DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Application/Amendments/Claims/RCE under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e) was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114 and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant’s submission filed on 1/28/2026 has been considered.
Claims 1 and 7 have been amended. Claim 24 has been newly added. Claims 1-21 and 24 are pending and are the subject of the present Official action. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Priority
Applicant’s claim for the benefit of a prior-filed application PRO 62/793,210, PRO/852,573 and PCT/US2020/013887 filed on 1/16/2019, 5/24/2019 and 1/16/2020, respectively under 35 U.S.C 119(e) or under 35 U.S.C 120, 121 or 365(c) is acknowledged.
Accordingly, the effective priority date of the instant application is granted as 1/16/2019.
Statement on Claim Interpretation
It is emphasized that claim 1 claims a product (genetically engineered hematopoietic stem or progenitor cells which comprise a genetic mutation in exon 3 of an endogenous CD33 gene) by a process (CRSPR/Cas9 editing). Product-by-process claims are not limited to the manipulations of the recited steps, only the structure implied by the steps, see MPEP 2113. The patentability of a product does not depend on its method of production. If the product in the product-by-process claim is the same as or obvious from a product of the prior art, the claim is unpatentable even though the prior product was made by a different process.
From the applicant’s specification SEQ ID NOs: 99-112s correspond to off-target site mutations as illustrated in Figure 30 which are infrequent given the target specificity of CRISPR/Cas9 systems.
Furthermore, SEQ ID NO: 58 (CCTCACTAGACTTGACCCAC) is contained within SEQ ID NO: 52 (TTCTCCTCACTAGACTTGACCCACAGGCCCA).
Maintained Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-21 and 24 stand rejected under 35 U.S.C. 103 as being unpatentable over Mukherjee et al. US 2017/0326179, published 11/16/2017 (hereinafter Mukherjee, reference of record) in view of Galetto et al. US 2017/0145094, published 5/25/2017 (hereinafter Galetto, reference of record). This rejection is repeated for the same reasons as set forth in the Official action mailed on 7/31/2025 and newly applied to claim 24. A response to applicant’s traversal follows the reiterated rejection below.
Claim 1: Mukherjee describes genetically engineered hematopoietic cells (HSCs) that are deficient in a lineage-specific cell-surface antigen, with express reference to CD33 deficient hematopoietic cells (Mukherjee, para 17). Mukherjee provides motivation for targeting CD33 and reducing its expression in HSCs stating that the combined administration of CAR-T cells targeting CD33 along with HSCs deficient in CD33 would provide an effective method for treating hematopoietic malignancies (Mukherjee, para 7). Mukherjee describes CRISPR-Cas9 based approaches for genetically engineering the HSCs for decreased CD33 expression including designing gRNAs which specifically target the CD33 gene resulting in insertions, deletions or substitutions of one or more nucleotides of the target polynucleotide (Mukherjee, para 146 and Table 4). Mukherjee describes using CRISPR-Cas9 to cleave the targeted gene (CD33) resulting in the decreased transcription of CD33 in HSCs (Mukherjee, para 147). Mukherjee does not expressly describe genetic mutations to exon 3 of the CD33 gene. With respect to the limitations describing wherein the genetic mutation is at a target site edited by a CRISPR/Cas9 system comprising a spacer sequence consisting of SEQ ID NO: 70, it is emphasized that claim 1 claims a product by a process (CRSPR/Cas9 editing). Product-by-process claims are not limited to the manipulations of the recited steps, only the structure implied by the steps, see MPEP 2113.
Claims 2-6 and 14-21: Mukherjee describes using FACS to quantify the CD33 expression level of HSCs and specifically states that “cells that are deficient in the antigen can be lower than about 40% (e.g. 30%, 20%, 15%, 10%, 5% or lower) of the expression level of the same lineage-specific antigen of the naturally-occurring counterpart” (Mukherjee, para 61). Mukherjee describes procedures wherein these methods are applied to a population of HSCs, which reads on a plurality of HSCs and multiple copies of CD33.
Claim 7-9: Mukherjee describes CRISPR-Cas9 based approaches for genetically engineering the HSCs for decreased CD33 expression including designing gRNAs which specifically target the CD33 gene via nucleotide insertion, deletion or frameshift (Mukherjee, para 146-148 and Table 4). Mukherjee lists numerous gRNAs for these CRISPR systems in Table 4 and 5. Mukherjee describes alternative embodiments wherein cleavage can further comprise repairing the cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein the repair results in an insertion, deletion or substitution of one or more nucleotides of the target polynucleotide (CD33) (Mukherjee, para 147).
Claim 10: Mukherjee describes preferred embodiments for CD34+ HSCs (Mukherjee, para 20).
Claims 11-13: Mukherjee states that the HSCs derived from bone marrow cells or peripheral blood mononuclear cells (PBMCs) from allogenic or patient derived sources (Mukherjee, para 18 and 131).
Claim 1: Galetto describes an analogous method to reduce CD33 expression in hematopoietic stem cells using TALENs to effect nucleotide substitutions, insertions or deletions (Galetto, para 93 and example 2). Galetto identified target sequences within CD33 exon 3 with specific reference to SEQ ID NO: 72 which has a 100% match to the complement of SEQ ID NO: 70 of the instant invention (Galetto, para 414 and Table 11 and PCT search report issued 6/11/2020; sequence search results shown below). Galetto describes targeting this region using TALENs to reduce CD33 expression in hematopoietic stem cells.
PNG
media_image1.png
143
574
media_image1.png
Greyscale
Galetto discloses nucleotide sequences within exon 3 of an endogenous CD33 gene which is to be modified by a substitution, insertion or deletion as shown below in the sequence search results which show a 100% match between instant SEQ ID NO: 52 and SEQ ID NO: 72 from Galetto.
PNG
media_image2.png
198
772
media_image2.png
Greyscale
Claim 24: It is emphasized that SEQ ID NO: 58 (CCTCACTAGACTTGACCCAC) is contained within SEQ ID NO: 52 (TTCTCCTCACTAGACTTGACCCACAGGCCCA) and is disclosed by Galetto (sequence search results below).
PNG
media_image3.png
198
784
media_image3.png
Greyscale
It would have been prima facie obvious to one of ordinary skill in the art to target a site within exon 3 corresponding to the complement of SEQ ID NO: 70 (or equivalently SEQ ID NO: 52 or 58) as described by Galetto using the CRISPR based methods outlined by Mukherjee in order to create genetically engineered hematopoietic stem cells with reduced expression levels of CD33. It would have been a matter of combining prior art elements according to known methods to yield predictable results to mutate this specific site since Galetto shows that exon 3 is an effective target for reducing CD33 gene expression in hematopoietic stem cells. One would have been motivated to do so in order to decrease CD33 expression in HSCs for improved treatment outcomes when combined with CAR-T cells targeting CD33 as described by Mukherjee. One would have a reasonable expectation of success given the relative interchangeability of TALEN and CRISPR genomic editing technologies and that both authors expressly targeted CD33 inactivation in HSCs. Furthermore, using CRISPR would results in reduced off-target effects like the mutations identified in SEQ ID Nos: 99-112. Accordingly, in the absence of evidence to the contrary, one of ordinary skill in the art would have considered the claimed invention to have been prima facie obvious to at the time the invention was made.
Response to Traversal
Applicant points to the amendment to claim 1, which describe a genetic mutation comprising a substitution, insertion or deletion relative to the nucleotide sequence of SEQ ID NO: 52 or 53 which is targeted by the claimed gRNA. Applicant argues that the combination of Mukherjee and Galetto do not suggest a substitution, insertion or deletion relative to the nucleotide sequence of SEQ ID NO: 52 or 53. Applicant argues that the combination of references does not establish a prima facie case of obviousness. Applicant argues that the sequence alignment from Galetto shows a spacer region between the TALEN targeting sites which is not bound by the TALE nucleases. Applicant argues that the TALEN target site in Galetto contains only a portion of instant SEQ ID NO: 70 and that one of ordinary skill would not have been motivated to change the function of the editing approach in Galetto by targeting the specific target site using the specific gRNA recited in the claims. Applicant argues that Galetto only contains a portion of instant SEQ ID NO: 70 while the spacer recited is located outside of the TALEN cleavage site in both the upstream and downstream directions.
This argument has been fully considered, but is not found persuasive since Galetto discloses nucleotide sequences within exon 3 of an endogenous CD33 gene which is to be modified by a substitution, insertion or deletion as shown below in the sequence search results which show a 100% match between instant SEQ ID NO: 52 and SEQ ID NO: 72 from Galetto. Furthermore, it is emphasized that SEQ ID NO: 58 (CCTCACTAGACTTGACCCAC) is contained within SEQ ID NO: 52 (TTCTCCTCACTAGACTTGACCCACAGGCCCA) and is disclosed by Galetto. Furthermore, it is emphasized that the spacer sequence comprising SEQ ID NO: 70 does not necessarily relate to an exact complement of a portion of exon 3 given that small mismatches between a gRNA spacer sequence and a target DNA can be tolerated. Thus, the complement of SEQ ID NO: 70 identified by Galetto within CD33 exon 3 reads on the claimed mutation site. Additionally, claim 1 only requires a genetically engineered hematopoietic stem or progenitor cell comprising a genetic mutation in exon 3 of an endogenous CD33 gene. It is emphasized that the claims recite a product (genetically engineered hematopoietic stem or progenitor cells which comprise a genetic mutation in exon 3 of an endogenous CD33 gene) by a process (CRSPR/Cas9 editing). Product-by-process claims are not limited to the manipulations of the recited steps, only the structure implied by the steps, see MPEP 2113. The patentability of a product does not depend on its method of production. If the product in the product-by-process claim is the same as or obvious from a product of the prior art, the claim is unpatentable even though the prior product was made by a different process.
Applicant states that although the Examiner has argued that SEQ ID NOs: 99-112s correspond to off-target site mutations as illustrated in Figure 30 which are infrequent given the target specificity of CRISPR/Cas9 systems, such editing effects are not attributable to merely using a CRISPR/Cas9 system irrespective of the gRNA spacer sequence since the spacer sequence influences the editing efficiency.
This argument has been fully considered, but is not found persuasive since the Applicant has failed to provide any evidence that the prior art cell comprises off-target mutations at SEQ ID NOs: 99-112s to support these arguments. Attorney arguments do not replace evidence where evidence is necessary, see MPEP 2145.
Applicant points to data claiming unexpected effects showing the low off-target mutation rates observed using a gRNA comprising a spacer sequence of SEQ ID NO: 70 which were unexpectedly low. Applicant argues that one of ordinary skill in the art would have not expected based on the combination of Mukherjee and Galetto to have achieved the on-target editing rate of 81.2% and off-targeting rates of less than 0.1% as observed after editing hematopoietic stem cells with the gRNA recited in the present claims.
This argument has been fully considered, but is not found persuasive since the claims are directed to a composition of genetically engineered hematopoietic stem or progenitor cells which comprise a genetic mutation in exon 3 of an endogenous CD33 gene rather than the process of editing. The patentability of a product does not depend on its method of production. If the product in the product-by-process claim is the same as or obvious from a product of the prior art, the claim is unpatentable even though the prior product was made by a different process. The present argument is that it would have been a matter of combining prior art elements according to known methods to yield predictable results to mutate this specific site since Galetto shows that it’s an effective target for reducing CD33 gene expression in hematopoietic stem cells. Galetto fully discloses a target sequence within CD33 exon 3 with specific reference to SEQ ID NO: 72 which has a 100% match to the complement of SEQ ID NO: 70 of the instant invention (Galetto, para 414 and Table 11). Galetto describes targeting this region using TALENs to reduce CD33 expression in hematopoietic stem cells (Galetto, example 2). Although TALENs and CRISPR/Cas9 systems have different mechanisms of actions, Galetto discloses that the specific mutational site targeted by the gRNA disclosed in SEQ ID NO: 70 is an effective target for reducing CD33 gene expression in hematopoietic stem cells.
Maintained Nonstatutory Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the "right to exclude" granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Langi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717 .02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP 706.02(1)(1) - 706.02(1)(3) for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Claims 1-21 and 24 stand rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13 of US Patent Number 10,786,535. Although the claims at issue are not identical, they are not patentably distinct from each other because the patented claims would anticipate the instant claims if they were available as prior art. This rejection is repeated for the same reasons as set forth in the Official action mailed on 7/31/2025 and newly applied to claim 24. A response to applicant’s traversal follows the reiterated rejection below.
The patented claims are drawn to a population of genetically engineered human hematopoietic stem cells that are deficient in CD33 expression. The patented claims describe genomic editing via CRISPR which produces an insertion, deletion, and/or substitution of the endogenous gene encoding CD33. The patented claims describe the deletion of one or more nucleotides in the gene encoding CD33. The patented claims read on both bone marrow and peripheral blood mononuclear cell derived human hematopoietic stem cells. Thus, the patented claims fully encompass the instant claims, which describe genetically engineered human hematopoietic stem cells which contain mutations in exon 3 of the CD33 gene at a specific site which is complementary to SEQ ID NO: 70 which results in reduced expression of CD33. Furthermore, SEQ ID NO: 52 and 58 read on exon 3 of the endogenous CD33 gene which is taught in the patented claims. The patented claims would fully anticipate the instantly claimed invention.
Response to Traversal
Applicant points to the amendment to claim 1, which describe a genetic mutation comprising a substitution, insertion or deletion relative to the nucleotide sequence of SEQ ID NO: 52 or 53 which is targeted by the claimed gRNA and amendments to claim 7.
This argument has been fully considered, but is not found persuasive since SEQ ID NO: 52 and 58 read on exon 3 of the endogenous CD33 gene which is taught in the patented claims. The patented claims also describe deletions to CD33, wherein the whole or a portion of the endogenous gene encoding CD33 is deleted (Claim 1). Thus, the patented claims would fully anticipate the instantly claimed invention.
Claims 1-21 and 24 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 5-9, 11, 13-16, 18, 20, 23-26, 28-30, 32-35 of copending US patent application number 16/451,906 (US 2019/0314418). Although the claims at issue are not identical, they are not patentably distinct from each other because the patented claims would anticipate the instant claims if they were available as prior art. This rejection is repeated for the same reasons as set forth in the Official action mailed on 7/31/2025 and newly applied to claim 24. A response to applicant’s traversal follows the reiterated rejection below.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. The copending claims are directed to a genetically engineered human hematopoietic stem cell that is deficient in a lineage-specific cell-surface antigen, with later claims directed to CD33. The copending claims describe CRISPR-Cas9 methods for producing insertion, deletion and/or substitutions of one or more nucleotides in one or more exons of CD33. Thus, the copending claims fully encompass the instant claims, which describe genetically engineered human hematopoietic stem cells which contain mutations in exon 3 of the CD33 gene at a specific site which is complementary to SEQ ID NO: 70 which results in reduced expression of CD33. Furthermore, SEQ ID NO: 52 and 58 read on exon 3 of the endogenous CD33 gene which is taught in the copending claims. The patented claims would fully anticipate the instantly claimed invention. The copending claims would fully anticipate the instantly claimed invention if they were available as art.
Response to Traversal
Applicant points to the amendment to claim 1, which describe a genetic mutation comprising a substitution, insertion or deletion relative to the nucleotide sequence of SEQ ID NO: 52 or 53 which is targeted by the claimed gRNA and amendments to claim 7.
This argument has been fully considered, but is not found persuasive since SEQ ID NO: 52 and 58 read on exon 3 of the endogenous CD33 gene which is taught in the copending claims. The copending claims also describe deletions to CD33, wherein the whole or a portion of the endogenous gene encoding CD33 is deleted (Claim 1). Thus, the copending claims would fully anticipate the instantly claimed invention.
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Dr. ALEXANDER NICOL whose telephone number is (571)272-6383. The examiner can normally be reached on M-F 8-5 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Maria Leavitt can be reached on (571)272-1085. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see https://ppair-my.uspto.gov/pair/PrivatePair. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Alexander Nicol
Patent Examiner
Art Unit 1634
/ALEXANDER W NICOL/Examiner, Art Unit 1634
Prosecution Insights