Prosecution Insights
Last updated: April 19, 2026
Application No. 17/389,599

MODULATION OF HEPATITIS B VIRUS (HBV) EXPRESSION

Final Rejection §103§DP
Filed
Jul 30, 2021
Examiner
ARIETI, RUTH SOPHIA
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Ionis Pharmaceuticals Inc.
OA Round
2 (Final)
46%
Grant Probability
Moderate
3-4
OA Rounds
2y 7m
To Grant
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allow Rate
37 granted / 81 resolved
-14.3% vs TC avg
Strong +73% interview lift
Without
With
+72.7%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
37 currently pending
Career history
118
Total Applications
across all art units

Statute-Specific Performance

§101
5.1%
-34.9% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
12.3%
-27.7% vs TC avg
§112
29.2%
-10.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 81 resolved cases

Office Action

§103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application is being examined under the pre-AIA first to invent provisions. Claims 45, 73-83, and 85-88 are pending. Status of the Application Applicant’s response and amendment filed 30 October 2025 are acknowledged and entered. Applicant has amended Claims 45, 73, 83, and 85. Applicant has cancelled Claim 84. Response to Amendment Applicant has amended the Spec. to overcome Objections; the objections are withdrawn. Applicant has amended Claims 45 and 73 to overcome Objections; the objections are withdrawn. The 103 rejection is maintained. The NSDP rejection over US752 is withdrawn in view of the terminal disclaimer approved on 05 November 2025. The NSDP rejection over App163 is withdrawn because the copending App163 claims filed 04 August 2025 no longer overlap with the instant claims. The other NSDP rejections are maintained. Claims 45, 73-83, and 85-88 are examined. Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed. Rejections not reiterated here are withdrawn. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of pre-AIA 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action: (a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under pre-AIA 35 U.S.C. 103(a) are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims under pre-AIA 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of pre-AIA 35 U.S.C. 103(c) and potential pre-AIA 35 U.S.C. 102(e), (f) or (g) prior art under pre-AIA 35 U.S.C. 103(a). Claims 45, 73-79, 81-83, and 85-88 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over US Patent No. 5728518 (issued 17 March 1998, “US518”, of record) and US Patent No. 7511131 (issued 31 March 2009, “US131”, of record). This rejection is maintained and updated in response to the claim amendments. US518 teaches (§Abstract) oligont that inhibit HBV replication and which can be used to treat viral infection in a subject. US518 discloses (p. 12 SEQ Listing) SEQ ID NO 1 which is a 25-mer that comprises a region of 100% identity to claimed SEQ ID NO 226, as shown by the following alignment: US-08-287-337A-1 (NOTE: this sequence has 1 duplicate in the database searched) Sequence 1, US/08287337A Patent No. 5728518 GENERAL INFORMATION APPLICANT: Ellen Carmichael TITLE OF INVENTION: ANTIVIRAL OLIGONUCLOETIDE CURRENT APPLICATION NUMBER: US/08/287,337A NUMBER OF SEQ ID NOS: 9 SEQ ID NO 1 LENGTH: 25 TYPE: DNA Query Match 100.0%; Score 20; Length 25; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCAGAGGTGAAGCGAAGTGC 20 |||||||||||||||||||| Db 1 GCAGAGGTGAAGCGAAGTGC 20 Regarding Claim 45, US518 teaches (Figs. 1, 3; Col 3 L25-42) the oligont comprising SEQ ID NO 1 inhibits HBV replication. US518 teaches (Col 8 L25-50) the oligont can be used to treat HBV infection in a person and administering the oligont within a pharmaceutically acceptable carrier. US518 teaches (Col 6 L1-30) oligont that are administered to a body are subject to degradation by nucleases but that chemical modifications can provide nuclease resistance and increase oligont stability. US518 teaches (Col 5 L15-35) the oligont can be from about 20 to about 25 bases long. US518 does not teach the exact sequence instantly claimed, or all of the instantly claimed modifications or modification patterns. However, US131, drawn to antisense compounds for modulating expression of a different target, teaches the limitations that US518 does not teach. US131 is directed to antisense compounds for modulating expression of apolipoprotein B including for (Col 9 L19-40) treating hepatitis. An artisan would therefore understand that any of the design features disclosed in US131 could be applied to any oligont for treating hepatitis. Regarding Claims 73-79, 83, and 86, US131 teaches (Col 59-60) 20 nt gapmers that consist of a central 10 deoxynucleotide gap flanked on either side by 5 nt wings comprising 2’-methoxyethyl (2’-MOE) nt. US131 teaches (same §) all linkages within the 5-10-5 gapmer are PS linkages and all cytidines are 5-methycytidines. US131 teaches (Col 16-17 L50-40) modified sugar moieties are types of modifications that improve an oligonucleotide’s pharmacokinetic and pharmacodynamic properties. Regarding Claims 45 and 86-88, US131 teaches (Col 6 L9-11) compositions comprising the oligont and a pharmaceutically acceptable carrier or diluent. Regarding Claims 81-83, 85, and 87-88, US131 teaches (Col 15 L49-50) their invention includes the oligont in salt form, (Col 23 L14-44) formulations for oral administration include sodium salt, and (Col 548 points 13-14) the modified antisense oligont can be in sodium salt form. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligont for treating HBV comprising US518’s SEQ ID NO 1 with the 5-10-5 gapmer motif and other teachings of US131 for the benefit of improving pharmacokinetic and pharmacodynamic properties when treating a subject with the oligont. One would have been motivated to do so with a reasonable expectation of success because US131 teaches (Col 16-17 L50-40) modified sugar moieties are types of modifications that improve the pharmacokinetic and pharmacodynamic properties of an oligonucleotide. One would have been motivated to do so because US518 teaches their oligont are effective at inhibiting HBV replication and teaches modifying an oligont to include synthetic oligont for the benefit of increasing nuclease resistance in vivo, so an artisan wanting to administer the oligont to a subject would have known to make those modifications. Furthermore, an artisan would have been motivated to shorten the oligont sequence of US518 so that they could apply the exact modification motif of US131 and because a shorter antisense oligont is a cheaper oligont (which is relevant when mass-producing a treatment for use in subjects). The easiest way to shorten would have been to remove 5 nt from either end; as discussed above, US518 allows for 20-mer oligos. Doing so would have produced the exact gapmer that is instantly claimed, including the exact sequence of SEQ ID NO 226 and the 5-10-5 gapmer motif. Therefore modifying the oligont for treating HBV comprising US518 SEQ ID NO 1 of US518 with the 5-10-5 gapmer motif and other teachings of US131 would have produced the limitations of Claims 45, 73-79, 81-83, and 85-88. Claims 45, 73-83, and 85-88 are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over US518 and US131 as applied to Claims 45, 73-79, 81-83, and 85-88 above, and further in view of US Patent Application Publication No US 2009/0318536 (24 December 2009, “App536”, of record). This rejection is maintained and updated in response to the claim amendments. The teachings of US518 and US131 as applied to Claims 45, 73-79, and 81-88 have been described above. US518 and US131 teach a 20-mer gapmer for treating HBV, wherein the gapmer comprises a 5-10-5 motif applied to a sequence consisting of the nucleobase sequence of SEQ ID NO 226, wherein each 5-mer wing comprises 2’-MOE sugars flanking a 10-mer gap, wherein all nt are linked by PS linkages. US518 and US131 do not teach the sugars are bicyclic sugars that can comprise a 4'-CH2-O-2' bridge or a 4'-CH(CH3)-O-2' (cEt) bridge (i.e., Claim 80). However, App536, drawn to antisense compounds for decreasing LDL, teaches (¶20) 5-10-5 gapmers comprising 2’-MOE nt. App536 teaches (¶835-836) sugar modifications impart nuclease stability, binding affinity, or other beneficial biological properties. App536 teaches (same ¶s) such modified sugars can include bicyclic modified sugars (BNAs) can comprise the bridged nt 4'-(CH2)n-O-2' and 4'-CH(CH3)-O-2'. Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the gapmer of US518 and US131 with the bicyclic sugar moieties (i.e., 4'-[CH2]n-O-2' and 4'-CH[CH3]-O-2') of App536 for the benefit of imparting nuclease stability and binding affinity. One would have been motivated to do so with a reasonable expectation of success because US518 (Col 6 L1-30), US131 (Col 16-17 L50-40), and App536 (¶835-836) all suggest modifying the oligont to improve its properties. One would have been motivated to do so because all of the modifications were modifications known in the art to provide benefits, and applying any of them would have been an obvious design choice well within the scope of what was common in the art at time of filing. Modifying the gapmer of US518 and US131 with the bicyclic 4'-(CH2)n-O-2' and 4'-CH(CH3)-O-2' sugar moieties of App536 would have produced all the limitations of Claim 80. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 45, 73-83, and 85-88 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-24 of U.S. Patent No. 9145558 (“US558”). This rejection is maintained and updated in response to the claim amendments. Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to a compound comprising a single-stranded modified 20-mer oligont that is a gapmer consisting of SEQ ID NO 226; wherein one or each linkage can be a PS linkage, wherein one or each cytosine can be a 5-methylcytosine, wherein each modified nt can comprise a 2-MOE or bicyclic sugar and wherein the bicyclic sugar can comprise bridges as recited in Claim 80; wherein each wing of the gapmer can be 5 nt and the gap can be 10 nt; to a salt or sodium salt of the oligont; and to a composition comprising the oligont and a pharmaceutically acceptable carrier or diluent. The patented US558 claims are directed to 20-mer compounds that comprise a conjugate and an oligont that is 100% complementary to nt 1583-1602 of SEQ ID NO 1, can comprise a 20-mer gapmer consisting of SEQ ID NO 3, that can comprise 2’-MOE or bicyclic nt; wherein one or each linkage can be a PS linkage, wherein one or each cytosine can be a 5-methylcytosine; and wherein the gapmer can be a 5-10-5 gapmer, can have various outcomes on target mRNA. US558 SEQ ID NO 3 is 100% complementary to nt 1583-1602 of SEQ ID NO 1 and is 100% identical to claimed SEQ ID NO 226, as shown by the following alignment: US-14-633-491-3 Filing date in PALM: 2015-02-27 Sequence 3, US/14633491 Patent No. 9145558 GENERAL INFORMATION APPLICANT: Isis Pharmaceuticals, Inc. TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR MODULATING HBV EXPRESSION FILE REFERENCE: BIOL0248US.C1 CURRENT APPLICATION NUMBER: US/14/633,491 CURRENT FILING DATE: 2015-02-27 PRIOR APPLICATION NUMBER: PCT/US2014/036463 PRIOR FILING DATE: 2014-05-01 PRIOR APPLICATION NUMBER: 61/818,442 PRIOR FILING DATE: 2013-05-01 PRIOR APPLICATION NUMBER: 61/823,826 PRIOR FILING DATE: 2013-05-15 PRIOR APPLICATION NUMBER: 61/843,887 PRIOR FILING DATE: 2013-07-08 PRIOR APPLICATION NUMBER: 61/871,673 PRIOR FILING DATE: 2013-08-29 PRIOR APPLICATION NUMBER: 61/880,790 PRIOR FILING DATE: 2013-09-20 PRIOR APPLICATION NUMBER: 61/976,991 PRIOR FILING DATE: 2014-04-08 PRIOR APPLICATION NUMBER: 61/986,867 PRIOR FILING DATE: 2014-04-30 NUMBER OF SEQ ID NOS: 53 SEQ ID NO 3 LENGTH: 20 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic oligonucleotide Query Match 100.0%; Score 20; Length 20; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCAGAGGTGAAGCGAAGTGC 20 |||||||||||||||||||| Db 1 GCAGAGGTGAAGCGAAGTGC 20 Both claim sets are directed to gapmer oligont that comprise or consist of the same nt sequence as claimed SEQ ID NO 226. Therefore the invention of the instant claims would have been obvious in view of the patented US558 claims. Claims 45, 73-83, and 85-88 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-17 and 23-27 of U.S. Patent No. 9932580 (“US580”) in view of United States Patent No 5728518 (“US518”) and US Patent No. 7511131 (“US131”). This rejection is maintained and updated in response to the claim amendments. Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to a compound comprising a single-stranded modified 20-mer oligont that is a gapmer consisting of SEQ ID NO 226; wherein one or each linkage can be a PS linkage, wherein one or each cytosine can be a 5-methylcytosine, wherein each modified nt can comprise a 2-MOE or bicyclic sugar and wherein the bicyclic sugar can comprise bridges as recited in Claim 80; wherein each wing of the gapmer can be 5 nt and the gap can be 10 nt; to a salt or sodium salt of the oligont; and to a composition comprising the oligont and a pharmaceutically acceptable carrier or diluent. The patented US580 claims are directed to 20-mer compounds that comprise a conjugate and an oligont that consists of SEQ ID NO 8, that can comprise 2’-MOE or bicyclic nt; wherein one or each linkage can be a PS linkage, wherein one or each cytosine can be a 5-methylcytosine; and wherein the gapmer can be a 5-10-5 gapmer, can have various outcomes on target mRNA. US580 SEQ ID NO 8 is 90% identical to claimed SEQ ID NO 226, as shown by the following alignment: US-14-822-493-8 Filing date in PALM: 2015-08-10 Sequence 8, US/14822493 Patent No. 9932580 GENERAL INFORMATION APPLICANT: Isis Pharmaceuticals, Inc. TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR MODULATING HBV EXPRESSION FILE REFERENCE: BIOL0248US.C2 CURRENT APPLICATION NUMBER: US/14/822,493 CURRENT FILING DATE: 2015-08-10 PRIOR APPLICATION NUMBER: 14/633,491 PRIOR FILING DATE: 2015-02-27 PRIOR APPLICATION NUMBER: PCT/US2014/036463 PRIOR FILING DATE: 2014-05-01 PRIOR APPLICATION NUMBER: 61/818,442 PRIOR FILING DATE: 2013-05-01 PRIOR APPLICATION NUMBER: 61/823,826 PRIOR FILING DATE: 2013-05-15 PRIOR APPLICATION NUMBER: 61/843,887 PRIOR FILING DATE: 2013-07-08 PRIOR APPLICATION NUMBER: 61/871,673 PRIOR FILING DATE: 2013-08-29 PRIOR APPLICATION NUMBER: 61/880,790 PRIOR FILING DATE: 2013-09-20 PRIOR APPLICATION NUMBER: 61/976,991 PRIOR FILING DATE: 2014-04-08 PRIOR APPLICATION NUMBER: 61/986,867 PRIOR FILING DATE: 2014-04-30 NUMBER OF SEQ ID NOS: 53 SEQ ID NO 8 LENGTH: 20 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Synthetic oligonucleotide Qy 1 GCAGAGGTGAAGCGAAGT 18 |||||||||||||||||| Db 3 GCAGAGGTGAAGCGAAGT 20 Both claim sets are directed to gapmer oligont that target the same region of claimed SEQ ID NO 226. The US580 claims do not recite the exact sequence that is SEQ ID NO 226. However, US518, drawn to RNA interference reagents for treating HBV, teaches (§Abstract) oligont for inhibiting HBV replication that can be used in a subject. US518 teaches (p. 12 L25) SEQ ID NO 1, a 25-mer that (Col 2 L 34-40) binds to HBV DNA and (Figs. 1, 3) inhibits its replication. Their SEQ ID NO comprises 100% identity to claimed SEQ ID NO 226, as shown by the following alignment: US-08-287-337A-1 (NOTE: this sequence has 1 duplicate in the database searched) Sequence 1, US/08287337A Patent No. 5728518 GENERAL INFORMATION APPLICANT: Ellen Carmichael TITLE OF INVENTION: ANTIVIRAL OLIGONUCLOETIDE CURRENT APPLICATION NUMBER: US/08/287,337A NUMBER OF SEQ ID NOS: 9 SEQ ID NO 1 LENGTH: 25 TYPE: DNA Query Match 100.0%; Score 20; Length 25; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCAGAGGTGAAGCGAAGTGC 20 |||||||||||||||||||| Db 1 GCAGAGGTGAAGCGAAGTGC 20 Therefore it would have been obvious to modify the invention of the US580 claims with the nt sequence disclosed by US518 for the benefit of targeting another HBV sequence and optimizing anti-HBV effect. It would have been obvious to do so because US518’s SEQ ID NO 1 was shown to inhibit HBV replication, because using inhibiting HBV mRNA with 20-mer gapmers was known in the art and an artisan would have shortened US518’s SEQ ID NO 1 from 25- to 20-mer because shorter oligos would be cheaper to produce and because the US580 claims recite a 5-10-5 gapmer and modified sugars that target the same region as that instantly claimed. Doing so would have produced the invention of the instant claims which therefore would have been obvious in view of the patented US580 claims and US518. Response to Arguments Applicant's arguments filed 30 October 2025 have been fully considered but they are not persuasive. Arguments that are no longer relevant are not addressed. 103 Applicant argues (Remarks p. 7, full ¶1-2) that there is no prima facie case of obviousness because it has not been demonstrated that an artisan of ordinary skill would have selected US518’s SEQ ID NO 1 as a lead compound and subsequently that the artisan would have had a reason to modify that compound. That is not found persuasive because US518 discloses a limited number of compounds and SEQ ID NO 1 is the first compound in their claims. Contrary to Applicant’s assertion, that indicates that the inventors of US518 considered their SEQ ID NO 1 important. US518 even calls SEQ ID NO 1 (Col 2 L33-40) a preferred oligonucleotide and describes (Co. 4 L7-14) it is preferred because it hybridizes to at least a portion of the DRII region of HBV DNA. US518 discusses (Col 1-2 L60-7) the DRII region is critically involved in the reverse transcriptase process of integrating into the host DNA. An artisan would have wanted to target DRII for all of those reasons. Furthermore, data in US518 (Figs. 1 and 3) indicate that SEQ ID NO 1 was effective. US518 discloses only a limited number of compounds and an artisan would have selected any of those for further modification, including SEQ ID NO 1. As for reasons to modify the selected compound, those were provided in the rejection: US518 teaches (Col 6 L1-30) oligont that are administered to a body are subject to degradation by nucleases but that chemical modifications can provide nuclease resistance and increase oligont stability. US131 teaches (Col 16-17 L50-40) modified sugar moieties are types of modifications that improve an oligonucleotide’s pharmacokinetic and pharmacodynamic properties. An artisan would have been motivated to modify the oligont for treating HBV comprising US518’s SEQ ID NO 1 with the 5-10-5 gapmer motif and other teachings of US131 for the benefit of improving pharmacokinetic and pharmacodynamic properties when treating a subject with the oligont. Furthermore, an artisan would have reasonably expected that applying US131’s gapmer motif to any sequence already demonstrated effective would improve its pharmacokinetic properties and pharmacodynamic properties because US131 teaches modified sugars have that effect. An artisan would have understood that a nuclease resistant ASO can be administered at a lower does because there is no need to administer extra volume to compensate for ASO that is degraded by nucleases. In addition, US131 teaches (Col 54 L7-32) they used ASO concentrations within the range of 5-300 nM. For example US131 teaches (Col 86 L28-40) using 20-mer 5-10-5 gapmers at 50-150 nM doses. Since an artisan would have known (from US518) that sugar modifications increase nuclease resistance and improve pharmacokinetic and pharmacodynamic properties, they would have expected that any ASO bearing a gapmer motif would require a much lower dose vs. an unmodified version of that ASO. Regarding Applicant’s argument that US518 provides no reason to shorten their sequence, that is not persuasive because the rejection explains that as discussed above, US518 allows for 20-mer oligos. The rejection explains that an artisan would have shortened the ASO because a shorter antisense oligont is a cheaper oligont (which is relevant when mass-producing a treatment for use in subjects) and because the easiest way to shorten would have been to remove 5 nt from either end. Regarding Applicant’s argument that (p. 7 ¶3) US131 is for ASOs for inhibiting a different target and the gapmer design features it discloses could not be applied to any ASO, that is not persuasive because the prior art teaches sugar modifications improve pharmacokinetic and pharmacodynamic properties and a person of ordinary skill understands that sugar modifications improve those properties due to the structure of the modification, not the sequence of nucleotides to which they’re applied. Furthermore, Applicant presents no evidence that the design features of US131 cannot be widely applied to any ASO to improve its pharmacokinetic and pharmacodynamic properties (including increasing nuclease resistance). ATTORNEY ARGUMENTS CANNOT TAKE THE PLACE OF EVIDENCE The arguments of counsel cannot take the place of evidence in the record. In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965). Examples of attorney statements which are not evidence and which must be supported by an appropriate affidavit or declaration include statements regarding unexpected results, commercial success, solution of a long-felt need, inoperability of the prior art, invention before the date of the reference, and allegations that the author(s) of the prior art derived the disclosed subject matter from the inventor or at least one joint inventor. See MPEP § 2145 generally for case law pertinent to the consideration of applicant’s rebuttal arguments. MPEP §716.01(c) That argument is further unpersuasive because a person of ordinary skill knows (and at least US131 and App538 demonstrate) that gapmer motifs are routinely applied to ASO sequences that inhibit various targets, which indicates that such motifs are not, as Applicant argues, applicable only to ASOs that inhibit a specific target but, rather, that applying such motifs is routine and conventional in the art of ASOs. Applicant argues that (p. 7 ¶4) the claimed compound exhibits an IC50 value of 67.9 nM which they assert is a dramatic improvement vs. the IC50 of the US518 compound. Those arguments are not persuasive because as discussed, US131 teaches that gapmer compounds are routinely used at a range of concentrations (see discussion of US131 Col 54 above) and an artisan would have expected that an ASO that comprises modified sugars would be more nuclease resistant and have a much lower IC50 than an unmodified compound. In addition, it was discussed in the preceding paragraphs that 67.9 nM IC50 is on the order of gapmer IC50s taught in the prior art. Note also that App536 teaches (¶952-953) 5-10-5 gapmers that exhibit 90% or greater inhibition and IC50 values (in two different cell types) on the order of 7-63 nM. That demonstrates that an IC50 of 67.9 nM is fully within the range of what an artisan would expect, contrary to Applicant’s assertion that 67.9 nM is an unexpected improvement in potency. Therefore those arguments are not persuasive. Applicant then argues that (p. 8 ¶2-4) App536 is directed to a different target. That is not persuasive because the improvements imparted by the gapmer motif have been addressed. Regarding Applicant’s arguments that App536 discloses ASOs with other motifs, those are not persuasive because US131 teaches the 5-10-5 motif and, of the various motifs Applicant describes, App536 explicitly claims the 5-10-5 motif (and only the 5-10-5 motif) which indicates that the 5-10-5 motif was preferred over any other variations. Therefore none of the arguments are persuasive and the 103 rejection is maintained. NSDP Applicant argues (pp. 9-10) the NSDP rejections over US558 and US580 because they say the Federal circuit stated that "the purpose of the ODP doctrine ... is to prevent patentees from obtaining a second patent on a patentably indistinct invention to effectively extend the life of a first patent to that subject matter." Applicant states that US558 and US580 are later filed, they would expire after the claimed invention would expire (if granted), so the NSDP rejection should be withdrawn. That is not persuasive because a patent is also about a right to exclude. The instant claims, if allowed, would improperly extend the "right to exclude" already granted in the issued patents. The subject matter claimed in the instant application either anticipates, is anticipated by, makes obvious, or would have been obvious in view of the issued patent(s) or the issued patent(s) and the prior art, as discussed in each NSDP rejection. Furthermore, there is no apparent reason why applicant was prevented from presenting claims corresponding to those of the instant application during prosecution of the application(s) which matured into a patent. See In re Schneller, 397 F.2d 350, 158 USPQ 210 (CCPA 1968). See also MPEP § 804. Information in the § about Terminal Disclaimers touches on the right to exclude (MPEP 804.02[IV]): Each one of the commonly owned conflicting nonstatutory double patenting references must be included in the terminal disclaimer to avoid the problem of dual ownership of patents to patentably indistinct inventions in the event that the patent issuing from the application being examined ceases to be commonly owned with any one of the double patenting references that have issued or may issue as a patent. Note that 37 CFR 1.321(c)(3) requires that a terminal disclaimer for commonly owned conflicting claims "[i]nclude a provision that any patent granted on that application or any patent subject to the reexamination proceeding shall be enforceable only for and during such period that said patent is commonly owned with the application or patent which formed the basis for the judicially created double patenting." Filing a terminal disclaimer including each one of the conflicting nonstatutory double patenting references is also necessary to avoid the problem of separate enforcement of patents to patentably indistinct inventions by parties to a joint research agreement. MPEP 804.02(IV) For those reasons, Applicant’s arguments are unpersuasive and the NSDP rejections are maintained. Conclusion No claim is allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. RUTHIE S ARIETI Examiner (Ruth.Arieti@uspto.gov) Art Unit 1635 /RUTH SOPHIA ARIETI/Examiner, Art Unit 1635 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jul 30, 2021
Application Filed
Jun 25, 2025
Non-Final Rejection — §103, §DP
Oct 30, 2025
Response Filed
Jan 15, 2026
Final Rejection — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12594349
COMPOSITIONS AND METHODS FOR THE TARGETING OF PCSK9
2y 5m to grant Granted Apr 07, 2026
Patent 12584134
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 24, 2026
Patent 12540324
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Feb 03, 2026
Patent 12540326
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Feb 03, 2026
Patent 12534728
RNAi Agents for Inhibiting Expression of 17beta-HSD Type 13 (HSD17B13), Compositions Thereof, and Methods of Use
2y 5m to grant Granted Jan 27, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+72.7%)
2y 7m
Median Time to Grant
Moderate
PTA Risk
Based on 81 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month