasileiou et al anticipate the claims.
Response to Arguments
Applicant argues that amended Claim 56 is directed to a synthetic RNA comprising SEQ ID NO:1 or SEQ ID NO:28.
Applicant’s argument(s) has been fully considered, but is not persuasive. As discussed above, instant independent claim merely requires the RNA molecule to have at least two nucleotides set forth in SEQ ID NO:1, e.g. uu, cu, uc, gg, or gu (bold, underlined), for which the siRNA of Vasileiou et al clearly comprises.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
15. Claims 56, 66, 69-70, 73, 77, 79, 86, and 91-92 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Vasileiou et al (available online September 3, 2015; of record) in view of Shen et al (available online July 1, 2015; of record), Aalto et al (2007; of record), Hannus et al (2014; of record), and GenBank NG_029965.1 (human Arid1a, 2024; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Instant specification discloses the synthetic RNA may be an antisense oligonucleotide (Claim 67), e.g. an siRNA (pg 40, line 31).
With respect to Claim 56, 79, and 86, Vasileiou et al is considered relevant prior art for having taught an in vitro method of decreasing expression of a target gene in a mammalian cell, e.g. human cells (e.g. pg 446, col. 2, Cell Culture), the method comprising the step of introducing into said mammalian cell a synthetic RNA molecule that binds to Arid1a RNA (e.g. pg 446, col. 2, siRNA Sequences).
Vasileiou et al taught the use of Arid1a siRNA molecules 19 nucleotides in length, which then results in the degradation of nascent Arid1a RNA.
Vasileiou et al taught the Arid1a siRNA has the nucleotide sequence (e.g. pg 446, col. 2, siRNA sequences), shown below:
CUCAUUGGUUUCACAAGUC
SEQ ID NO:1 (30nts, Arid1a), has the nucleotide sequence shown below:
cucuucucucuuaaaauggcugccugucug
As discussed above, instant independent claim merely requires the RNA molecule to have at least two nucleotides set forth in SEQ ID NO:1, e.g. uu, cu, uc, gg, or gu (bold, underlined), for which the siRNA of Vasileiou et al clearly comprises.
Verdel et al taught that it is natural law of cell biology that siRNA molecules bind to nascent RNA (e.g. pg 249, col. 2, “a siRNA-nascent RNA base-pairing mechanism”; Figure 2b legend, “siRNA base-pairs with a complementary nascent transcript”).
Thus, it is considered that the siRNA of Vasileiou et al interferes with binding between YY1 protein and the nascent RNA because the nascent RNA has been degraded.
Shen et al is considered relevant prior art for having taught an in vitro method of decreasing expression of a target gene in a mammalian cell, e.g. human cells (e.g. pg 765, col. 1, Cell Culture), the method comprising the step of introducing into said mammalian cell a pool of synthetic RNA molecules that binds to Arid1a RNA (e.g. Figure 4 legend, ARID1a siRNA (SMARTpool).
As discussed above, instant amended Claim 56 does not require the RNA molecule to bind to a YY1 consensus binding motif of the nascent RNA, but rather may bind any sequence within the nascent RNA.
Sigova declares (para 8) the YY1 consensus binding motif includes the 9-nucleotide sequence:
(cga)(gt)cCATn(ta)(tgc); or
(agc)(at)nATGg(ac)(gct), reverse-complement.
Neither Vasileiou et al nor Shen et al teach wherein the siRNA comprises a motif at least 66% (6 of 9 nucleotides), 77% (7 of 9 nucleotides), 88% (8 of 9 nucleotides), or 100% complementary to a YY1 consensus binding motif.
However, prior to the effective filing date of the instantly claimed invention, Aalto et al is considered relevant prior art for having taught an in vitro method of decreasing expression of the artisan’s gene of interest in a mammalian cell, e.g. a human cell (e.g. pg 428, col. 1, Methods, Transfections), the method comprising the step of synthesizing a pooled combination of siRNAs directed to the same target mRNA (e.g. Abstract, “pools of siRNAs...decreased the expression of a transgene”; pg 423, col. 1, “siRNA pools for entire genes”).
Aalto et al taught wherein the siRNA pool was enzymatically derived from dsRNA of the entire length of a “cDNA of the desired gene” (e.g. Figure 1, legend), including 5’ UTR, coding sequence, and 3’ UTR.
Aalto et al taught that the dsRNA was enzymatically digested with recombinant Dicer, thereby creating the synthetic siRNA pools (e.g. pg 424, col. 2).
Aalto et al taught that because several factors affect the efficacy of an siRNA, identifying a functional sequence is often laborious and expensive, whereby the problem can be circumvented by using siRNA pools containing molecules of different sequences (e.g. pg 422, col. 2).
Aalto et al taught that because each siRNA has its own off-targets, pooling is thought to reduce the individual nonspecific contributions of each sequence, revealing the “true” RNAi phenotype (e.g. pg 426, col. 2).
Hannus et al is considered relevant prior art for having taught an in vitro method of decreasing expression of the artisan’s gene of interest in a mammalian cell, e.g. a human cell (e.g. pg 8050, col. 2, Methods, Cell culture and transfections), the method comprising the step of synthesizing a pooled combination of siRNAs directed to the same target mRNA. Hannus et al taught that one of the major shortcomings of siRNA are sequence-specific off-target effects, which are largely unpredictable. However, the use of a pooled combination of siRNAs (syn. siRNA pool) can eliminate off -target effects because each individual siRNA is present in the pool at low concentrations, diluting sequence-specific off-target effects below detection limits. While single siRNA transfections can severely affect global gene expression, there is almost no transcriptome alteration when using complex siRNA pools (Abstract).
Hannus et al taught the RNA template was enzymatically digested with RNAse to create the siRNA pools of about 21 nucleotides in length (e.g. pg 8050, col. 1, Methods; Figure 1c; pg 8053, col. 1, “distinct, 21 nt long cleavage product”).
Hannus et al taught the pooled combination of siRNAs target a single gene (e.g. pg 8050, col. 1, “synergistically silencing one single on-target gene”).
GenBank NG_029965.1 (human Arid1a, 2024) evidences that there are:
i) at least 4 motifs substantially identical to a YY1 consensus binding motif inherently and naturally present in the Arid1a mRNA, such that an siRNA of 19nt having 100% complementarity to a nucleotide sequence of a nascent RNA and at least 77% complementarity to a consensus YY1 consensus binding motif (cga)(gt)cCATn(ta)(tgc) or reverse-complement (agc)(at)nATGg(ac)(gct), as per Sigova Declaration (para 8), including the absolutely conserved central (CAT) or reverse-complement (ATG) motif, for example:
agccatcxx;
cagatggxx;
axgatggxg; and
gxgatggxt;
ii) at least 6 motifs substantially identical to a YY1 consensus binding motif inherently and naturally present in the Arid1a mRNA, such that an siRNA of 19nt having 100% complementarity to a nucleotide sequence of a nascent RNA and at least 88% complementarity to a consensus YY1 consensus binding motif, for example:
cagatggxc;
agccatcxc;
cagatggxt;
axgatggct;
ctccatctx; and
ggccatcax; and
ii) at least 1 motif identical to a YY1 consensus binding motif inherently and naturally present in the Arid1a mRNA, such that an siRNA of 19nt having 100% complementarity to a nucleotide sequence of a nascent RNA and at least 100% complementarity to a consensus YY1 consensus binding motif, for example:
ctccatcac.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Vasileiou et al, Shen et al, Aalto et al, and Hannus et al taught the siRNA(s) has/have 100% complementarity to the target RNA.
Instant claims recite the synthetic siRNA at a high level of generality, and the instant specification fails to disclose an element of criticality for at least 81% complementarity to the target RNA, as opposed to at least 77%, 85%, 87%, 89%, 91%, 93%, 95%, 97%, 99%, or 100% complementarity.
GenBank NG_029965.1 evidences that, using the methods of Aalto et al and/or Hannus et al, the pooled siRNAs would inherently and/or naturally comprise siRNAs whose nucleotide sequences would comprise a sequence that at least 66% (6 of 9 nucleotides), 77% (7 of 9 nucleotides), 88% (8 of 9 nucleotides), or 100% complementary to a YY1 consensus binding motif.
Instant claims recite the synthetic siRNA at a high level of generality, and the instant specification fails to disclose an element of criticality for at least 81% complementarity, as opposed to at least 66%, 77%, 88%, or 100% complementarity to a YY1 consensus binding motif.
Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology and methods of synthesizing antisense molecules such as siRNA. Therefore, the level of ordinary skill in this art is high.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first Arid1a siRNA and/or Arid1a SMARTpool, with a pooled combination of siRNAs, each of which are 100% complementary to an Arid1a nascent RNA sequence, in an in vitro method of decreasing expression of an Arid1a target gene in a mammalian cell with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute first Arid1a siRNA and/or Arid1a SMARTpool, with a pooled combination of siRNAs, each of which are 100% complementary to an Arid1a nascent RNA sequence, in a method of decreasing expression of an Arid1a target gene in a mammalian cell because:
i) those of ordinary skill in the art previously recognized and successfully reduced to practice siRNA molecules complementary to an Arid1a nascent RNA (e.g. Vasileiou et al);
ii) those of ordinary skill in the art previously recognized and successfully reduced to practice a pooled combination of siRNA molecules complementary to an Arid1a nascent RNA (e.g. Shen et al); and
iii) those of ordinary skill in the art previously recognized and successfully reduced to practice a pooled combination of siRNA molecules complementary to the same target gene mRNA (Aalto et al, Hannus et al), thereby overcoming and reducing the problem of off-target effects of the individual nonspecific contributions of each siRNA sequence, as each individual siRNA is present in the pool at low concentrations, diluting sequence-specific off-target effects below detection limits, such that there is almost no transcriptome alteration when using complex siRNA pools, and successfully achieving “synergistically silencing one single on-target gene”.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Aalto et al taught the synthesis of a pooled combination of siRNAs directed to the same target gene, whereby the siRNAs were produced from a template of up to 4 kb (e.g. Abstract), thereby generating a multitude of siRNAs having different nucleotide sequences, each of which are complementary to the same target gene mRNA.
Similarly, Hannus et al taught the synthesis of a pooled combination of siRNAs directed to the same target gene, thereby generating the siRNA pools composed of 30, 45, or 60 siRNAs (e.g. pg 8050, col. 1, Methods, siPool 30, siPool 45, siPool 60) having different nucleotide sequences, each of which are complementary to the same target gene mRNA.
Instant claims recite the synthetic siRNA at a high level of generality, and the instant specification fails to disclose an element of criticality for at least 81% complementarity to the target RNA, as opposed to at least 77%, 85%, 87%, 89%, 91%, 93%, 95%, 97%, 99%, or 100% complementarity.
GenBank NG_029965.1 evidences the Arid1a nascent RNA, including mRNA, comprises at least 11 sequences having at least 66%, 77%, 88%, and/or 100% complementarity to a YY1 consensus binding sequence, and thus using the methods of Aalto et al and/or Hannus et al, the pooled siRNAs would inherently and/or naturally, per natural law of chemistry and enzymology, comprise siRNAs whose nucleotide sequences would comprise a sequence that at least 66% (6 of 9 nucleotides), 77% (7 of 9 nucleotides), 88% (8 of 9 nucleotides), and/or 100% complementary to a YY1 consensus binding motif.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant claims recite the synthetic siRNA at a high level of generality, and the instant specification fails to disclose an element of criticality for at least 81% complementarity, as opposed to at least 66%, 77%, 88%, or 100% complementarity to a YY1 consensus binding motif.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 56, 75, and 83, Vasileiou et al taught the use of Arid1a siRNA molecules 19 nucleotides in length (e.g. pg 446, col. 2, siRNA Sequences).
Aalto et al taught wherein the RNA template was enzymatically digested with DICER to create the siRNA pools, whereby those of ordinary skill in the art have long-recognized DICER to produce 21 nucleotide siRNAs (e.g. Hannus et al, pg 8049, col. 1, Introduction).
Hannus et al taught the RNA template was enzymatically digested with RNAse to create the siRNA pools of about 21 nucleotides in length (e.g. pg 8050, col. 1, Methods; Figure 1c; pg 8053, col. 1, “distinct, 21 nt long cleavage product”).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant specification fails to disclose an element of criticality for an RNA molecule that is 10, 15, 20, 30, or 50 nucleotides in length.
With respect to Claims 87-88, as discussed above, Vasileiou et al, Shen et al, Aalto et al, and Hannus et al taught the siRNA(s) has/have 100% complementarity to the target RNA.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant claims recite the synthetic siRNA at a high level of generality, and the instant specification fails to disclose an element of criticality for at least 81% complementarity to the target RNA, as opposed to at least 77%, 85%, 87%, 89%, 91%, 93%, 95%, 97%, 99%, or 100% complementarity.
With respect to Claim 79, the specification discloses the Arid1a nascent RNA inherently and naturally comprises an enhancer and/or promoter RNA.
The claim is considered to fail to further limit the independent claim. See 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, above.
To the extent Applicant argues otherwise, see 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, and 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejections above.
With respect to Claims 69-70, Sun et al evidence that it is natural law of cell biology and physiology that increased expression of Arid1a is associated with a disease, e.g. liver cancer.
As discussed above, instant independent claim merely requires the RNA molecule to have at least two nucleotides set forth in SEQ ID NO:1, e.g. uu, cu, uc, gg, or gu (bold, underlined), for which the siRNA of Vasileiou et al clearly comprises.
There is no requirement that a person of ordinary skill in the art would have recognized the inherent disclosure at the time of the invention, but only that the subject matter is in fact inherent in the prior art reference. This inherency argument is bolstered by Schering Corp. v. Geneva Pharm. Inc., 339 F.3d 1373, 1377, 67 USPQ2d 1664, 1668 (Fed. Cir. 2003). Inherent anticipation does not require recognition in the prior art.
"Products of identical chemical composition can not have mutual exclusive properties." A compound and its properties are inseparable (In re Papesch, 315 F.2d 381, 137 USPQ 43 (CCPA 1963)). Any properties exhibited by or benefits from are not given any patentable weight over the prior art provided the composition is inherent. A chemical composition and its properties are inseparable. Therefore, if the prior art teaches the identical chemical structure, the disclosed properties are necessarily present. In re Spada, 911 F.2d 705,709, 15 USPQ 1655, 1658 (Fed. Cir. 1990). See MPEP §2112.01. The burden is shifted to the applicant to show that the prior art product/target gene, to wit, increased expression of Arid1a, does not inherently possess the same properties as the instantly claimed product/target gene, to wit, is associated with a disease, e.g. liver cancer or a neurodegenerative disorder.
The claim is considered to fail to further limit the independent claim. See 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, above.
To the extent Applicant argues otherwise, see 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, and 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejections above.
With respect to Claim 85, GenBank evidences that the nascent RNA inherently and naturally comprises the YY1 consensus binding motif provided in SEQ ID NO:4, to wit:
aaaatggct.
Thus, using the methods of Aalto et al and/or Hannus et al, the pooled siRNAs would inherently and/or naturally comprise siRNAs whose nucleotide sequences would comprise a sequence that at least 66% (6 of 9 nucleotides), 77% (7 of 9 nucleotides), 88% (8 of 9 nucleotides), and/or 100% complementary to the YY1 consensus binding motif provided in SEQ ID NO:4 per natural law of chemistry and enzymology.
With respect to Claim 73, Vasileiou et al taught formulating the siRNA with a transfer vehicle (pg 446, col. 2, Methods, Transfections).
Shen et al taught formulating the siRNA with a transfer vehicle (pg 765, col. 2, Methods, RNA interference).
Aalto et al taught formulating the siRNA with a transfer vehicle (pg 428, col. 1, Methods, Transfections).
Hannus et al taught formulating the siRNA with a transfer vehicle (pg 8050, col. 2, Methods, Transfections).
With respect to Claims 66 and 77, Hannus et al taught that the method of producing siRNA pools allows for the inclusion of modified nucleotides (e.g. pg 8059, col. 2).
With respect to Claim 86, Vasileiou et al taught an in vitro method of decreasing expression of a target gene in a mammalian cell, e.g. human cells (e.g. pg 446, col. 2, Cell Culture).
Shen et al taught an in vitro method of decreasing expression of a target gene in a mammalian cell, e.g. human cells (e.g. pg 765, col. 1, Cell Culture).
Aalto et al taught an in vitro method of decreasing expression of the artisan’s gene of interest in a mammalian cell, e.g. a human cell (e.g. pg 428, col. 1, Methods, Transfections).
Hannus et al taught an in vitro method of decreasing expression of the artisan’s gene of interest in a mammalian cell, e.g. a human cell (e.g. pg 8050, col. 2, Methods, Cell culture and transfections).
With respect to Claims 91-92, GenBank NG_029965.1 evidences the Arid1a nascent RNA, including mRNA, comprises a sequence that is 100% complementarity to a YY1 consensus binding sequence, including a sequence identical to SEQ ID NO:1, and thus using the methods of Aalto et al and/or Hannus et al, the pooled siRNAs would inherently and/or naturally, per natural law of chemistry and enzymology, comprise siRNAs whose nucleotide sequences would comprise a sequence that is 100% complementary to a YY1 consensus binding motif, including SEQ ID NO:28.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Applicant provides no objective evidence on the record that a synthetic RNA comprising the nucleotide sequence of SEQ ID NO:1 or SEQ ID NO:28 yields a superior or unexpected ability to decrease expression of the Arid1a target gene, as opposed to the siRNA molecules of Vasileiou et al and/or Shen t al, and/or the pooled siRNAs using the methods of Aalto et al and/or Hannus et al.
Instant specification fails to disclose an element of criticality for an RNA molecule that comprises the sequence of SEQ ID NO:1 or SEQ ID NO:28, as opposed to the pooled siRNAs, per Hannus et al and Aalto et al, that would inherently and/or naturally, per natural law of chemistry and enzymology, comprise siRNAs whose nucleotide sequences would comprise, consist of, and/or substantially overlap with a sequence that is 100% complementary to a YY1 consensus binding motif, including SEQ ID NO:1 and/or SEQ ID NO:28.
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Vasileiuo et al do not teach SEQ ID NO:1 or SEQ ID NO:28.
Applicant’s argument(s) has been fully considered, but is not persuasive. As discussed above, the breadth of the independent claim does not require SEQ ID NO:1 or SEQ ID NO:28.
Applicant argues that Vasileiou et al targets mRNA, not nascent RNA.
Applicant’s argument(s) has been fully considered, but is not persuasive. As discussed above, Verdel et al taught that it is natural law of cell biology that siRNA molecules bind to nascent RNA (e.g. pg 249, col. 2, “a siRNA-nascent RNA base-pairing mechanism”; Figure 2b legend, “siRNA base-pairs with a complementary nascent transcript”).
Applicant argues that neither Shen et al, Aalto et al, nor Hannus et al teach SEQ ID NO:1 or SEQ ID NO:28.
Applicant’s argument(s) has been fully considered, but is not persuasive.
Shen et al taught using a pool of different siRNAs to decrease expression of Arid1a.
Aalto et al and Hannus et al taught how to synthesize much larger pools of different siRNAs directed to the artisan’s gene of interest.
Thus using the methods of Aalto et al and/or Hannus et al, the pooled siRNAs would inherently and/or naturally, per natural law of chemistry and enzymology, comprise siRNAs whose nucleotide sequences would comprise, consist of, and/or substantially overlap with a sequence that is 100% complementary to a YY1 consensus binding motif, including SEQ ID NO:1 and/or SEQ ID NO:28.
16. Claim 56, 73, 86, and 91-92 are rejected under AIA 35 U.S.C. 103 as being unpatentable over Vasileiou et al (available online September 3, 2015; of record) in view of Shen et al (available online July 1, 2015; of record), Aalto et al (2007; of record), Hannus et al (2014; of record), and GenBank NG_029965.1 (human Arid1a, 2024; of record), as applied to Claims 56, 66, 69-70, 73, 77, 79, 86, and 91-92 above, and in further view of Watanabe et al (2006; of record).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
GenBank NG_029965.1 taught the coding sequence and mRNA of the Arid1a gene.
Instant SEQ ID NO:1 and SEQ ID NO:28, both 30 nucleotides in length, are in the Arid1a 5’UTR.
Aalto et al taught wherein the siRNA pool was enzymatically derived from dsRNA of the entire length of a “cDNA of the desired gene” (e.g. Figure 1, legend), including 5’ UTR, coding sequence, and 3’ UTR, as demonstrated with a dsRNA of up to 4kb (e.g. Abstract).
Watanabe et al is considered relevant prior art for having taught an in vitro method of decreasing expression of the artisan’s gene of interest in a mammalian cell, e.g. a human cell (e.g. pg 890, col. 2, Methods, Cell culture and transfection), the method comprising the step of synthesizing an siRNA pool, wherein the siRNA pool was enzymatically derived from long dsRNA templates, e.g. of 50, 100, 197, 357, 572, or 817 nucleotides (Figure 2b) by Dicer, thereby yielding siRNA molecules of about 21-, 36-, or 40-nucleotides in length (e.g. Figures 2a, 3a), wherein Watanabe et al’s working examples target either the 5’ UTR or the 3’UTR of the artisan’s target gene(s), respectively (e.g. Figure 2b).
Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first Arid1a siRNA dsRNA template and/or firs Arid1a siRNA with a synthetic RNA having a length of about 60 nucleotides, in an in vitro method of decreasing expression of an Arid1a target gene in a mammalian cell with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would have been motivated to substitute a first Arid1a siRNA dsRNA template and/or firs Arid1a siRNA with a synthetic RNA having a length of about 60 nucleotides, in an in vitro method of decreasing expression of an Arid1a target gene in a mammalian cell with a reasonable expectation of success because those of ordinary skill in the art previously recognized that the Dicer enzyme, naturally present in mammalian cells, will, per natural law of cell biology and chemistry, cleave larger dsRNA molecules into smaller siRNA molecules, as successfully demonstrated by Aalto et al and Watanabe et al, including long dsRNA templates of 50, 100, 197, 357, 572, or 817 nucleotides (Figure 2b), thereby yielding siRNA molecules of about 21-, 36-, or 40-nucleotides in length.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant specification fails to disclose an element of criticality for an RNA molecule that is 10, 15, 20, 30, 50, or 60 nucleotides in length.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claims 56 and 91-92, Vasileiou et al taught the use of Arid1a siRNA molecules 19 nucleotides in length (e.g. pg 446, col. 2, siRNA Sequences).
Aalto et al taught wherein the RNA template was enzymatically digested with DICER to create the siRNA pools, whereby those of ordinary skill in the art have long-recognized DICER to produce 21 nucleotide siRNAs (e.g. Hannus et al, pg 8049, col. 1, Introduction).
Hannus et al taught the RNA template was enzymatically digested with RNAse to create the siRNA pools of about 21 nucleotides in length (e.g. pg 8050, col. 1, Methods; Figure 1c; pg 8053, col. 1, “distinct, 21 nt long cleavage product”).
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant specification fails to disclose an element of criticality for an RNA molecule that is 10, 15, 20, 30, 50, or 60 nucleotides in length.
Instant specification fails to disclose an element of criticality for an RNA molecule that comprises the sequence of SEQ ID NO:1 or SEQ ID NO:28, as opposed to the pooled siRNAs, per Hannus et al and Aalto et al, that would inherently and/or naturally, per natural law of chemistry and enzymology, comprise siRNAs whose nucleotide sequences would comprise, consist of, and/or substantially overlap with a sequence that is 100% complementary to a YY1 consensus binding motif, including SEQ ID NO:1 and/or SEQ ID NO:28.
With respect to Claim 73, Vasileiou et al taught formulating the siRNA with a transfer vehicle (pg 446, col. 2, Methods, Transfections).
Shen et al taught formulating the siRNA with a transfer vehicle (pg 765, col. 2, Methods, RNA interference).
Aalto et al taught formulating the siRNA with a transfer vehicle (pg 428, col. 1, Methods, Transfections).
Hannus et al taught formulating the siRNA with a transfer vehicle (pg 8050, col. 2, Methods, Transfections).
Watanabe et al taught formulating the siRNA with a transfer vehicle (pg 890, col. 2, Methods, Transfections).
With respect to Claim 86, Vasileiou et al taught an in vitro method of decreasing expression of a target gene in a mammalian cell, e.g. human cells (e.g. pg 446, col. 2, Cell Culture).
Shen et al taught an in vitro method of decreasing expression of a target gene in a mammalian cell, e.g. human cells (e.g. pg 765, col. 1, Cell Culture).
Aalto et al taught an in vitro method of decreasing expression of the artisan’s gene of interest in a mammalian cell, e.g. a human cell (e.g. pg 428, col. 1, Methods, Transfections).
Hannus et al taught an in vitro method of decreasing expression of the artisan’s gene of interest in a mammalian cell, e.g. a human cell (e.g. pg 8050, col. 2, Methods, Cell culture and transfections).
Watanabe et al taught an in vitro method of decreasing expression of the artisan’s gene of interest in a mammalian cell, e.g. a human cell (e.g. pg 890, col. 2, Methods, Cell culture and transfection).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious.
Response to Arguments
Applicant argues that Watanabe et al do not cure the defect of Vasileiou et al in view of Shen et al, Aalto et al, Hannus et al.
Applicant’s argument(s) has been fully considered, but is not persuasive. The Examiner’s response to Applicant's argument(s) regarding Vasileiou et al, Shen et al, Aalto et al, and Hannus et al are discussed above and incorporated herein. Applicant does not contest the teachings of Watanabe et al as applied to the obviousness to substitute a first Arid1a siRNA dsRNA template and/or firs Arid1a siRNA with a synthetic RNA having a length of about 60 nucleotides, in an in vitro method of decreasing expression of an Arid1a target gene in a mammalian cell with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would have been motivated to substitute a first Arid1a siRNA dsRNA template and/or firs Arid1a siRNA with a synthetic RNA having a length of about 60 nucleotides, in an in vitro method of decreasing expression of an Arid1a target gene in a mammalian cell with a reasonable expectation of success because those of ordinary skill in the art previously recognized that the Dicer enzyme, naturally present in mammalian cells, will, per natural law of cell biology and chemistry, cleave larger dsRNA molecules into smaller siRNA molecules, as successfully demonstrated by Aalto et al and Watanabe et al, including long dsRNA templates of 50, 100, 197, 357, 572, or 817 nucleotides (Figure 2b), thereby yielding siRNA molecules of about 21-, 36-, or 40-nucleotides in length.
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I).
Instant specification fails to disclose an element of criticality for an RNA molecule that is 10, 15, 20, 30, 50, or 60 nucleotides in length.
Instant specification fails to disclose an element of criticality for an RNA molecule that comprises the sequence of SEQ ID NO:1 or SEQ ID NO:28, as opposed to the pooled siRNAs, per Hannus et al and Aalto et al, that would inherently and/or naturally, per natural law of chemistry and enzymology, comprise siRNAs whose nucleotide sequences would comprise, consist of, and/or substantially overlap with a sequence that is 100% complementary to a YY1 consensus binding motif, including SEQ ID NO:1 and/or SEQ ID NO:28.
Conclusion
17. No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached at 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
KEVIN K. HILL
Examiner
Art Unit 1638
/KEVIN K HILL/Primary Examiner, Art Unit 1638