DETECTION OF BACTERIAL (MOLLICUTIES) CONTAMINATION

§101 §103

DETAILED ACTION Notice of Pre-AIA or AIA Status 1. The present application is being examined under the pre-AIA first to invent provisions. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the prior art rejection set forth below will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. Status of the Application 2. Applicant's response filed on July 13, 2026 has been entered. Claims 1-13 are pending. Claims 1-4 are under examination. Claims 5-13 remain withdrawn as being drawn to a non-elected invention. Response to Arguments 3. Applicant’s arguments filed on July 13, 2026 have been fully considered. Priority Applicant argues that, in view of the claim amendments, claims 1-4 should have an effective filing date of February 1, 2012 (Remarks, pages 5-6). This argument was persuasive. As discussed below in the modified “Priority” section, claims 1-4 have an effective filing date of February 1, 2012. Rejection of claim 3 under pre-AIA 35 U.S.C. 112(a) Applicant argues that the rejection should be withdrawn in view of the amendments to claim 3 (Remarks, pages 5-6). This argument was persuasive. The rejection has been withdrawn. Rejection of claims 1-4 under pre-AIA 35 U.S.C. 112(b) This rejection has been withdrawn in view of the amendments to claim 1. Accordingly, Applicant’s arguments on pages 7-9 of the Remarks have been considered, but they are moot since the rejection has been withdrawn in view of the amendments to claim 1. Rejection of claims 1-4 and 14 under 35 U.S.C. 101 Applicant argues on pages 10-13 of the Remarks that the rejection should be withdrawn for the following reasons: I. Claimed kit possesses markedly different characteristics from any naturally occurring counterpart (Remarks, pages 10-11); II. The Office’s findings regarding the concentration limitation in claim 1 are internally inconsistent (Remarks, page 12); and III. The Office’s rejection under pre-AIA 35 U.S.C. 103(a) is evidence that the claimed combination is not well-understood, routine, and conventional (Remarks, pages 12-13). Response: These arguments have been fully considered, but they were not persuasive for the following reasons. Argument I: This argument was not persuasive for the following reasons. First, the rejection does consider the claimed combination as a whole and concludes that the kit components perform the same function in the kit that they (or their naturally occurring counterparts) perform in nature. Applicant’s argument that the CHO cell DNA in the kit reduces nonspecific amplification is acknowledged, but it is not sufficient to cause the claims to be directed to eligible subject matter because the claims do not require a composition formed from the kit components or even a composition containing the claimed primers and CHO cell DNA. Instead, the claims encompass a kit with each component in a separate container. Argument II: This argument is moot in view of the amendments to claim 1, which address the indefiniteness issue discussed in the last Office action. It is noted, though, that it is not improper to note an indefiniteness issue and also perform an obviousness analysis based on a reasonable interpretation of the claim. This is, in fact, required for compact prosecution (MPEP 2173.06). Argument III: This argument was not persuasive because the rejection is not, in fact, based on a finding that providing the claimed components in a kit is well-understood, routine, and conventional. This finding would be required if the claimed kit contained elements in addition to the judicial exceptions (MPEP 2106.05(d)), but as discussed in the rejection, it does not. Therefore, there are no additional elements that could be assessed as well-understood, routine, and conventional. Since Applicant’s arguments were not persuasive, the rejection has been maintained with modifications to address the amendments to claims 1 and 3. Rejection of claims 1-4 under pre-AIA 35 U.S.C. 103(a) as being unpatentable over MycoTool in view of Kim and further in view of Arieli The rejection has been modified to address Applicant’s amendments to claims 1 and 3. Applicant argues on pages 13-18 of the Remarks that the rejection should be withdrawn for the following reasons: Kim does not teach the use of Eukaryotic or CHO cell DNA (Remarks, page 14); Arieli teaches a synthetic control template, not total genomic DNA (Remarks, page 15); The prior art does not teach adding CHO cell DNA to a detection reaction to reduce nonspecific amplification and Ex parte Obiaya does not apply (Remarks, pages 15-16); The evidence of unexpected results is commensurate in scope (Remarks, pages 16-17); The species-specific effect constitutes unexpected results (Remarks, page 17); and The rejection is the result of impermissible hindsight (Remarks, page 17). Response: These arguments have been fully considered, but they were not persuasive for the following reasons. Argument I: This argument was not persuasive because the rejection does not allege that Kim teaches CHO cell DNA. Instead, the rejection uses the teachings of Kim concerning a total genomic DNA control, the teachings in the MycoTool reference, and the ordinary inferences and reasoning possessed by the ordinary artisan to arrive at the conclusion that it would have been obvious to include either GAPDH DNA as taught in the MycoTool reference or total DNA from CHO cells in the MycoTool kit. Argument II: This argument was unpersuasive because Arieli is not relied upon to teach CHO cell DNA or even total genomic DNA. The reference is only relied upon to motivate inclusion of a labeled oligonucleotide probe and/or an intercalating dye in the MycoTool kit as well as a thermostable DNA polymerase. Argument III: This argument was unpersuasive for the following reasons. First, the claims do not require a mixture or composition containing a thermostable DNA polymerase, the claimed primers, and a large amount of CHO cell DNA. Instead, the claims encompass providing these components separately in a kit format. Second, citing Ex parte Obiaya is not improper. Since the claims do not require forming a mixture containing all of the kit components, it is reasonable to note that another reason exists for providing the aforementioned elements in a kit format. Third, one could conceivably provide a large amount of DNA to be used as a positive control in a kit provided that the other components were also provided in large amounts. There is currently not requirement in the claims for a large amount of CHO cell DNA compared to the other kit components. Argument IV: This argument was unpersuasive because the results shown in the specification are not, in fact, commensurate in scope with the claimed invention. The results alleged to be unexpected were observed with a composition containing a thermostable DNA polymerase, CHO cell DNA, and primers consisting of SEQ ID NOs: 1 and 2 (i.e., without the 1-3 variations encompassed by the claims). The instant claims, though, are much broader since there is no requirement to form such a composition. Instead, each of the kit components may be provided in a separate container. As well, it is not clear that the same results would be observed with the variant primers encompassed by the claims. Argument V: As with Argument IV, this argument was unpersuasive because the claims do not require forming a composition containing the claimed primers, a thermostable DNA polymerase, and CHO cell DNA, and instead encompass providing each component of the claimed kits in a separate container in the kit. Argument VI: In response to Applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). In this case, the rejection does not improperly rely on Applicant’s disclosure, and instead, provides another reason for arriving at the claimed kits. And, as discussed above, the claims do not require forming a mixture or composition containing CHO cell DNA, the claimed primers, and a thermostable DNA polymerase. Instead, they encompass merely providing these components as separate reagents in a kit format. Since Applicant’s arguments were not persuasive, the rejection has been maintained with modifications to address the amendments to claims 1 and 3. Priority 4. Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 120, 121, or 365(c) as follows: The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994). In this case, the disclosure of PCT/EP2010/004655 fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. More specifically, the ‘655 application fails to provide support for a kit containing a thermostable DNA polymerase as recited in independent claim 1 of the instant application. Compositions disclosed in the ‘655 application may include such a polymerase (see, e.g., claim 11), but there is nothing to indicate that including a polymerase, thermostable or otherwise, in the kit was contemplated. The ‘655 application also fails to provide support for including primers in the kit that contain up to three variations relative to the primers set forth in SEQ ID NOs: 1 and 2. This is also recited in claim 1 of the instant application. The ‘655 application states that the kit may include “a first primer according to SEQ ID NO: 1 and a second primer according to SEQ ID NO: 2” (see, e.g., page 5, lines 15-19; see also claim 13). As noted above, though, independent claim 1 encompasses variant primers, though, and there is nothing in the ‘655 application to indicate that these variant primers were contemplated. Thus, the ‘655 application fails to provide support for the subject matter of the instant claim 1. It is also noted that the ‘655 application fails to provide support for the subject matter of the instant claim 3, which depends from the instant claim 1. This claim requires the kit to further include “a detection reagent selected from the group consisting of an intercalating dye and an oligonucleotide probe.” First, there is no disclosure of an oligonucleotide probe in the ‘655 application, let alone including an oligonucleotide probe in the disclosed kit. Second, the ‘655 application only discloses an intercalating dye in the context of a composition (see, e.g., claim 12) and contains nothing to indicate that including an intercalating dye in the kit was contemplated. Accordingly, claim 3 lacks support in the ‘655 application for an additional reason. Accordingly, the instant claims 1-4 have an effective filing date of February 1, 2012, which is the filing date of prior-filed Application Serial No. 13/364,050. Claim Rejections - 35 USC § 101 5. 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-4 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception—specifically, a product of nature—without significantly more. Claim 1 Claim 1 is drawn to a kit comprising a thermostable DNA polymerase. The kit also comprises the following components: (i) purified DNA that has been obtained from Chinese hamster ovary (CHO) cells and is free of prokaryotic DNA, (ii) a first synthetic primer consisting of a nucleotide sequence with no more than three variations from the sequence of SEQ ID NO: 1, and (iii) a second synthetic primer consisting of a nucleotide sequence with no more than three variations from the sequence of SEQ ID NO: 2. Each of the components present in the kit of claim 1 is judicial exception (product of nature) for the following reasons. First, thermostable DNA polymerases (e.g., Taq DNA polymerase or Pfu DNA polymerase) are found in nature, and there is nothing in the claim that requires the thermostable DNA polymerase in the kit to possess any structural or functional differences relative to the naturally occurring proteins. In other words, the thermostable DNA polymerase recited in the kit of claim 1 has no structural or functional differences relative to its naturally occurring counterparts. Thus, this component of the kit encompasses naturally occurring products. Second, as to the CHO cell DNA, CHO cells are naturally occurring cells, and there is nothing in the claim that requires the purified DNA to differ in any way, structurally or functionally, from naturally occurring CHO cell DNA. Thus, this component in the kit also encompasses naturally occurring products. Third, as to the primers, it is not clear that these oligonucleotides are found in nature, but these nucleic acids are, nevertheless, a judicial exception because they are derived from naturally occurring nucleic acids and possess no structural or functional differences relative to their naturally occurring counterpart. For example, the naturally occurring nucleic acids disclosed in GenBank Accession Numbers MW725075 and LR605549, the relevant portions of which are shown below, contain a stretch that includes the instant SEQ ID NO: 1 or SEQ ID NO: 2. The nucleic acids recited in claim 1 are also not required to include a label (e.g., a radioisotope) or a non-naturally occurring nucleotide(s), nor do they have any functions not possessed by naturally occurring nucleic acids. As well, MPEP 2106.04(b)(I) identifies isolated nucleic acids having no structural or functional differences from naturally occurring nucleic acids as an example of a patent-ineligible natural product. Further, as discussed in MPEP 2106.04(b)(II), “[P]roduct of nature exceptions include both naturally occurring products and non-naturally occurring products that lack markedly different characteristics from any naturally occurring counterpart.” See Ambry Genetics, 774 F.3d at 760, 113 USPQ2d at 1244. In this case, the nucleic acids recited in claim 1 need not possess any structural differences relative to their naturally occurring counterpart, which is the single-stranded nucleic acid segment of the same sequence found in the naturally occurring nucleic acid.1 The claimed nucleic acids also have no functional differences relative to their naturally occurring counterpart since both molecules hybridize to complementary nucleic acids. Thus, claim 1 clearly recites a plurality of judicial exceptions since each element in the kit encompasses, or is not materially different from, a naturally occurring product. The judicial exceptions are not integrated into a practical application because providing them in a kit is nothing more than token extra-solution activity and an attempt to link the judicial exception to a particular technological environment. Claim 1 also does not include additional elements that are sufficient to amount to significantly more than the judicial exception because the kit need not have any components other than the recited nucleic acids and polymerase. Lastly, the requirements in the last clause of claim 1, which state that the “purified DNA from CHO cells reduces unspecific amplification” and that the purified DNA from CHO cells is to be added to a sample do not render the claim patent eligible for the following reasons. First, the CHO cell DNA in the kit performs the same function that it does in nature (i.e., hybridization to complementary nucleic acids). Second, it is acknowledged that the specification teaches that adding particular amounts of purified total DNA from CHO cells to a sample decreases undesirable nonspecific amplification, whereas calf thymus DNA did not show the same effect (see, e.g., Examples 6, 9, and 10 on pages 26-28 and 31-34 of the originally filed specification). These examples indicate that CHO cell DNA may function in a manner in addition to its naturally occurring function of binding to complementary nucleic acids, but this is not entirely clear from the examples. That is, it is not clear that CHO cell DNA is simply more homologous to the nucleic acids found in the samples used than calf thymus DNA. If this is the case, then the CHO cell DNA would simply be performing its naturally occurring function. As well, claim 1 does not require the kit to contain a mixture containing a large amount of CHO cell DNA, primers, and a DNA polymerase. Instead, claim 1 only recites an amount of CHO cell DNA that is defined relative to an object that is variable (i.e., the sample volume), and the CHO cell DNA need not be provided in a composition together with the primers and other reaction components. Thus, amended claim 1 is directed to a judicial exception without significantly more, and it is rejected under 35 U.S.C. 101. Claims 2-4 Each of claims 2-4 depends from claim 1. Claims 2-4 further require the kit to contain the following components: (i) a lysis reagent (claim 2); (ii) a detection reagent selected from an intercalating dye and an oligonucleotide probe (claim 3); and (iii) total DNA purified from CHO cells (claim 4). The additional elements recited in claims 2-4 are also judicial exceptions. As to claim 2, the term “lysis reagent” includes naturally occurring substances (e.g., water, sodium hydroxide, and proteases). There is nothing in the claim that requires the lysis reagent to have any structural or functional properties that differ from the naturally occurring counterparts. Thus, this claim encompasses naturally occurring products. As to claim 3, the oligonucleotide probe is not markedly different from a naturally occurring product for the same reasons set forth above with respect to the two primers in the kit of claim 1. As well, naturally occurring intercalating dyes exist. See, for example, Li et al. (Biomacromolecules 2012; 13: 873-880; cited previously), where berberine—a naturally occurring intercalator with fluorescent properties—is discussed. Thus, claim 3 also encompasses naturally occurring products. As to claim 4, the purified total DNA from CHO cells is not required to have any structural or functional differences compared to the naturally occurring CHO cell DNA. Accordingly, it is not markedly different from naturally occurring CHO cell DNA for the reasons set forth above with respect to the CHO cell DNA in claim 1. In view of the foregoing, claims 2-4 also recite a plurality of judicial exceptions since each additional element required by these claims encompasses, or is not materially different from, a naturally occurring product. These additional judicial exceptions are not integrated into a practical application because providing them in a kit is nothing more than token extra-solution activity and an attempt to link the judicial exception to a particular technological environment. Claims 2-4 also do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the kit need not have any components other than the recited additional components. Thus, claims 2-4 are also directed to a judicial exception without significantly more, and they are also rejected under 35 U.S.C. 101. ALIGNMENTS BETWEEN SEQ ID NOs: 1 & 2 AND NATURALLY OCCURRING NUCLEIC ACIDS SEQ ID NO: 1 MW725075 LOCUS MW725075 194 bp DNA linear ENV 15-MAR-2021 DEFINITION Mycoplasmopsis bovis isolate LBV_50 16S ribosomal RNA gene, partial sequence. ACCESSION MW725075 VERSION MW725075.1 KEYWORDS ENV. SOURCE Mycoplasmopsis bovis (Mycoplasma bovis) ORGANISM Mycoplasmopsis bovis Bacteria; Tenericutes; Mollicutes; Mycoplasmataceae; Mycoplasmopsis. REFERENCE 1 (bases 1 to 194) AUTHORS De Carli,S., Dias,M.E., Silva,M.E., Brayer,G.M. and Siqueira,F.M. TITLE Molecular detection of the agents responsible for poor reproductive performance in bulls JOURNAL Unpublished REFERENCE 2 (bases 1 to 194) AUTHORS De Carli,S., Dias,M.E., Silva,M.E., Brayer,G.M. and Siqueira,F.M. TITLE Direct Submission JOURNAL Submitted (10-MAR-2021) Laboratorio de Bacteriologia Veterinaria, Universidade Federal do Rio Grande do Sul, Av. Bento Goncalves 9090, Porto Alegre, RS 91540000, Brazil COMMENT ##Assembly-Data-START## Sequencing Technology :: Sanger dideoxy sequencing ##Assembly-Data-END## FEATURES Location/Qualifiers source 1..194 /organism="Mycoplasmopsis bovis" /mol_type="genomic DNA" /isolate="LBV_50" /isolation_source="Prepuce" /host="Bull" /db_xref="taxon:28903" /environmental_sample /note="amplified with species-specific primers" rRNA <1..>194 /product="16S ribosomal RNA Query Match 100.0%; Score 21; Length 194; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; SEQ ID NO: 1 1 GGCGAATGGGTGAGTAACACG 21 ||||||||||||||||||||| Db 77 GGCGAATGGGTGAGTAACACG 97 SEQ ID NO: 2 LR605549 LOCUS LR605549 288 bp DNA linear ENV 25-JAN-2021 DEFINITION uncultured Mycoplasma sp. partial 16S rRNA gene. ACCESSION LR605549 VERSION LR605549.1 DBLINK BioProject: PRJEB23299 KEYWORDS ENV. SOURCE uncultured Mycoplasma sp. ORGANISM uncultured Mycoplasma sp. Bacteria; Tenericutes; Mollicutes; Mycoplasmataceae; Mycoplasma; environmental samples. REFERENCE 1 AUTHORS Yao,H. TITLE Direct Submission JOURNAL Submitted (28-JUN-2019) INSTITUTE OF MICROBIOLOGY CHINESE ACADEMY OF SCIEN, No.3, 1st Beichen West Road, Chaoyang District, Beijing, China FEATURES Location/Qualifiers source 1..288 /organism="uncultured Mycoplasma sp." /mol_type="genomic DNA" /isolation_source="Mangrove leaves" /db_xref="taxon:167967" /environmental_sample gene <1..>288 /gene="16S rRNA" rRNA <1..>288 /gene="16S rRNA" /product="16S ribosomal RNA Query Match 100.0%; Score 22; Length 288; Best Local Similarity 100.0%; Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0; SEQ ID NO: 2 1 CGGATAACGCTTGCGACCTATG 22 |||||||||||||||||||||| Db 246 CGGATAACGCTTGCGACCTATG 267 Claim Rejections - 35 USC § 103 6. The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action: (a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negatived by the manner in which the invention was made. 7. Claims 1-4 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over the MycoTOOL PCR Mycoplasma Detection Kit from ROCHE (Cat. No. 05 200 709 001; published March 2008 and hereafter “MycoTool”) in view of Kim et al. (Journal of Dairy Science 2001; 84: 74-83) and further in view of Arieli et al. (US 2010/0196904 A1). The claims are drawn to a kit for detecting Mollicute nucleic acid in one of the following sample types: (i) amniotic fluid of embryonated cells, (ii) a eukaryotic cell culture supernatant, and (iii) a eukaryotic cell culture suspension. The kit comprises a thermostable DNA polymerase, nucleic acid primers, and purified DNA obtained from CHO cells. Regarding claims 1, 2, and 4, MycoTool discloses a kit for detecting the presence of a specific type of Mollicute contaminant—specifically, mycoplasmas—in mammalian cell cultures (page 1, “What this Product Does” and “Application” sections). The kit includes the following components: (i) a primer mix for mycoplasma (page 1, vial 3 in subkit 2); (ii) a lysis reagent (page 1, proteinase K and lysis buffer in subkit 1); (iii) detection dye (page 1, subkit 2); and (v) a positive control, which is GAPDH (page 1, subkit 2 and the “Application” section). Further regarding claim 1, as evidenced by the specification of the instant application at page 20, para. [0080], the mycoplasma-specific primers in the MycoTool kit are identical to the instant SEQ ID NOs: 1 and 2). The MycoTool kit does not include all of the required elements. First, as to claim 1, the reference does not clearly teach including a thermostable DNA polymerase in the kit. This may be the case since the MycoTool protocol does not include a separate polymerase addition step, nor is a polymerase included in the “Additional Equipment and Reagents Required” list on page 2, but it is not entirely clear that the required polymerase is, in fact, included in the kit. Second, also as to claim 1, MycoTool does not clearly teach that the positive control DNA is obtained from CHO cells and lacks prokaryotic DNA. As a result, MycoTool also fails to meet the requirement in claim 1 for the kit to contain purified DNA that has been obtained from CHO cells and is free of prokaryotic DNA. Third, as to claim 3, MycoTool does not teach detection using a detection reagent selected from an intercalating dye and an oligonucleotide probe. The reference only teaches detection using a dye, and it is not clear that this dye is an intercalating dye. Fourth, as to claim 4, MycoTool does not teach that the positive control DNA is total DNA from CHO cells. The teachings of Kim and Arieli, though, remedy these deficiencies in the MycoTool reference. In particular, Kim describes the use of PCR to detect a target nucleic acid from S. aureus in bovine milk (abstract and page 75, col. 1). The PCRs of Kim use either Taq DNA polymerase or Tth polymerase, each of which is a thermostable DNA polymerase (p. 76, col. 2). As well, the PCRs of Kim use total DNA isolated from cells as a positive control (Fig. 1). Arieli describes nucleic acid amplification compositions that may include primer pairs and a nucleic acid template, which may be a positive control nucleic acid (see, e.g., paras. 28 and 91-93 as well as Example 3 at paras. 146-148 and 151-152). Arieli teaches that such compositions may be provided in a kit (para. 28). Further regarding amended claim 3, Arieli also teaches that detection probes may be provided in a kit together with oligonucleotide primers, a DNA polymerase, dNTPs, a buffer solution, and magnesium chloride (para. 29). Arieli additionally teaches that a kit may contain an intercalating dye (para. 153). Lastly, Arieli teaches that fluorescently labeled probes and intercalating dyes (e.g., SYBR™ Green) advantageously allow one to perform quantitative PCR (see, e.g., paras. 5, 29, 74, and 83-85). It would have been prima facie obvious for one of ordinary skill in the art at the time of the invention to include a thermostable DNA polymerase (e.g., Taq or Tth as disclosed in Kim) in the MycoTool kit. As discussed above, it is not entirely clear that the MycoTool kit contains a thermostable DNA polymerase, but if it does not, including one in the kit would have been obvious since the ordinary artisan would have recognized that the PCRs to be conducted with this kit would be most effectively and efficiently conducted using such a polymerase. The ordinary artisan would have had a reasonable expectation of success since suitable polymerases were known in the art as evidenced by Kim. It also would have been prima facie obvious to further include an intercalating dye in the MycoTool kit and/or to substitute the detection dye taught in MycoTool and Kim with a fluorescently labeled oligonucleotide probe as taught in Arieli such that the resulting kit contains an intercalating dye and/or a fluorescently labeled oligonucleotide probe. The ordinary artisan would have been motivated to do so to obtain the ability to use the kit for quantitative PCR as taught in Arieli and would have had a reasonable expectation of success in view of the guidance throughout Arieli concerning providing fluorescently labeled oligonucleotide probes and an intercalating dye in a kit together with other PCR reagents. It also would have been prima facie obvious to include total DNA purified from CHO cells and lacking prokaryotic DNA in the MycoTool kit. As discussed above, the MycoTool kit contains positive control DNA, and the protocol indicates that the positive control primers target the GAPDH gene from CHO cells (page 1). It is not clear that the positive control DNA is obtained from CHO cells and is free of prokaryotic DNA, but this would have been obvious since Kim teaches that a useful positive control may be total DNA isolated from cells expected to contain the positive control nucleic acid (see, e.g., Fig. 1). In this case, the ordinary artisan would have recognized from the teachings of Kim that the positive control DNA in the MycoTool kit could either be a synthetic form of the target GAPDH nucleic acid or total DNA isolated from CHO cells, and, accordingly, would have been motivated to select either alternative with a reasonable expectation of success. The ordinary artisan also would have recognized that for DNA isolated from CHO cells to be useful as a positive control, it must be free of prokaryotic nucleic acids that may falsely amplify with the mycoplasma-specific primers in the kit. Accordingly, the inclusion of total DNA purified from CHO cells and free of prokaryotic DNA in the MycoTool kit would have been prima facie obvious. Lastly, further regarding the requirement in the last clause of amended claim 1 concerning the amount of purified CHO cell DNA provided in the kit, as discussed in MPEP 2144.05 II, determining optimal amounts of reagents is prima facie obvious in the absence of unexpected results or secondary considerations. In this case, no persuasive evidence of unexpected results with respect to the claimed amounts of purified CHO cell DNA have been presented. Thus, the kits of claims 1-4 are prima facie obvious in view of the combined teachings of the cited references. Conclusion 8. No claims are currently allowable. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Angela Bertagna whose telephone number is (571)272-8291. The examiner can normally be reached 8-5, M-F. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached on 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ANGELA M. BERTAGNA/Primary Examiner, Art Unit 1637 1 MPEP 2106.04(c)(II)(A) discusses how to select an appropriate counterpart when a claimed nucleic acid is derived from a naturally occurring nucleic acid and states that the appropriate counterpart for a short nucleic acid derived from a naturally occurring nucleic acid (e.g., a primer) is the single-stranded region in the naturally occurring nucleic acid that is identical to the claimed nucleic acid.