DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 9/16/2025 has been entered.
Status of Claims
Claims 5-7, 9-10 and 15 are cancelled.
Claims 22-23 are withdrawn.
Claims 1-4, 8, 11-14, 16-21 and 24 are examined on the merits.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Priority of US application 62/731,859 filed 9/15/2018 is acknowledged.
Election/Restrictions
Applicant’s election without traverse of claims 22-23 in the reply filed on 9/16/2025 is acknowledged.
Withdrawn Rejections/Objections
The rejections to claims 11-17 under 35 U.S.C. 102 in the Office action posted 4/16/2025 are withdrawn in view of claim amendments filed 9/16/2025.
The rejections to claims 11-17 under 35 U.S.C. 102 in the Office action posted 4/16/2025 are withdrawn in view of claim amendments filed 9/16/2025.
Claim Rejections - 35 USC § 112
This rejection is newly installed, necessitated by claim amendments.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-4, 8, 18-21 and 21 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites “sequencing amino acids in the at least one target peptide sequence by mass spectroscopy to allow a readout of the coded peptide sequence”. It is not clear why and how sequencing the “at least one target peptide” would achieve “allow[ing] a readout of the coded peptide sequence.” The target peptide is part of the coded peptide sequence, according to the previous step.
It is suggested that claim 1 be amended to recite “sequencing amino acids in the at least one
Claim 18 recites “generating an answer to the polynomial time problem by correlating the amount of the identification portions for each pair of nodes present at the measurement time with the answer to the polynomial time problem” at the last step. It is not clear how the “an answer to the polynomial time problem” can be generated by “correlating the amount of the identification portions for each pair of nodes present at the measurement time with the answer to the polynomial time problem”.
Claim 18 can be amended through providing further explanation.
Claim Rejections - 35 USC § 101
This rejection was instituted at the FAOM. It was withdrawn in the previous Office Action. Upon further consideration and necessitated by claim amendment, this rejection is re-installed herein.
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-4, 8 and 21 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter.
Step 1: Process, Machine, Manufacture or Composition
Claims 1-4, 8 and 21 are directed to a process, here a “method”, with a series functional steps.
Step 2A Prong One: Identification of Abstract Ideas
Claim 1 recites:
creating a recording key by assigning at least two amino acids a binary code identity;
--This step is interpreted as designing and creating an encoding schema so the binary data can be encoded into a peptide sequence like the mapping Table 1 (page 17-18). This encoding schema can be achieved in human mind with the aid of a pen and paper. Although recited as done in computer, nothing can stop human from achieve such a mapping (encoding) schema. Therefore this step equates to an abstract idea of mental processes.
recording the binary code into at least one coded polypeptide by adding the at least two amino acids in sequence to form a coded peptide sequence according to the recording key, wherein the coded peptide sequence corresponds to the binary code;
--This step is interpreted as encoding the binary data into a peptide sequence according to the mapping Table 1 (page 17-18). This data conversion can be achieved in human mind with the aid of a pen and paper. Although recited as done in computer, nothing can stop human from achieve such a data conversion. Therefore this step equates to an abstract idea of mental processes.
reading the coded peptide sequence into the binary code by identifying the at least two amino acids according to their binary code identity;
--This step is interpreted as decoding the peptide sequence into binary data according to the mapping Table 1 (page 17-18). This data conversion can be achieved in human mind with the aid of a pen and paper. Although recited as done in computer, nothing can stop human from achieve such a data conversion. Therefore this step equates to an abstract idea of mental processes.
Step 2A Prong Two: Consideration of Practical Application
The claims result in a process of “reading the coded peptide sequence into the binary code by identifying the at least two amino acids according to their binary code identity” (claim 1), or result in “generating an answer to the polynomial time problem by correlating the amount of the identification portions for each pair of nodes present at the measurement time with the answer to the polynomial time problem”, which are both drawn to abstract ideas of mental processes.
The claims do not recite any additional elements that integrate the abstract idea/judicial exception into a practical application.
This judicial exception is not integrated into a practical application because the claims do not meet any of the following criteria:
An additional element reflects an improvement in the functioning of a computer, or an improvement to other technology or technical field;
an additional element that applies or uses a judicial exception to effect a particular treatment or prophylaxis for a disease or medical condition;
an additional element implements a judicial exception with, or uses a judicial exception in conjunction with, a particular machine or manufacture that is integral to the claim;
an additional element effects a transformation or reduction of a particular article to a different state or thing; and
an additional element applies or uses the judicial exception in some other meaningful way beyond generally linking the use of the judicial exception to a particular technological environment, such that the claim as a whole is more than
a drafting effort designed to monopolize the exception.
Step 2B: Consideration of Additional Elements and Significantly More
The claimed method also recites "additional elements" that are not limitations drawn to an abstract idea. The recited additional elements are drawn to:
providing a binary code (claim 1);
synthesizing the coded peptide sequence for storing the binary code (claim 1);
determining the coded peptide sequence by mass spectroscopy (claim 1);
storing the coded peptide by immobilizing the at least one coded polypeptide on at least one position in a microarray (claim 1);
providing at least one labeled nucleotide sequence to recognize and hybridize with at least one nucleotide recognition sequence of at least one target peptide sequence in the at least one coded polypeptide (claim 1);
sequencing amino acids in the at least one target peptide sequence by mass spectroscopy to allow a readout of the coded peptide sequence (claim 1);
The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because “providing a binary code” is an insignificant extra-solution activity because it is necessary to acquire data input for further analysis.
The claims do not include additional elements that are sufficient to amount of significantly more than the judicial exception because it is routine and conventional to perform the following acts in a biological core facility or in a biological research lab:
providing a binary code (claim 1);
synthesizing the coded peptide sequence for storing the binary code (claim 1);
determining the coded peptide sequence by mass spectroscopy (claim 1);
storing the coded peptide by immobilizing the at least one coded polypeptide on at least one position in a microarray (claim 1);
providing at least one labeled nucleotide sequence to recognize and hybridize with at least one nucleotide recognition sequence of at least one target peptide sequence in the at least one coded polypeptide (claim 1);
sequencing amino acids in the at least one target peptide sequence by mass spectroscopy to allow a readout of the coded peptide sequence (claim 1);
Viewed as a whole, these additional claim element(s) do not provide meaningful limitation(s) to transform the abstract idea recited in the instantly presented claims into a patent eligible application of the abstract idea such that the claim(s) amounts to significantly more than the abstract idea itself. Therefore, the claim(s) are rejected under 35 U.S.C. 101 as being directed to non-statutory subject matter.
Claim Rejections - 35 USC § 103
This rejection is strengthened by incorporating the previous 102 rejection to claims 11-14 and 16-17. Modifications are necessitated by claim amendments.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 11-14 and 16-17 are rejected under 35 U.S.C. 102(a)(1) as being unpatentable over Tahereh (“Cognitive cell with coded chemicals for generating outputs from environmental inputs and method of using same”, WO 2018/009770 A1, Published 1/11/2018. Cited on the 3/12/2021 IDS).
Claim 11 is interpreted as a molecular system for solving the polynomial time problem. Regarding claim 11, Tahereh discloses a system for solving a polynomial time problem (a multi-node process comprising applying a hybrid DNA/protein algorithm to a nondeterministic polynomial problem; page 57, paragraph [0049]) comprising (emphasis added):
a polynomial time problem (a multi-node process comprising applying a hybrid DNA/protein algorithm to a nondeterministic polynomial problem; page 57, paragraph [0049]) and a map (is a schematic diagram depicting an example traveling salesman problem; page 3, paragraph [0021]; Figure 12), wherein the map includes N number of map locations with a distance between their map locations (given a list of cities and the distances between each pair of cities; page 42, paragraph [0002]); and a closed loop molecular structure having a number N of nodes located along the closed loop molecular structure (vector DNA with 4 nodes connected by 12 routes; page 42, paragraph [0003], Figure 12), wherein each of the N nodes corresponds to a different map location (vector DNA with 4 nodes connected by 12 routes; page 42, paragraph [0003]; page 55, paragraph [0041]).
Tahereh provides (Page 42, par [0006]) “In at least one aspect, the disclosure relates to a synthetic, cognitive cell for automatically generating an output based on an environmental input. The cognitive cell comprises an operator comprising chemical agents, and a coded chemical comprising polymers. … The coded chemical and at least one chemical agent are contained within a natural or synthetic membrane”, which suggests a polymer microbead as a cognitive cell is a microbead.
Tahereh teaches wherein each of the N nodes is connected to a different node by an oligomer containing chain (vector DNA with 4 nodes connected by 12 routes, wherein paths including different combinations of cities and roads are generated by the hybridization reaction between the sequences of cities and their complements flanking parts on both sides of cost sequences; page 42, paragraph [0003]; page 55, paragraph [0041]),
wherein each of the nodes is connected to N-1 different single stranded oligonucleotide identification sequences (since every edge in TSP has a specific weight, the coding sequences of each city (oligonucleotide) of each edge is defined based on their weight; and paths including different combinations of cities and roads are generated by the hybridization reaction between the sequences of cities and their complements flanking parts on both sides of cost sequences; page 53, paragraph [0035]; page 55, paragraph [0040]), wherein each single stranded oligonucleotide identification sequence contains an identification portion (applying specific forward primer for the first part of city A and back ward primer for the second part of city A (unique identification sequence for city A); page 56, paragraph [0043]), wherein the identification portion contains a sequence which corresponds to an identity of the node to which it is attached (applying specific forward primer for the first part of city A and back ward primer for the second part of city A (unique identification sequence for city A); page 56, paragraph [0043]), and an interaction portion (paths including different combinations of cities and roads are generated by the hybridization reaction between the nucleotide sequences of cities and their complements flanking parts on both sides of cost sequences; page 55, paragraph [0040]), which is complementary to one single stranded oligonucleotide identification sequence on another node (paths including different combinations of cities and roads are generated by the hybridization reaction between the sequences of cities and their complements flanking parts on both sides of cost sequences; page 55, paragraph [0040]), wherein each pair of single stranded oligonucleotide identification sequences that is capable of hybridizing with its complementary single stranded oligonucleotide identification sequence (paths including different combinations of cities (oligonucleotide identification sequences) and roads are generated by the hybridization reaction between the sequences of cities and their complements flanking parts on both sides of cost sequences; page 55, paragraph [0040]), to form a double stranded oligonucleotide identification sequence between a pair of nodes (merge operation of cities and costs in the hybrid DNA/protein algorithm is based on the sequential hybridization and ligation reactions between the Watson-Crick complimentary DNA sequences (formation of double stranded sequence); page 55, paragraph [0041]), has a length corresponding to the distance between the map location of the pair of nodes (given a list of cities and the distances (length) between each pair of cities (pair of nodes); page 42 paragraph [0002]).
Tahereh provides (Page 42, [0003]) “Figure 12 schematically represents an example TSP 1200. The non-limiting example presented in Figure 12 has 4 nodes (cities) 1230 connected by 12 routes (roads) 1232. The traveling salesman problem starts at a given city 1230, and travels along paths 1232 of various lengths such that each other city is visited exactly once before the route ends back at the starting city 1230. The paths start and end with city A. Cities are defined by A-D squares. Squares Al-Dl represent the initial 9 nucleotides of each city, squares A2-D2 represents the 9 end nucleotides of each city, and arrows represent the roads. The numbers on each arrow represents the cost on the given road. [0004] The TSP finds a minimum cost (weight) path for a given set of cities (nodes or vertices) and roads (routes or edges). The path must pass each city exactly once and return to the original city. In a TSP with N cities, (N-1)! possible solutions exist. This means that for only 10 cities there are over 180 thousand combinations to try (since the start city is defined, there can be permutations on the remaining nine), resulting in 91/2=181440 possible solutions”, which suggest N-1 connections among the N nodes.
Regarding claim 12, Tahereh discloses the system of claim 11, and Tahereh further discloses wherein the single stranded oligonucleotide identification sequences include single stranded DNA (gene sequences of cities and costs are designed by 18 and 27 per single stranded DNA; page 55, paragraph [0040]), a RNA, a single stranded polymer, or combinations thereof.
Regarding claim 13, Tahereh discloses the system of claim 11, and Tahereh further discloses wherein the oligomer includes amino acids, nucleic acids (since every edge in TSP has a specific weight, the unique single stranded genetic sequence of each edge is defined based on their weight; page 53, paragraph [0031]), polyethylene glycol, an acrylate polymer, a water-soluble polymer, or combinations thereof.
Regarding claim 14, Tahereh discloses the system of claim 11, and Tahereh further discloses wherein the closed loop molecular structure is dissolved in an aqueous buffer solution containing at least one polar buffer {the buffer may be a fluid, e.g., water phosphate buffer; page 6, paragraph [0031]), a hydrogel, or a combination thereof.
Regarding claim 16, Tahereh discloses the system of claim 11, and Tahereh further discloses wherein the nodes are connected to the single stranded oligonucleotide identification sequences including a streptavidin-avidin bond, an overlapping polynucleotide handle (ligation of roads and node sequence; page 51, paragraph [0029]), or a combination thereof.
Regarding claim 17, Tahereh discloses the system of claim 13, and Tahereh further discloses wherein at least one oligomer containing chain includes at least one restriction enzyme recognition site (each gene construct is inserted into back-bone plasmid through its multiple cloning site by applying the matching restriction enzyme for each gene construct; page 27, paragraph [0098]), at least one protease cleavage site, or combination thereof.
Claims 18-19 and 24 are rejected under 35 U.S.C. 103 as being unpatentable over Tahereh as applied to claims 11-17 above, and in view of Nordhoff ("Rapid determination of short DNA sequences by the use of MALDI-MS." Nucleic Acids Research 28.20 (2000): e86-e86. Cited on the 3/12/2021 IDS).
Claims 18 and 19 are interpreted as a method of solving a polynomial time problem using oligonucleotide hybridization in aqueous solution. Regarding claim 18, Tahereh is applied to claims 11-17 above. Tahereh discloses the system of claim 12, and Tahereh further discloses a method of solving a polynomial time problem (a multi-node process comprising applying a hybrid DNA/protein algorithm to a nondeterministic polynomial problem; page 57, paragraph [0048]) comprising: providing the polynomial time problem (a multi-node process comprising applying a hybrid DNA/protein algorithm to a nondeterministic polynomial problem; page 57, paragraph [0048]), the map (is a schematic diagram depicting an example traveling salesman problem; page 3, paragraph [0021]; Figure 12), and the closed loop molecular structure (vector DNA with 4 nodes connected by 12 routes; page 42, paragraph [0003]; page 55, paragraph [0041]), wherein the molecular structure is in an aqueous buffer solution (the buffer may be a fluid, e.g., water phosphate buffer; page 5, paragraph [0031]); forming double stranded oligonucleotide identification sequences between the nodes (merge operation of cities and costs in the hybrid DNA/protein algorithm is based on the sequential hybridization and ligation reactions between the Watson-Crick complimentary DNA sequences; page 55, paragraph (0041]); correlating the sequence of the identification portion to the pair of nodes they identified (nodes denote different genes, while roads are the correlation between the expression of two genes; paragraph [0011 ]); quantifying a value of the identification portions for each pair of nodes (the most economical path which is represented by a peptide with the lowest pKa value from other candidate paths; page 57, paragraph [0047]); and generating an answer to the polynomial time problem by correlating the amount of the identification portions for each pair of nodes present at the measurement time with the answer to the polynomial time problem (the process may also involve a method of optimizing the efficiency a vehicle routing process for an autonomous vehicle, comprising: applying a hybrid DNA/protein algorithm to a nondeterministic polynomial problem comprising multiple nodes, wherein each of said multiple nodes represents a point within the vehicle routing process and each point only occurs once. thereby establishing a optimally efficient route for said autonomous vehicle, and programming said optimally efficient route into said autonomous vehicle; page 58, paragraph [0049]).
Tahereh does not disclose heating the aqueous buffer solution at a heating rate to a measurement temperature; adding a double stranded detection molecule to the aqueous buffer at a measurement time; sequencing the double stranded oligonucleotide identification sequences present at the measurement time by mass spectroscopy to provide the sequences of the identification portions of a pair of nodes.
Nordhoff does disclose heating the aqueous buffer solution at a heating rate to a measurement temperature (heated to 94 degrees for two minutes; page 2, 1st column, 3rd paragraph}; adding a double stranded detection molecule to the aqueous buffer at a measurement time (double-stranded DNA templates heated to 94 degrees for two minutes; page 2, 1st column, 3rd paragraph); sequencing the double stranded oligonucleotide identification sequences present at the measurement time by mass spectroscopy to provide the sequences of the identification portions of a pair of nodes (a protocol for rapid sequencing of DNA using MALDI-TOF MS; abstract).
Regarding claim 19, Tahereh and Nordhoff, in combination, disclose the method of claim 18, and Tahereh discloses further comprising: providing sample vessels containing the molecular structure in an aqueous buffer solution (QIAGEN multiplex PCR kit; page 56, paragraph (0043]}; forming double stranded oligonucleotide identification sequences between the nodes in the sample vessels at room temperature (the gene sequences of all cities and roads annealed together through the Watson-Crick hybridization at 20 C; page 56, paragraph [0042]), wherein the double stranded oligonucleotide identification sequences include at least one nucleotide-binding sequence selected from a TALE identification sequence (the plasmid PET- TALEN-HIS; page 22, paragraph [0083]), a zinc finger sequence, a CRISPR recognition sequence, or a combination thereof, wherein the double stranded detection molecule is selected from a TALE DNA recognition domain (the plasmid PET- TALEN-HIS; page 22, paragraph [0083]), a zinc finger, a CRISPR-cas9 recognition domain, or a combination thereof.
Tahereh does not disclose sequencing the double stranded oligonucleotide identification sequences present in the at least two sample vessels at the least two measurement times by mass spectroscopy to provide the sequences of the identification portions of pairs of nodes. It would have been obvious to one of ordinary skill in the art at the time the invention was made to disclose at least two sample vessels, since the previous disclosure by Tahereh includes samples (page 27, paragraph [0099]), and discovering the optimum value of a result effective variable involves only routine skill in the art, and the result would have been data run in duplicate which would show reproducibility of the results.
Nordhoff does disclose sequencing the double stranded oligonucleotide identification sequences present in the at least two sample vessels at the least two measurement times by mass spectroscopy to provide the sequences of the identification portions of pairs of nodes (a protocol for rapid sequencing of DNA using MALDI-TOF MS; abstract).
Regarding claim 24, Tahereh provides (pages 41-42, Section “EXAMPLE 3 - LOGIC COGNITIVE CELL” par. [0001-0002]) “Figures 2C and 12-17 depict aspects of the logic cognitive cell 202c and cognitive process 204c. In this example, the cognitive cell 202c is used as part of a computational cognitive system for solving a set of decision making problems in computer science using DNA/proteins for information storage in molecules. To solve the TSP (traveling sales person) problem, the cognitive cell 202c may be provided with a coded chemical 111c and an operator 112c capable of storing information concerning the TSP problem, and performing reactions to generate the solution”, and
“This logic operation 204c may be used to optimize efficiency of multi-node processes to solve problems, such as Nondeterministic Polynomial time (NP) problems. P problems are a class of mathematical problems which have exponential complexity, for which an efficient solution may not be available. The NP complete problems are categorized as a class of decision problems in computational complexity theory. The travelling salesman problem (TSP) is an example of an NP-hard problem in combinatorial optimization, used in operations research and theoretical computer science. The TSP asks the following question: Given a list of cities and the distances between each pair of cities, what is the shortest possible route that visits each city exactly once and returns to the origin city?”
Therefore Tahereh teaches the polynomial time problem is a traveling salesman problem.
It would have been obvious to a person of ordinary skill in the art, at the time of the invention, to have modified the method, as previously disclosed by Tahereh, for the integration of heating the aqueous buffer solution at a heating rate to a measurement temperature; adding a double stranded detection molecule to the aqueous buffer at a measurement time; sequencing the double stranded oligonucleotide identification sequences present at the measurement time by mass spectroscopy to provide the sequences of the identification portions of a pair of nodes, as previously disclosed by Nordhoff, as the previous disclosure by Tahereh includes biological solutions may be generated using techniques based on the physical properties of the DNA molecule including the length or melting temperature of DNA sequences (page 43, paragraph [0009]), the Nordhoff reference discloses a protocol for rapid sequencing of DNA using MALDI-TOF MS (abstract), and this combination would provide a protocol optimized for low costs; and solid phase purification, concentration and mass spectrometric sample preparation of the sequencing products are accomplished in a few minutes (abstract). There would be an expectation of successfully combining the Nordhoff with Tahereh because both analyze DNA of different aspects with various sequencing techniques, and these two methods operate independently, one would expect success as this is a simple combination of prior art elements according to known methods to yield predictable results (MPEP §2143.I.(A)).
Claim 20 is rejected under 35 U.S.C. 103 as being unpatentable over Tahereh and Nordhoff as applied to claims 18-19 and 24 above, in view of Barbas.
Claim 20 further limits the method of solving a polynomial time problem. Regarding claim 20, Tahereh and Nordhoff, in combination, disclose the method of claim 18, but Tahereh in view of Nordhoff does not disclose further comprising: labeling the double stranded detection molecule before adding the double stranded molecule to the aqueous buffer at the measurement time; and detecting a signal from the labeled double stranded detection molecule before sequencing the double stranded oligonucleotide identification sequences present at the measurement time. Barbas does disclose labeling the double stranded detection molecule before adding the double stranded molecule to the aqueous buffer at the measurement time (exposing the fusion protein to a sample containing one or more double-stranded DNA molecules linked to a fluorescent moiety and used to label the protein of interest so that any double-stranded DNA molecule possessing a defined nucleotide sequence bound by a zinc finger tag incorporated in a fusion protein is bound; paragraphs [0017], [0044]); and detecting a signal from the labeled double stranded detection molecule before sequencing the double stranded oligonucleotide identification sequences present at the measurement time (analyzing the binding of DNA molecules to the fusion proteins in order to determine whether DNA molecules possessing any of the defined nucleotide sequences are present in the sample; paragraph [0017]).
It would have been obvious to a person of ordinary skill in the art, at the time of the invention, to have modified the method, as previously disclosed by Tahereh in view of Nordhoff, for the integration of labeling the double stranded detection molecule before adding the double stranded molecule to the aqueous buffer at the measurement time; and detecting a signal from the labeled double stranded detection molecule before sequencing the double stranded oligonucleotide identification sequences present at the measurement time, as previously disclosed by Barbas, as the previous disclosure by Tahereh in view of Nordhoff includes DNA sequences corresponding to the nodes (or cities) may be designed with equal cost which is coded by nucleotide sequences for nonpolar amino acids (paragraph [0035]), the Barbas reference discloses exposing the fusion protein to a sample containing one or more double-stranded DNA molecules linked to a fluorescent moiety and used to label the protein of interest so that any double-stranded DNA molecule possessing a defined nucleotide sequence bound by a zinc finger tag incorporated in a fusion protein is bound (paragraphs [0017], [0044]), and this combination would provide a means for the tracking of proteins in living cells and for the assembly of proteins into arrays (paragraph [0008]). Because Tahereh in view of Nordhoff’s method for rapid sequencing of DNA using MALDI-TOF MS (Nordhoff: abstract), does not interrupt with Bass’ method for labeling the double stranded detection molecule and detecting a signal from the labeled double stranded, and these two methods operate independently, one would expect success as this is a simple combination of prior art elements according to known methods to yield predictable results (MPEP §2143.I.(A)).
Claims 1-4 and 8 are rejected under 35 U.S.C. 103 as being unpatentable over Smirnov (“Methods of encoding and decoding information”, RU2659025C1, granted and published 6/26/2018. Cited on the 3/12/2021 IDS), in view of Tahereh as applied to claims 11-14 and 16-17 above, and Gordon (“Proteomic analysis with nucleic acid identifiers”, WO 2016145416 A2, published 9/15/2016. Cited on the 3/12/2021 IDS).
Claim 1 is interpreted as a method for recording and reading binary code using amino acids or oligonucleotides. Regarding claim 1, Smirnov discloses a method of recording and reading a binary code (the information encoded by the described method is recorded in binary form and decoded; abstract; page 16, 2nd paragraph) comprising: providing a binary code (combining the binary code; page 7, 5th paragraph); creating a recording key by assigning at least two amino acids a binary code identity (a linear matrix representation of a matrix formed from 64 triplets used for coding for DNA, RNA and amino acids with binary indexing information corresponding to each matrix element; page 5, 11th paragraph; Figure 1); recording the binary code into at least one coded polypeptide by adding the at least two amino acids in sequence to form a coded peptide sequence according to the recording key (the information to be coded is lined up as a sequence of nitrogenous bases to be coded on the protein level; claim 10), wherein the coded peptide sequence corresponds to the binary code (the binary indices of the molecular genetic system correspond to the selected characteristic of nitrogenous bases for amino acids; claim 19); and reading the coded peptide sequence into the binary code by identifying the at least two amino acids according to their binary code identity (sequencing technologies and special software can be used to translate the genetic code back into a binary; page 16, 2nd paragraph).
Smirnov does not disclose synthesizing a peptide, storing the peptide on an immobilized membrane, or determining the coded peptide sequence by mass spectroscopy.
Tahereh disclose synthesizing a peptide (page 27, par. [0098]) (“ In an example, the cognitive cell 202a is synthesized in a configuration that produces a recombinant protein (e.g., spider silk, Insulin, albumin, collagen or each of the enzymes for the desired synthetic pathways such as different units of a solar cell, Glucose- ATP battery, etc.). Gene constructs of each recombinant protein/ polymer are designed using the known DNA sequence relevant to each gene construct”).
Tahereh disclose storing the peptide on an immobilized membrane (page 24, par. [0088]) (“The enzyme cluster 706a may include Ribulose-1,5 bisphosphate,
carboxylase/oxygenase, phosphoglycerate kinase and glyceraldehyde-3-
phosphatedehydrogenase, hexoisomerase, Aldolase, fructose 1,6 bisphosphatase, and
phosphoglycerate kinase which may be immobilized on the artificial membrane I 03 of cell 202a. In addition, the catalyst cobaxime may be bound to the membrane I 03 to form a cobaxime coated membrane 706a”).
Tahereh disclose determining the coded peptide sequence by mass spectroscopy (MALDI-TOF is used as the amino acid sequencing method; page 27, paragraph [0099]).
Smirnov in view of Tahereh, does not disclose further comprising: providing at least one labeled nucleotide recognizing the at least one nucleotide recognition sequence; and identifying a target peptide sequence in the coded peptide sequence by hybridizing the at least one labeled nucleotide to the at least one nucleotide recognition sequence.
Gordon does disclose further comprising: providing at least one labeled nucleotide recognizing the at least one nucleotide recognition sequence (the Cas9-expressing eukaryotic cell or eukaryote, can have labelled guide RNA delivered or administered thereto; paragraphs [0189], [0198]); and identifying a target peptide sequence in the coded peptide sequence by hybridizing the at least one labeled nucleotide to the at least one nucleotide recognition sequence (the Cas9-expressing eukaryotic cell or eukaryote, can have labelled guide RNA delivered or administered thereto (which would induce binding of the nucleotide recognition sequence to the guide RNA); paragraphs [0189], [0198]).
Regarding claim 2, Smirnov, Tahereh and Gordon, in combination, disclose the method of claim 1, and Smirnov further discloses wherein from two to sixteen amino acids are assigned a binary code identity (a linear matrix representation of a matrix formed from 64 triplets used for coding for DNA, RNA and amino acids with binary indexing information corresponding to each matrix element; page 5, 11th paragraph; Figure 1 ); or the at least one coded polypeptide sequence is formed by chemical-based peptide synthesis, or by in vitro translation of at least one recombinant polynucleotide sequence encoding the at least one coded peptide sequence, or a combination thereof.
Claims 3-4 further limit the method of recording and reading a binary code. Regarding claim 3, Smirnov, Tahereh and Gordon, in combination, disclose the method of claim 1. Gordon does disclose further comprising: identifying at least one target peptide sequence in the at least one coded polypeptide (target polypeptides identified by mass spectrometry; paragraphs [0003], [0120]), wherein the at least one target peptide sequence includes at least one detectable label on a polypeptide N-terminus (N-acetoxysuccinimide or acetate can be used to differentially label the N-terminus; paragraph (0064]), at least one detectable label on a polypeptide C-terminus (all target polypeptides may be encoded to include a common affinity tag or other epitope on a N- or C-terminus; paragraph [0163]), at least one nucleotide recognition sequence (such as the insertion of peptide identifier elements, can be made by way of the CRISPR-Cas system; paragraph [0189]), at least one protease recognition sequence (fused to a protease-cleavable polypeptide identifier element; paragraph [0222]), or a combination thereof; and determining the target peptide sequence by mass spectroscopy (target polypeptides identified by mass spectrometry; paragraphs [0003], [0120]).
Regarding claim 4, Smirnov, Tahereh and Gordon, in combination, disclose the method of claim 3, but Smirnov in view of Tahereh, does not disclose wherein the at least one nucleotide recognition sequence includes a TALE identification sequence, a zinc finger sequence, a CRISPR recognition sequence (such as the insertion of peptide identifier elements, can be made by way of the CRISPR-Cas system; paragraph [0189]), or a combination thereof.
Gordon does disclose wherein the nucleotide recognition sequence includes a CRISPR recognition sequence (such as the insertion of peptide identifier elements, can be made by way of the CRISPR-Cas system; paragraph [0189]).
Regarding claim 8, Smirnov, Tahereh and Gordon, in combination, disclose the method of claim 1. Gordon does disclose further comprising: identifying at least one target peptide sequence in the at least one coded polypeptide (target polypeptides identified by mass spectrometry; paragraphs [0003], [0120]), wherein the at least one target peptide sequence includes at least one detectable label on a polypeptide N-terminus (N-acetoxysuccinimide or acetate can be used to differentially label the N-terminus; paragraph (0064]), at least one detectable label on a polypeptide C-terminus (all target polypeptides may be encoded to include a common affinity tag or other epitope on a N- or C-terminus; paragraph [0163]), at least one nucleotide recognition sequence (such as the insertion of peptide identifier elements, can be made by way of the CRISPR-Cas system; paragraph [0189]), at least one protease recognition sequence (fused to a protease-cleavable polypeptide identifier element; paragraph [0222]), or a combination thereof; and determining the target peptide sequence by mass spectroscopy (target polypeptides identified by mass spectrometry; paragraphs [0003], [0120]).
Tahereh provides (page 30, par. [00111]) “In this example, the synthetic photosynthesis cognitive cell 202a is shown between a pair of membranes 803 a and 803b. The upper membrane 803 a may be a synthetic membrane, such as a piece of glass. The lower membrane 803b may be a biological membrane, such as a lipid bilayer”, which teaches the glass as immobilization membrane.
It would have been obvious to a person of ordinary skill in the art, at the time of the invention, to have modified the method disclosed by Smirnov with Tahereh’s method for determining the coded peptide sequence by mass spectroscopy (MALDI-TOF is used as the amino acid sequencing method; page 27, paragraph [0099]). As previously disclosed method by Smirnov includes recording and reading a binary code (the information encoded by the described method is recorded in binary form and decoded; abstract; page 16, 2nd paragraph); creating a recording key by assigning at least two amino acids a binary code identity (a linear matrix representation of a matrix formed from 64 triplets used for coding for DNA, RNA and amino acids with binary indexing information corresponding to each matrix element; page 5, 11th paragraph; Figure 1); and recording the binary code into at least one coded polypeptide by adding the at least two amino acids in sequence to form a coded peptide sequence according to the recording key (the information to be coded is lined up as a sequence of nitrogenous bases to be coded on the protein level; claim 10), and this combination would provide a comprehensive method for encoding, storing, and decoding binary data in peptides.
One would reasonably expect success because Smirnov’s method for creating and recording of polypeptide sequence does not interrupt with Tahereh’s method for identifying target peptide sequence in the coded polypeptide, and these two methods operate independently. This is a simple combination of prior art elements according to known methods to yield predictable results (MPEP §2143.I.(A)).
It would have been obvious to a person of ordinary skill in the art, at the time of the invention, to have modified the method, as previously disclosed by Smirnov in view of Tahereh, for the integration of: identifying at least one target peptide sequence in the at least one coded polypeptide, wherein the at least one target peptide sequence includes at least one detectable label on a polypeptide N-terminus, at least one detectable label on a polypeptide C-terminus at least one nucleotide recognition sequence, at least one protease recognition sequence, or a combination thereof; and determining the target peptide sequence by mass spectroscopy, as previously disclosed by Gordon. As the previous disclosure by Smirnov in view of Tahereh includes increased efficiency of noise-immune encoding/decoding of information by increasing the amount of information transmission/reception while reducing the number of elements used (abstract), the Gordon reference discloses target polypeptides identified by mass spectrometry; paragraphs [0003], (0120]), and this combination would provide labeling the target polypeptides in the discrete volumes with origin-specific barcodes present in the discrete volumes to create origin-labeled target polypeptides, wherein the origin-labeled target polypeptides from each individual discrete volume comprise the same unique indexing nucleic acid identification or matched sequence; and detecting the nucleotide sequence of the origin-specific barcodes, thereby assigning the set of target polypeptides to a specific discrete volume, while maintaining information about sample origin of the target polypeptides; and/or labeling the target polypeptides in the discrete volume with distinguishable mass tags present in the discrete volumes to create mass tag labeled target polypeptides (paragraph [0003]). Because Smirnov, in view of Tahereh’s method for creating and recording of polypeptide sequence does not interrupt with Gordon’s method for identifying target peptide sequence in the coded polypeptide (Gordon: [3, 120]), and these two methods operate independently, one would expect success as this is a simple combination of prior art elements according to known methods to yield predictable results (MPEP §2143.I.(A)).
Claim 21 is rejected under 35 U.S.C. 103 as being unpatentable over Smirnov in view of Tahereh and Gordon, as applied to claims 1-4 above, in view of Zhang, Feng And Cong, Le (“Nucleotide-specific recognition sequences for designer TAL”, Patent No. 8450107, prior filing date: 2012-07-20. Newly cited).
Claim 21 recites one labelled nucleotide sequence. Here is the sequence search report:
RESULT 1
US-13-604-945-28
(NOTE: this sequence has 5 duplicates in the database searched.
See complete list at the end of this report)
Sequence 28, US/13604945
Patent No. 8450107
GENERAL INFORMATION
APPLICANT: ZHANG, FENG
APPLICANT: CONG, LE
TITLE OF INVENTION: NUCLEOTIDE-SPECIFIC RECOGNITION SEQUENCES FOR DESIGNER TAL
TITLE OF INVENTION: EFFECTORS
FILE REFERENCE: 44790.01.2006
CURRENT APPLICATION NUMBER: US/13/604,945
CURRENT FILING DATE: 2012-09-06
PRIOR APPLICATION NUMBER: 13/554,922
PRIOR FILING DATE: 2012-07-20
PRIOR APPLICATION NUMBER: 61/565,171
PRIOR FILING DATE: 2011-11-30
NUMBER OF SEQ ID NOS: 392
SEQ ID NO 28
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Description of Artificial Sequence: Synthetic
oligonucleotide
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TGAAGCACTTACTTTAGAAA 20
||||||||||||||||||||
Db 1 TGAAGCACTTACTTTAGAAA 20
It would have been obvious to a person of ordinary skill in the art, at the time of the invention, to have modified the method, as previously disclosed by Smirnov in view of Tahereh and Gordon, for the integration of further comprising: including at least one nucleotide-binding sequence in the at least one coded polypeptide; immobilizing the at least one coded polypeptide on at least one position in a microarray; providing at least one detectably labeled polynucleotide recognized by the at least one nucleotide-binding sequence; and identifying at least one target coded polypeptide by hybridizing the at least one detectably labeled polynucleotide to the at least one nucleotide-binding sequence, as the previous disclosure by Smirnov in view of Tahereh and Gordon. The Zhang reference demonstrated that Seq ID NO: 2 has a high affinity for the designer Tal. Because Smirnov, in view of Tahereh’s and Gordon’s method are looking for nucleotide sequence recognizable by polypeptide and Zhang’s proved the binding between the nucleotide and Tal, one would expect success as this is a simple combination of prior art elements according to known methods to yield predictable results (MPEP §2143.I.(A)).
Response to Applicant’s Arguments
In the Remarks filed 9/16/2025, Applicant argued that Tahereh does not teach (page 8, penultimate para through page 10, 3rd para) “N nodes comprises a polymer microbead and that the oligomer containing chains and N-1 different single stranded oligonucleotide identification sequences”.
To response, Applicant’s argument is not persuasive. Tahereh does not teach a polymer microbead explicitly, but Tahereh disclosed a system for solving a polynomial time problem (a multi-node process comprising applying a hybrid DNA/protein algorithm to a nondeterministic polynomial problem; page 57, paragraph [0049]) comprising (emphasis added):
a polynomial time problem (a multi-node process comprising applying a hybrid DNA/protein algorithm to a nondeterministic polynomial problem; page 57, paragraph [0049]) and a map (is a schematic diagram depicting an example traveling salesman problem; page 3, paragraph [0021]; Figure 12), wherein the map includes N number of map locations with a distance between their map locations (given a list of cities and the distances between each pair of cities; page 42, paragraph [0002]); and a closed loop molecular structure having a number N of nodes located along the closed loop molecular structure (vector DNA with 4 nodes connected by 12 routes; page 42, paragraph [0003], Figure 12), wherein each of the N nodes corresponds to a different map location (vector DNA with 4 nodes connected by 12 routes; page 42, paragraph [0003]; page 55, paragraph [0041]).
Tahereh provides (Page 42, par [0006]) “In at least one aspect, the disclosure relates to a synthetic, cognitive cell for automatically generating an output based on an environmental input. The cognitive cell comprises an operator comprising chemical agents, and a coded chemical comprising polymers. … The coded chemical and at least one chemical agent are contained within a natural or synthetic membrane”, which suggests a polymer microbead as a cognitive cell is a microbead.
Tahereh teaches wherein each of the N nodes is connected to a different node by an oligomer containing chain (vector DNA with 4 nodes connected by 12 routes, wherein paths including different combinations of cities and roads are generated by the hybridization reaction between the sequences of cities and their complements flanking parts on both sides of cost sequences; page 42, paragraph [0003]; page 55, paragraph [0041]),
wherein each of the nodes is connected to N-1 different single stranded oligonucleotide identification sequences (since every edge in TSP has a specific weight, the coding sequences of each city (oligonucleotide) of each edge is defined based on their weight; and paths including different combinations of cities and roads are generated by the hybridization reaction between the sequences of cities and their complements flanking parts on both sides of cost sequences; page 53, paragraph [0035]; page 55, paragraph [0040]), wherein each single stranded oligonucleotide identification sequence contains an identification portion (applying specific forward primer for the first part of city A and back ward primer for the second part of city A (unique identification sequence for city A); page 56, paragraph [0043]), wherein the identification portion contains a sequence which corresponds to an identity of the node to which it is attached (applying specific forward primer for the first part of city A and back ward primer for the second part of city A (unique identification sequence for city A); page 56, paragraph [0043]), and an interaction portion (paths including different combinations of cities and roads are generated by the hybridization reaction between the nucleotide sequences of cities and their complements flanking parts on both sides of cost sequences; page 55, paragraph [0040]), which is complementary to one single stranded oligonucleotide identification sequence on another node (paths including different combinations of cities and roads are generated by the hybridization reaction between the sequences of cities and their complements flanking parts on both sides of cost sequences; page 55, paragraph [0040]), wherein each pair of single stranded oligonucleotide identification sequences that is capable of hybridizing with its complementary single stranded oligonucleotide identification sequence (paths including different combinations of cities (oligonucleotide identification sequences) and roads are generated by the hybridization reaction between the sequences of cities and their complements flanking parts on both sides of cost sequences; page 55, paragraph [0040]), to form a double stranded oligonucleotide identification sequence between a pair of nodes (merge operation of cities and costs in the hybrid DNA/protein algorithm is based on the sequential hybridization and ligation reactions between the Watson-Crick complimentary DNA sequences (formation of double stranded sequence); page 55, paragraph [0041]), has a length corresponding to the distance between the map location of the pair of nodes (given a list of cities and the distances (length) between each pair of cities (pair of nodes); page 42 paragraph [0002]).
As discussed above over the 103 rejection. Consequently, Tahereh is no longer applied to a 102 (a)(1) rejection but Tahereh is applied for the 103 rejection over claim 11.
In the Remarks, Applicant argued that Tahereh does not teach (page 10, last para through page 11, 3rd para) “the closed loop molecular structures”.
To response, Applicant’s argument is not persuasive. Tahereh disclosed a system for solving a polynomial time problem (a multi-node process comprising applying a hybrid DNA/protein algorithm to a nondeterministic polynomial problem; page 57, paragraph [0049]) comprising (emphasis added): a polynomial time problem (a multi-node process comprising applying a hybrid DNA/protein algorithm to a nondeterministic polynomial problem; page 57, paragraph [0049]) and a map (is a schematic diagram depicting an example traveling salesman problem; page 3, paragraph [0021]; Figure 12), wherein the map includes N number of map locations with a distance between their map locations (given a list of cities and the distances between each pair of cities; page 42, paragraph [0002]); and a closed loop molecular structure having a number N of nodes located along the closed loop molecular structure (vector DNA with 4 nodes connected by 12 routes; page 42, paragraph [0003], Figure 12), wherein each of the N nodes corresponds to a different map location (vector DNA with 4 nodes connected by 12 routes; page 42, paragraph [0003]; page 55, paragraph [0041]). Therefore, Tahereh does teach the closed loop molecular structures.
In the Remarks, Applicant argued that newly amended claim 1 components (page 11, 5th para through page 12, 1st para) “claim 1 has been amended to recite a method of recording and reading a binary code comprising steps of synthesizing the coded peptide sequence for storing the binary code and storing the coded peptide by immobilizing the at least one coded polypeptide on at least one position in a microarray, wherein the method provides built-in direct random data access capability and data storage” are not taught.
To response, Applicant’s argument is not persuasive. Although Smirnov does not disclose synthesizing a peptide, or storing the peptide on an immobilized membrane, Tahereh does disclose synthesizing a peptide (page 27, par. [0098]) (“ In an example, the cognitive cell 202a is synthesized in a configuration that produces a recombinant protein (e.g., spider silk, Insulin, albumin, collagen or each of the enzymes for the desired synthetic pathways such as different units of a solar cell, Glucose- ATP battery, etc.). Gene constructs of each recombinant protein/ polymer are designed using the known DNA sequence relevant to each gene construct”).
Tahereh also disclose storing the peptide on an immobilized membrane (page 24, par. [0088]) (“The enzyme cluster 706a may include Ribulose-1,5 bisphosphate,
carboxylase/oxygenase, phosphoglycerate kinase and glyceraldehyde-3-
phosphatedehydrogenase, hexoisomerase, Aldolase, fructose 1,6 bisphosphatase, and
phosphoglycerate kinase which may be immobilized on the artificial membrane I 03 of cell 202a. In addition, the catalyst cobaxime may be bound to the membrane I 03 to form a cobaxime coated membrane 706a”).
In the Remarks, Applicant argued that (page 12, 2nd para through page 13, last para):
“Tahereh does not teach a method of recording and reading a binary code comprising synthesizing the coded peptide sequence for storing the binary code and storing the coded peptide by immobilizing the at least one coded polypeptide on at least one position in a microarray.”
“Gordon et al. teach labeling target molecules or associated target molecule tags with origin-specific nucleic acid barcodes in the Cas9-expressing eukaryotic cell or eukaryote. Gordon et al. do not teach a method of recording and reading a binary code comprising synthesizing the coded peptide sequence for storing the binary code and storing the coded peptide by immobilizing the at least one coded polypeptide on at least one position in a microarray.”
“Smirnov does not suggest to one skilled in the art the step of synthesizing the coded peptide sequence for storing the binary code once the provided binary code is recorded according to the recording key. Although Tahereh teaches MALDI-TOF as the amino acid sequencing method, such teaching does not suggest to one skilled in the art the step of synthesizing the coded peptide sequence for storing the binary code and sequencing such coded peptide sequence.”
To response, Applicant’s arguments are not persuasive. As discussed above, combination of Smirnov, Tahereh and Gordon teach everything recited in claim 1.
Smirnov discloses a method of recording and reading a binary code (the information encoded by the described method is recorded in binary form and decoded; abstract; page 16, 2nd paragraph) comprising: providing a binary code (combining the binary code; page 7, 5th paragraph); creating a recording key by assigning at least two amino acids a binary code identity (a linear matrix representation of a matrix formed from 64 triplets used for coding for DNA, RNA and amino acids with binary indexing information corresponding to each matrix element; page 5, 11th paragraph; Figure 1); recording the binary code into at least one coded polypeptide by adding the at least two amino acids in sequence to form a coded peptide sequence according to the recording key (the information to be coded is lined up as a sequence of nitrogenous bases to be coded on the protein level; claim 10), wherein the coded peptide sequence corresponds to the binary code (the binary indices of the molecular genetic system correspond to the selected characteristic of nitrogenous bases for amino acids; claim 19); and reading the coded peptide sequence into the binary code by identifying the at least two amino acids according to their binary code identity (sequencing technologies and special software can be used to translate the genetic code back into a binary; page 16, 2nd paragraph).
Smirnov does not disclose synthesizing a peptide, storing the peptide on an immobilized membrane, or determining the coded peptide sequence by mass spectroscopy.
Tahereh disclose synthesizing a peptide (page 27, par. [0098]) (“ In an example, the cognitive cell 202a is synthesized in a configuration that produces a recombinant protein (e.g., spider silk, Insulin, albumin, collagen or each of the enzymes for the desired synthetic pathways such as different units of a solar cell, Glucose- ATP battery, etc.). Gene constructs of each recombinant protein/ polymer are designed using the known DNA sequence relevant to each gene construct”).
Tahereh disclose storing the peptide on an immobilized membrane (page 24, par. [0088]) (“The enzyme cluster 706a may include Ribulose-1,5 bisphosphate,
carboxylase/oxygenase, phosphoglycerate kinase and glyceraldehyde-3-
phosphatedehydrogenase, hexoisomerase, Aldolase, fructose 1,6 bisphosphatase, and
phosphoglycerate kinase which may be immobilized on the artificial membrane I 03 of cell 202a. In addition, the catalyst cobaxime may be bound to the membrane I 03 to form a cobaxime coated membrane 706a”).
Tahereh disclose determining the coded peptide sequence by mass spectroscopy (MALDI-TOF is used as the amino acid sequencing method; page 27, paragraph [0099]).
Smirnov in view of Tahereh, does not disclose further comprising: providing at least one labeled nucleotide recognizing the at least one nucleotide recognition sequence; and identifying a target peptide sequence in the coded peptide sequence by hybridizing the at least one labeled nucleotide to the at least one nucleotide recognition sequence.
Gordon does disclose further comprising: providing at least one labeled nucleotide recognizing the at least one nucleotide recognition sequence (the Cas9-expressing eukaryotic cell or eukaryote, can have labelled guide RNA delivered or administered thereto; paragraphs [0189], [0198]); and identifying a target peptide sequence in the coded peptide sequence by hybridizing the at least one labeled nucleotide to the at least one nucleotide recognition sequence (the Cas9-expressing eukaryotic cell or eukaryote, can have labelled guide RNA delivered or administered thereto (which would induce binding of the nucleotide recognition sequence to the guide RNA); paragraphs [0189], [0198]).
Hence the combination of Smirnov, Tahereh and Gordon teach a method of recording and reading a binary code that comprises the steps of providing at least one labeled nucleotide sequence to recognize and hybridize with at least one nucleotide recognition sequence of at least one target peptide sequence in the at least one coded polypeptide; and sequencing amino acids in the at least one target peptide sequence by mass spectroscopy to allow a readout of the coded peptide sequence, as recited in claim 1.
In the Remarks, Applicant argued on behalf of claims 6 (page 14, paras 1-6) and claims 7-8 (page 14, para 7 through page 15, penultimate para).
To response, claims 6-7 is cancelled by Applicant. Claim 8 is amended. The modified rejection to claim 8 in view of claim 8 amendment does not rely on Barbas anymore. The argument related to the Barbas reference is void.
In the Remarks, Applicant argued on behalf of claims 21, 18-19 and 20 consecutively (page 15, last para through page 17, last para) against “the deficiencies of the Smirnov, Tahereh and Gordon et al. references;” against “the deficiencies of the Tahereh references; ” against “the deficiencies of the Tahereh and Nordhoff et al. references.”
To response, the arguments are not supported by evidence. Applicant does not provide any evidence for the arguments. As discussed above, the combination of the Smirnov, Tahereh and Gordon et al. references; the Tahereh references; and the Tahereh and Nordhoff et al. references have no deficiency
Hence, the 103 rejections are maintained and are strengthened.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to GUOZHEN LIU whose telephone number is (571)272-0224. The examiner can normally be reached Monday-Friday 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Larry D Riggs can be reached at (571) 270-3062. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/GL/
Patent Examiner
Art Unit 1686
/Anna Skibinsky/
Primary Examiner, AU 1635